|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, 15 January 2008, Vol. 111, No. 2, pp. 525-533. Prepublished online as a Blood First Edition Paper on October 15, 2007; DOI 10.1182/blood-2007-02-072207.
CHEMOKINES, CYTOKINES, AND INTERLEUKINS Critical role for Rsk2 in T-lymphocyte activation1 Laboratory of Molecular Immunology, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD
During T-cell activation, a number of cytokine-activated signaling cascades, including the Jak-STAT, phosphoinositol 3-kinase (PI 3-kinase), and mitogen-activated protein kinase (MAPK) pathways, play important roles in modulating the expression of target genes and mediating a cellular response. We now report that interleukin 2 (IL-2) and IL-15, but not IL-7, rapidly activate the p90 ribosomal S6 kinases, Rsk1 and Rsk2, in human T lymphocytes. Surprisingly, mouse spleen T cells transduced with either the wild-type or a dominant-negative (DN) Rsk2-expressing retrovirus could not be recovered, in contrast to the normal survival of T cells transduced with retroviruses expressing wild-type or DN mutants of Rsk1 or Rsk3. Examination of Rsk2 knockout (KO) mice revealed normal T-cell development, but these T cells had delayed cell-cycle progression and lower production of IL-2 in response to anti-CD3 and anti-CD28 stimulation in vitro. Moreover, Rsk2 KO mice had defective homeostatic T-cell expansion following sublethal irradiation in vivo, which is known to involve T-cell receptor (TCR), IL-2, and/or IL-15 signals, each of which we demonstrate can rapidly and potently activate Rsk2 in mouse T cells. These results indicate an essential nonredundant role of Rsk2 in T-cell activation.
Interleukin-2 has pleiotropic actions on T cells, B cells, and natural killer (NK) cells.1–5 Three IL-2 receptor subunits have been identified, including the IL-2 receptor  chain (IL-2R), IL-2Rβ, and the common cytokine receptor  chain, c.1–3 High-affinity (IL-2R/IL-2Rβ/c) and intermediate-affinity (IL-2Rβ/c) IL-2 receptors are functional receptors, whereas low-affinity (IL-2R) receptors are not.1–3 Interestingly, IL-2Rβ is also shared by the IL-15 receptor, whereas c is also shared by the receptors for IL-4, IL-7, IL-9, IL-15, and IL-21,6,7 and is the protein whose gene is mutated in humans with X-linked severe combined immunodeficiency (XSCID).8
Like other type 1 cytokine receptor proteins, IL-2Rβ and One of the serine kinase pathways activated by IL-2 is the Ras-MAP kinase pathway, which is widely used by growth factors, hormones, neurotransmitters, and stress stimuli,12 and within the immune system, this pathway is activated via antigen receptors as well as cytokines, and is known to be essential for the development, differentiation, and function of T cells.4,13–16 Interestingly, mitogen-activated protein kinases (MAPKs) are found in both the cytoplasm and nucleus,17 and this dual localization is shared by 85 kDa to 92 kDa serine/threonine kinases downstream of MAPKs that are known as p90 ribosomal S6 kinases (p90Rsks).17 These latter kinases have 2 catalytic domains,18,19 and simultaneous mutation of both adenosine triphosphate (ATP) binding sites abrogates kinase activity20 and results in a dominant-negative mutant. Full catalytic activity of Rsks requires activation by both extracellular signal-regulated kinase (ERK)21,22 and PDK1 (3-phosphoinositide–dependent protein kinase 1).23,24
Rsk family kinases have multiple cellular functions. They are involved in the phosphorylation of histone H3 and remodeling of chromatin in response to epidermal growth factor (EGF)25 and can regulate gene expression by phosphorylating transcription factors, including c-Fos,26,27 cAMP-response element-binding protein (CREB),28–30 CREB-binding protein,31,32 estrogen receptor,33 ATF4,34 NFATc4,35 and NF- We now show that IL-2 and IL-15 rapidly activate Rsk1 and Rsk2 in human T cells. Moreover, our data indicate a nonredundant role for Rsk2 in TCR/cytokine signaling based on expression of various Rsk constructs as well as analysis of Rsk2-deficient mice.
Cell culture Human peripheral blood lymphocytes (PBLs) were isolated from healthy donors using Ficoll-Hypaque, and T cells were enriched using nylon wool. Cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum (FBS; HyClone, Logan, UT), 2 mM glutamine, 100 U/mL penicillin and streptomycin (complete medium), and 2 µg/mL phytohemmaglutinin (PHA; Boehringer Mannheim, Mannheim, Germany) for 2 days and maintained in complete medium with 20 U/mL recombinant (r) IL-2 (Roche, Indianapolis, IN). NK-like YT cells44 were grown in complete RPMI-1640 medium and 293T+ cells in complete Dulbecco modified Eagle medium (DMEM). Plasmids, oligonucleotides, and mutagenesis pRV is a bicistronic murine stem cell leukemia retroviral expression vector.45 pCL-Eco is a retroviral packaging vector plasmid.46 Mouse Rsk1, Rsk2, and Rsk3 retroviral vectors were generated by polymerase chain reaction (PCR) amplification from cDNAs using PfuUltra II Fusion HS DNA Polymerase (Stratagene, La Jolla, CA) or AccuPrime Taq DNA Polymerase High Fidelity (Invitrogen, Carlsbad, CA) and primers including the Kozak consensus sequence 5' to each ATG, with XhoI sites (for Rsk1 and Rsk2) or SalI sites (for Rsk3) at 5' and 3' ends, and subcloned into the XhoI site of pRV. Correct orientations and sequences were confirmed by DNA sequencing. Dominant-negative (DN) Rsk mutants were generated using oliogonucleotide-mediated (Table 1) site-directed mutagenesis (Stratagene) to replace K94 and K447 in Rsk1, K100 and K451 in Rsk2, and K91 and K444 in Rsk3 with alanines.20
Antibodies, immunoprecipitation, Western blotting, and in vitro kinase assay Antibodies to Rsk1 (C-21), Rsk2 (C-19 and E-1), Rsk3 (C20), pRsk (T359/S363), pRsk (T577), Erk (K23), Actin (I19), and antiphosphotyrosine antibody (pY99) were from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-Stat5 monoclonal antibody was from Transduction Laboratories (Lexington, KY). Antibodies for human Stat5a and Stat5b were described elsewhere.47 For immunoprecipitation and Western blotting,48 cells were washed in cold phosphate-buffered saline (PBS) and lysed in 50 mM Tris, pH 7.0, 150 mM NaCl, 0.5% NP40, 2.5 mM metabisulphite, 20 mM β-glycerophosphate, 0.5 mM Na3VO4, 5 mM benzamidine HCl, 20 mM NaF, and 1 mM AEBSF at 4°C for 30 minutes. Lysates were clarified by centrifugation at 25 000g at 4°C for 20 minutes. Immunoprecipitations were performed using 1 µg antibody and 40 µL rProtein-G agarose slurry (Invitrogen) or Goat ExactaCruz D IP Matrix (Santa Cruz Biotechnology), and then washed, resolved by 4% to 20% Nu-PAGE (Invitrogen), transferred to Immobilon-P membranes, blotted with indicated antibodies, and developed by enhanced chemiluminescence (ECL) reagent (Millipore, Billerica, MA).
For on-membrane in vitro kinase assays,49 total cell lysates were denatured, fractionated by 8% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE), transferred to PVDF membranes, denatured with 7 M guanidine HCl, and renatured on the membranes. After blocking with 5% bovine serum albumin (BSA), 30 mM Tris, pH 7.5, membranes were incubated with kinase buffer (30 mM Tris, pH 7.5, 10 mM MgCl2, 2 mM MnCl2) containing 50 µCi/mL [ Transfection of 293T+ cells and reporter assay
293T+ cells were cotransfected47 with a luciferase reporter containing 3 copies of the IL-2R Retroviral transduction and FACS analysis Retroviral supernatants were produced and mouse T cells transduced as described.51 pCL-Eco was cotransfected with WT or mutant pRV-Rsk1, pRV-Rsk2, or pRV-Rsk3, into 293T+ cells using Effectene (Qiagen). One day later, medium was changed to RPMI-1640 medium containing 7.5% fetal bovine serum (FBS), glutamine, streptomycin, and penicillin, and the cells incubated at 32°C. Retrovirus-containing supernatant was harvested 48 and 72 hours after transfection. Splenocytes were isolated from 8- to 12-week-old WT C57BL/6 mice and T cells were either enriched by panning with goat anti–mouse IgG (Sigma, St Louis, MO) or purified using CD90 magnetic beads (Miltenyi Biotec, Bergisch Gladbach, Germany), grown in complete RPMI medium containing 50 µM 2 ME, and activated with 5 µg/mL plate-bound anti-CD3 plus 1 µg/mL anti-CD28 for 24 hours. Activated T cells were transduced with viral supernatant in the presence of 4 µg/mL polybrene (Sigma), spinning at 713g for 45 minutes at 30°C, and grown in complete RPMI medium containing 2 µg/mL anti-CD3, 1 µg/mL anti-CD28, and 40 U/mL IL-2. A second retroviral transduction was performed 24 hours after the first, and the cells were grown in complete medium with 40 U/mL IL-2 for 2 to 3 days. One day after the second retroviral transduction, transduced T cells were identified by staining with anti-CD3 allophycocyanin (APC) and annexin V PE (BD Biosciences, San Jose, CA) and analyzed by FACSort using CellQuest software (BD Biosciences). To determine the retroviral titer, NIH3T3 cells were incubated with a range of volumes of the retroviral supernatant in the presence of 4 µg/mL polybrene overnight and grown in complete medium for an additional 24 hours before determining GFP+ cells using a FACSort (BD Biosciences, San Jose, CA). Analysis of Rsk2-deficient mice Wild-type C57BL/6 or Balb/c male mice used for mating were from the Jackson Laboratory (Bar Harbor, ME). All experiments were performed under protocols approved by the National Heart, Lung, and Blood Institute (NHLBI) Animal Use and Care Committee and followed the National Institutes of Health (NIH) guidelines for using animals in intramural research. Rsk2-deficient mice were generated at the NHLBI Mouse Core Facility using Rsk2–/– embryonic stem (ES) cells (provided by Dr Beverly H. Koller, University of North Carolina, and Dr Christian Bjorbaek, Harvard University), as described.52 Rsk2 KO mice were identified by PCR amplification using the following primers: Rsk2 5' primer, CTTGATGAAGAAGGTCACATCAAG; Rsk2 3' primer, AACTACTTCTGGAGCCATGTATTC; Neo 5' primer, ACAAGATGGATTGC ACGCAGGTTC; Neo 3' primer, TCTTCGTCCAGATCATCCTGATCG. Heterozygous female mice were backcrossed to C57BL/6 or Balb/c male mice for 5 to 9 generations. All Rsk2-deficient mice used were male, as Rsk2 is on the X chromosome.53
Thymic and splenic cellularities were determined. Total splenic T cells and CD4+ and CD8+ subpopulations were isolated from 6- to 12-week-old Rsk2-deficient mice and age-matched littermates. Cells were stimulated with plate-bound anti-CD3 (2 µg/mL) or plate-bound anti-CD3 (2 µg/mL) plus anti-CD28 (1 µg/mL) for 16 or 40 hours, followed by the measurement of mRNA levels for IL-2, IL-4, and IFN For in vitro proliferation experiments, 5,6-carboxyfluorescein diacetate-succinimyl ester (CFSE)–labeled T cells (purified by negative selection using a pan–T-cell isolation kit; Miltenyi Biotec) were stimulated by plate-bound anti-CD3 (2 µg/mL) plus anti-CD28 (1 µg/mL). Cell division of CD4+ and CD8+ T-cell subpopulations was measured by assessing CSFE dilution on days 1 to 4 by flow cytometric analyses of cells stained with CD4-CyChrom and CD8-APC. T-cell survival was determined using an Annexin V–PE Apoptosis Detection Kit (BD Pharmingen, San Diego, CA) on day 1 and day 2 after stimulation with plate-bound anti-CD3 (2 µg/mL) plus anti-CD28 (1 µg/mL). For homeostatic proliferation in vivo, 8- to 12-week-old WT or Rsk2-deficient mice were sublethally irradiated (600 Rad), and splenocyte recovery was evaluated 14 to 16 days later. Total splenocytes, T cells, and CD4+ and CD8+ T-cell subpopulations, as well as B220+, DX5+, Mac1+, Gr1+, and Ter119+ cells were evaluated by flow cytometry. For cytokine injection experiments, sublethally irradiated WT or Rsk2-deficient mice were intraperitoneally injected54 daily for 15 days with 10 µg IL-2, IL-15 in 0.2 mL PBS or 0.2 mL PBS and total splenocytes, T cells, or CD4+ and CD8+ T-cell subpopulations were evaluated by flow cytometry.
IL-2 and IL-15, but not IL-7, rapidly activate Rsk1 and Rsk2 in human T cells and YT cells
To identify serine/threonine kinase(s) that are activated by IL-2, an on-membrane in vitro kinase assay that preferentially detects serine/threonine protein kinases49 was performed. As shown in Figure 1A, a 78 kDa to 80 kDa major band was revealed in total cell lysate of YT cells and its activity was rapidly and markedly increased by IL-2 stimulation (Figure 1A lanes 2-4 vs lane 1). Bands of 16 kDa (not shown) and 50 kDa to 60 kDa were also detected, but IL-2 did not increase their intensities (Figure 1A). To try to identify the 78 kDa to 80 kDa putative kinase, we tested antibodies to Raf1, RafB, p70S6 kinase (p70S6K), p90Rsk1, p90Rsk2, and p90Rsk3, which are serine/threonine kinases with relatively similar molecular weights. Of these, complexes immunoprecipitated with antibodies to Rsk1, Rsk2, and Rsk3 exhibited basal kinase activity that was induced by IL-2 in YT cells (Figure 1B lanes 1-6) and primary human T cells (lanes 7-12), whereas IL-2 did not induce activation of Raf1, RafB, and p70S6K in this assay (not shown). However, evaluation of these Rsk antibodies revealed that antibodies to Rsk1 and Rsk2 were specific for endogenous and overexpressed Rsk1 and Rsk2 proteins (Figure S1A, available on the Blood website; see the Supplemental Materials link at the top of the online article), respectively, whereas the antibody to Rsk3 could also recognize endogenous Rsk2 (Figure S1A) as well as overexpressed Rsk1 and Rsk2 (Figure S1A,B). We also examined 2 other cytokines whose receptors share
Rsks do not alter IL-2–dependent GAS-driven reporter activity but the WT and a DN Rsk2 mutant failed to transduce mouse T cells To further evaluate the biologic significance of IL-2–induced phosphorylation of the Rsks, we generated retroviruses expressing wild-type (WT) or DN mutants of Rsk1, Rsk2, and Rsk3, with similar viral titers and expression levels in 293T+ cells (not shown). Infected GFP+ T cells were readily recovered from Rsk1, Rsk3, DN-Rsk1, and DN-Rsk3, but unexpectedly, essentially no GFP+ cells were recovered from T cells transduced with either the WT Rsk2 or a DN Rsk2 mutant (Figure 2A,B). The same retroviral supernatants could infect NIH3T3 cells with similar efficiency (Figure 2C), indicating that all these retroviral constructs could produce comparable levels of infectious viral particles in 293T+ cells. Although the basis for the effect of the Rsk2 is unknown, it is presumably independent of Stat5a phosphorylation, as neither the WT Rsk2 nor the DN Rsk2 affected Stat5-dependent reporter activity (Figure 2D).
Rsk2 is required for T-cell proliferation in vitro and homeostatic proliferation in vivo
Given the unexpected lack of recovery of T cells transduced with either WT or DN Rsk2, to further analyze the role of Rsk2 on cell proliferation/survival, we next regenerated Rsk2 KO mice52 from Rsk2 KO ES cells. As expected, T cells from Rsk2 KO mice did not express Rsk2 but expressed similar levels of Rsk1, Rsk3, and Erk as their WT littermates (Figure S1A). These mice and WT littermates had similar cellularity and CD4/CD8 flow cytometric profiles in the thymus (Figure 3A) as well as similar numbers of T, B, and NK cells and CD4+, CD8+, and CD4+/CD25+ T-cell subpopulations in the spleen (Figure 3B). This indicates that Rsk2 is dispensable for normal lymphocyte development. Interestingly, however, when CFSE-labeled T cells were stimulated in vitro by anti-CD3 plus anti-CD28, both CD4+ and CD8+ T cells from Rsk2 KO mice had delayed cell division as compared with cells from WT littermates. This effect was evident at days 2 and 3 (Figure 4A-B), but not at day 4 (Figure 4B), indicating that Rsk2 contributes to the early phase of T-cell proliferation in response to stimulation with anti-CD3 plus anti-CD28. In addition, there was no increased apoptosis in either CD4 or CD8 T cells from Rsk2 KO mice after stimulation with anti-CD3 plus anti-CD28 (Figure 4C,D). Because of this delayed TCR-induced proliferation, we hypothesized that Rsk2 might be required for optimal production of IL-2. Indeed, stimulation of Rsk2 KO CD4+ T cells with anti-CD3 or anti-CD3 plus anti-CD28 resulted in diminished induction of IL-2 mRNA (Figure 5A) and with anti-CD3 plus anti-CD28 resulted in lower production of IL-2 protein (Figure 5B). In contrast, IL-4 mRNA (Figure 5C) and IFN
In view of the diminished cell-cycle progression observed in vitro (Figure 4A-B), we next investigated whether Rsk2 is also involved in the lymphopenia-mediated homeostatic proliferation of T cells in vivo. Mice were sublethally irradiated (600 rad) and then the recovery of cellular populations in the spleen was analyzed 16 days later. Total splenocytes were unexpectedly higher in irradiated Rsk2 KO mice than in WT mice (Figure 6A), but this apparently resulted, at least in part, from an increase in Ter119+ cells (Figure 6I). The basis for the increase in those erythroid lineage cells is unclear and an area for future investigation. The recovery of total T cells (Figure 6B) as well as both CD4 (Figure 6C) and CD8 (Figure 6D) subpopulations was significantly lower in irradiated Rsk2 KO mice than in WT mice, whereas there was no statistically significant difference in the recovery of B cells, NK cells, Gr1+ cells, and Mac1+ cells (Figure 6E-H). These data reveal a role for Rsk2 in the homeostatic proliferation of CD4+ and CD8+ T cells in vivo.
It is well known that signals for TCR activation and for IL-7 and IL-15 play vital roles in homeostatic proliferation of T cells in vivo.55,56 In addition to IL-2, anti-CD3 plus anti-CD28 and IL-15 can rapidly and potently activate Rsk2 in both mouse (Figure 7A lanes 2-4 vs lane 1) and human T cells (lanes 7-10 vs lane 6), whereas IL-7 did not (lanes 5 and 11). As expected, IL-2, IL-15, and IL-7 readily activated Stat5 in mouse (Figure 7C lanes 3-5 vs lane 1) and human T cells (lanes 9-11 vs lane 6) whereas antigen stimulations did not (lanes 2, 7, and 8). After sublethal irradiation, the number of total T cells in Rsk2 KO mice was lower as compared with WT mice, even with intraperitoneal injection with IL-2 or IL-15 (Figure 8A). However, these cytokines had some effect on total cellularity, with IL-2 having a grater effect on CD4+ T cells (Figure 8B) and IL-15 having a great effect on CD8+ T cells (Figure 8C). The ex vivo mRNA expression levels for IL-2, IL-15, and IL-7 in spleen and bone marrow were similar in WT and Rsk2 KO mice (Figure 8D-F), indicating that Rsk2 is not required for the basal expression of these cytokines in vivo. Thus, defective IL-2–, IL-15–, or TCR-mediated activation of Rsk2 may provide at least a partial explanation for the defective homeostatic proliferation of T cells in the Rsk2-deficient mice.
Although Rsk family proteins have been extensively studied, little is known of their role or roles in the immune system. We now report that Rsk1 and Rsk2 are catalytically activated by stimulation with TCR, IL-2, and IL-15 in T cells. Unexpectedly, primary splenic T cells transduced with this DN Rsk2 mutant could not be recovered, whereas cells expressing DN forms of Rsk1 and Rsk3 were readily recovered. Thus, Rsk2 appears to play an essential role in T-cell activation at least for cellular growth/survival. The inability to recover T cells after retroviral transduction with WT or DN Rsk2 prevented our using this approach to further evaluate the function of Rsk2 in normal T cells. Both Erk1/2 and PDK1 are upstream of p90Rsks and are essential for the full activation of p90Rsks in response to extracellular stimuli. The vital roles of Erk1/2 and PDK1 in development and cellular functions have been demonstrated in knockout mice. Erk1 KO mice have defective thymocyte maturation and TCR-mediated thymocyte proliferation is severely impaired,57 whereas Erk2 and PDK1 KO mice are embryonic lethal.58–60 Interestingly, deleting PDK1 in T cells blocks thymocyte differentiation whereas hypomorphic expression allows thymocyte differentiation but blocks thymocyte expansion.61 Given the roles of Erk and PDK1 for activating all the Rsks, it is not surprising that the abnormalities in the Rsk2 KO mice are less severe than those in the Erk and PDK1-deficient mice. In this study, we showed that T, B, and NK cells from Rsk2 KO mice developed normally but that there is defective TCR-induced IL-2 production as well as a defect in homeostatic proliferation. Stimulation via the T-cell receptor, IL-7, and IL-15 can contribute to homeostatic proliferation55,56 and indeed we found that anti-CD3 plus anti-CD28 and IL-15 activated Rsk2 at least as potently as did IL-2 in both human and mouse T cells, which may partially explain the defect in homeostatic proliferation of T cells observed in Rsk2 mice upon sublethal irradiation. In contrast to IL-2 and IL-15, IL-7 did not activate Rsk2, which is consistent with previous reports that IL-7 does not activate the ERK/MAP kinase pathway in IL-7–dependent T-cell lines.62,63 Additional work is required to identify the specific critical substrates for Rsk2 and/or other functions for this protein to clarify the mechanistic basis. In summary, we have identified Rsk1 and Rsk2 as kinases that are activated by stimulation with anti-CD3 plus anti-CD28, IL-2, and IL-15, but not IL-7, and for the first time provided data indicating a critical role for Rsk2 in T-cell activation, with actions related to both cytokine and TCR signaling.
Contribution: J.-X.L. and R.S. designed and performed research, collected and analyzed data, and wrote the paper; W.J.L. designed research, analyzed data, and wrote the paper. Conflict of interest disclosure: The authors declare no competing financial interests. Correspondence: Warren J. Leonard, NHLBI, NIH, Bldg 10, Rm 7B05, 10 Center Dr, Bethesda, MD 20892-1674; e-mail: wjl{at}helix.nih.gov.
We thank Dr Hai-Hui Xue (National Heart, Lung, and Blood Institute [NHLBI]) for his valuable insights and suggestions; Drs Kuan-Teh Jeang (National Institute of Allergy and Infectious Diseases [NIAID]), Keji Zhao (NHLBI), and Larry E. Samelson (National Cancer Institute [NCI]) for their critical comments on the manuscript; Drs Robert L. Erickson for plasmid encoding for mouse Rsk2, Kenneth M. Murphy for pRV, and Inder M. Verma for pCL-Eco; Larry E. Samelson for his suggestion to use an on-membrane in vitro kinase assay; Chengyu Liu (Transgenic Core Facility, NHLBI) for regenerating Rsk2 KO mice; Hyok Joon Kwon for intraperitoneal injection; and Ms Constance Robinson for maintaining the mouse colony. This work was supported by the Intramural Research Program of the NHLBI, NIH.
Submitted February 5, 2007; accepted October 5, 2007.
Prepublished online as Blood First Edition Paper, October 15, 2007
DOI: 10.1182/blood-2007-02-072207
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 USC section 1734.
  CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2008 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
B/I
