Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 15 January 2008, Vol. 111, No. 2, pp. 534-536.
Prepublished online as a Blood First Edition Paper on October 23, 2007; DOI 10.1182/blood-2007-05-090928.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Table
Right arrow All Versions of this Article:
blood-2007-05-090928v1
111/2/534    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mezger, M.
Right arrow Articles by Loeffler, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mezger, M.
Right arrow Articles by Loeffler, J.
Related Collections
Right arrow Brief Reports
Right arrow Chemokines, Cytokines, and Interleukins
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

CHEMOKINES, CYTOKINES, AND INTERLEUKINS

Brief Report

Polymorphisms in the chemokine (C-X-C motif) ligand 10 are associated with invasive aspergillosis after allogeneic stem-cell transplantation and influence CXCL10 epression in monocyte-derived dendritic cells

Markus Mezger1, Michael Steffens2, Melanie Beyer1, Carolin Manger1, Johannes Eberle1, Mohammad-Reza Toliat3, Thomas F. Wienker2, Per Ljungman4, Holger Hebart5, Hans Jürgen Dornbusch6, Hermann Einsele1, and Juergen Loeffler1

1 Julius-Maximilians-Universität Würzburg, Medizinische Klinik und Poliklinik II, Würzburg, Germany; 2 Institut für Medizinische Biometrie, Informatik, und Epidemiologie der Rheinischen Friedrich-Wilhelms-Universität, Bonn, Germany; 3 Cologne Centre for Genomics, Cologne, Germany; 4 Karolinska University Hospital/Huddinge, Stockholm, Sweden 5 Universitätsklinikum Tübingen, Medizinische Klinik II, Tübingen, Germany, and 6 Universitätsklinik für Kinder- und Jugendheilkunde, Graz, Austria


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results and discussion
 Authorship
 References
 
Patients after allogeneic stem-cell transplantation (alloSCT) have an increased risk for invasive aspergillosis (IA). Here, recipients of an allograft with IA (n = 81) or without IA (n = 58) were screened for 84 single nucleotide polymorphisms in 18 immune relevant genes. We found 3 markers in chemokine (C-X-C motif) ligand 10 (CXCL10, 4q21, 11 101 C > T, P = .007; 1642 C < G, P = .003; –1101 A < G, P = .001) significantly associated with an increased risk of developing IA. Furthermore, immature dendritic cells (iDCs) exposed to Aspergillus fumigatus germlings showed markedly higher CXCL10 expression, if carrying the wild type genotype, compared with the "CGAG" high risk haplotype. In addition, serum from patients with proven/probable IA showed increased serum levels of CXCL10, compared with immunocompromised patients without IA. Thus, polymorphisms in CXCL10 determine chemokine secretion by iDCs upon exposure to A fumigatus and most likely thereby genetically determine the risk of IA after alloSCT.


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results and discussion
 Authorship
 References
 
Infections with Aspergillus fumigatus are frequent and life threatening in patients after allogeneic stem-cell transplantation (alloSCT).1 Several single nucleotide polymorphisms (SNPs) were described influencing the course and outcome of invasive aspergillosis (IA). Kesh and colleagues revealed an association of IA with polymorphisms in Toll-like receptor genes TLR1 and TLR6, whereas no association could be found for the TLR4 gene.2 In addition, it has been shown that polymorphisms in mannan-binding lectin (MBL) contribute to the occurrence of allergic bronchopulmonary aspergillosis (ABPA) by influencing the MBL plasma level and protein activity.3 Besides MBL, further SNPs in C-type lectins were investigated leading to the identification of an association between ABPA and variants of the surfactant protein A2 gene (SFPTPA2).4 In contrast, alleles with a protective role in the pathogenesis of IA were discovered in the promoter region of IL10.5


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results and discussion
 Authorship
 References
 
This study was approved by the local ethics committees involved in the study (University of Innsbruck, Innsbruck, Austria; University of Graz, Graz, Austria; Karolinska University Hospital, Stockholm, Sweden; and Medical Hospital II, Tübingen, Germany).

Patient and sampling data

After approval of the local ethics committees, each consecutive patient who underwent alloSCT and who showed complete donor chimerism at the time of blood collection (as determined by short tandem repeat markers6) was asked for study participation. After informed consent was obtained in accordance with the Declaration of Helsinki, blood samples from 139 consecutive patients were collected between day +20 and day +50 after alloSCT. Patients suffered from acute myeloid leukemia (n = 57), chronic myeloid leukemia (n = 26), acute lymphatic leukemia (n = 20), multiple myeloma (n = 11), and other hematologic disorders (n = 25). Sampling was performed at the University of Innsbruck, Innsbruck, Austria (n = 16), University of Graz, Graz, Austria (n = 26), Karolinska University Hospital, Stockholm, Sweden (n = 13), and Medical Hospital II, Tübingen, Germany (n = 84). All patients were of European origin (median age 37y, range [7-61y], 82/139 males). Patients after alloSCT either developed proven or probable IA (as defined by the European Organization for Research and Treatment of Cancer/Invasive Fungal Infections Co-operative Group (EORTC-IFICG)/ National Institute of Allergy and Infectious Diseases/Mycoses Study Group (NIAID/MSG),7 n = 81) whereas controls (alloSCT patients without IA, n = 58) did not fulfil these criteria.

According to a case-control study design, samples were analyzed for association between an increased risk for IA and defined genetic markers (n = 84) in 18 genes (Table S1, available on the Blood website; see the Supplemental Materials link at the top of the online article). Genes were chosen for being differentially regulated in genome-wide expression profiling studies in cocultures of A fumigatus with immature dendritic cells (iDCs) or for being generally relevant for regulation of immune defense mechanisms. Retrospective genotyping was carried out as previously described on DNA from each patient who had given consent.8

The following clinical risk factors were tested for an association to IA: (1) selection of CD34+ cells before alloSCT, (2) corticosteroid therapy with a dosage of more than 2 mg/kg body weight, (3) severe acute graft-versus-host disease (aGVHD), grade II – IV, (4) cytomegalovirus disease (HCMV), and (5) respiratory virus (RV) infection. HCMV disease was defined by Ljungman et al,9 RV infection was defined as influenza A, influenza B, human parainfluenza 1-3, adenovirus, and respiratory syncytial virus detection by culture or reverse transcriptase–polymerase chain reaction (RT-PCR) assay.10

In a preliminary, add-on study, 1 mL serum from further consecutive patients after alloSCT, (each patient who agreed to participate was included, n = 33, median age 52 years, range [23-64 years], 19/33 males) and from randomly selected laboratory workers (n = 14, median age 28 years, range [23-41 years], 6/14 males) was collected for quantification of CXCL10 levels by ELISA (R&D Systems, Wiesbaden, Germany). Patients suffered from proven or probable IA (6/33) or showed no clinical signs of infection (27/33).

Statistical analysis

Allele and genotype frequencies were compared between patients with IA and controls using Allele-Frequency-Difference-Test and Armitage Trend Test, respectively. P values less than .01 were considered to be significant. All markers were tested for Hardy-Weinberg equilibrium using the chi square test statistics with one degree of freedom, or an exact test in case of low expectation values (< 5). For 4 markers in CXCL10, haplotype analysis was performed with the program FAMHAP8,11 (version 16; Dr Tim Beder, University of Bonn, Institut für Medizinische Biometrie, Informatik und Epidemiologie, Bonn, Germany) and the overall significance for the haplotype block was calculated based on a permutation based procedure to correct for multiples testing. CXCL10 serum levels were analyzed with the Wilcoxon test.

Analysis of CXCL10 expression upon stimulation with A fumigatus

Isolation of monocytes (obtained from the laboratory workers mentioned above) and differentiation into iDCs was achieved as described before.12 Cocultivation of A fumigatus germlings (ATCC 9197) with iDCs was carried out for 5hours. CXCL10 expression was analyzed by real-time PCR assay13 using the following primers (F: acgtgttgagatcattgctacaa, R: gattttgctcccctctggt) and probes (P1: agtaaattcttgatggccttcgattct, P2: gattcagacatctcttctcacccttctttt, TIB MOLBIOL, Berlin, Germany). Results were normalized against the housekeeping gene 5-aminolevulinate synthase.14


    Results and discussion
 Top
 Abstract
 Introduction
 Methods
 Results and discussion
 Authorship
 References
 
DNA specimens of 139 patients after alloSCT were screened for defined polymorphisms. The single marker analyses revealed no association with an increased risk for IA for 80 of the 84 genetic markers (Table S1). However, 3 SNPs in CXCL10 (rs1554013, rs3921, and rs425767415) and one marker in IFN-{gamma} (rs2069705) showed a significant association with the occurrence of IA (P < .01, Table 1).


View this table:
[in this window]
[in a new window]

 
Table 1. Genotyped polymorphisms in CXCL10 and statistical analysis

 
Haplotype analysis for the 3 markers in CXCL10 [rs1554013 (C/T), rs3921 (C/G), rs4859588 (A/G)] and the IFN-{gamma} marker rs4257674 (A/G, located in a potential negative regulatory site) confirmed the single marker analysis and identified "CGAG" as the high risk haplotype (significance of the haplotype block: P = .008).

There is currently no consensus on how to adjust the level of significance in exploratory epidemiologic studies. The Bonferroni correction for multiple testing is often considered too conservative. In this study, P values less than .01 were considered to be significant for single marker analysis, but it cannot be excluded that even P values less than .05 can be regarded as indicators for an association with the occurrence of IA.16,17 We believe that multiple occurrence of several markers with low (P < .01) P values in one gene region and a significant P value of the haplotype analysis corrected for multiple testing give strong evidence of a true association.

CXCL10 is an inflammatory mediator, induced by IFN-{gamma}, which stimulates the directional migration of Th1 cells as well as increasing T-cell adhesion to endothelium.17 Antigen-specific proliferation of T cells occurred in healthy individuals and in patients surviving IA, indicating that T-lymphocytes play a pivotal role in fungal clearance.19 Furthermore, Th1/Th2 deregulation and a switch to Th2 immune response may contribute to an unfavorable outcome of IA.19

Serum levels of CXCL10 were compared in patients after alloSCT and in healthy individuals. In sera from patients who survived proven or probable IA (mean 998 pg/mL, range [753-1445 pg/mL], P = .002) as well as in specimens from patients without signs of infection (mean 554 pg/mL, range [151-1030 pg/mL], P = .004), CXCL10 levels were significantly higher compared with healthy controls (mean 102 pg/mL, range [28-372 pg/mL]).

To study the role of A fumigatus for CXCL10 induction, A fumigatus germlings were cocultured with iDCs generated from blood of healthy volunteers. Stimulation with A fumigatus augmented CXCL10 expression, dependent on the respective genoptype. In iDCs carrying the wild type alleles, CXCL10 expression increased notably [53.4x-335.5x], whereas in iDCs with the identified risk haplotype, expression ranged between 1.5x and 35.8x only. In the mean, markedly higher mRNA levels (9.3x) could be detected in iDCs carrying the wild type haplotype. These observations confirm the relevance of the risk haplotype "CGAG" for CXCL10 production and support the role of CXCL10 for effective immune defense against A fumigatus.

Table 2 shows the odds ratios of the clinical risk factors analyzed. Although most of them are not statistically significant, they point in the expected direction of being associated with A fumigatus infection. We suppose that lower P values might have been found in larger patient cohorts, as demonstrated by Upton et al in 405 cases.20 We found an especially strong association for the occurrence of RV infections (P = .004) with A fumigatus infection. This observation confirms data from Marr et al, who assumed that increased risk may be related to effects on pulmonary phagocyte function.21


View this table:
[in this window]
[in a new window]

 
Table 2. Correlation between defined clinical parameters and patients with or without proven/probable IA after alloSCT

 
Only a few reports exist about an association of SNPs with susceptibility to IA, including markers in mannose-binding lectin and TLR genes.2,3,22 In contrast to Bochud et al, who showed that a distinct haplotype in TLR4 increased the risk of mould infections, our analyses did not show an association between polymorphisms in TLR4 (n = 5) and the probability of IA.23

In conclusion, screening of patients after alloSCT for the presence of defined alleles in CXCL10 might have an impact on early identification of patients at risk for the development of IA, and thus on individualization of antifungal prophylaxis and treatment. A prospective study, evaluating treatment / prophylaxis strategies based on genetic polymorphisms in CXCL10, is under development.


    Authorship
 Top
 Abstract
 Introduction
 Methods
 Results and discussion
 Authorship
 References
 
Contribution: M.M. performed research, analyzed data, and wrote; the manuscript; M.S. and T.F.W. performed data analysis; M.B. performed research and data analysis; C.M.J.E. and M.R.T. performed research; P.L. and H.J.D. collected data; H.H. and H.E. designed research; and J.L. designed research, analyzed data, and wrote the manuscript.

Conflict-of-interest disclosure: The authors declare no competing financial interests.

Correspondence: Dr Juergen Loeffler, Medizinische Klinik & Poliklinik II, Josef-Schneider-Str. 2, 97070 Würzburg, Germany; e-mail: loeffler_j{at}klinik.uni-wuerzburg.de.


    Acknowledgments
 
We thank Dr Oliver Morton, Trinity College, Dublin, Ireland, for correction of the English language, and all volunteers for their generous blood donations.

This study was supported by research funding from the National Genomic Research Network, the European Union (EU) project The Development of Immunotherapeutic Strategies to Treat Haematologic and Neoplastic Diseases on the Basis of Optimised Allogeneic Stem Cell Transplantation (Allostem; LSHB-CT-2004-503319), the Infectious Diseases Working Party of the European Group for Blood and Marrow Transplantation (EBMT-IDWP), and the EuroNet Leukemia (Contract No. LSH-2002-2.2.0-3; Strengthen and develop scientific and technologic excellence in research and therapy of leukemia [CML, AML, ALL, CLL, MDS, CMPD] by integration of the leading national leukemia networks and their interdisciplinary partner groups in Europe; Project No. 503216).


    Footnotes
 
Submitted May 16, 2007; accepted September 28, 2007.

Prepublished online as Blood First Edition Paper, October 23, 2007 DOI: 10.1182/blood-2007-05-090928

The online version of this article contains a data supplement.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 USC section 1734.


    References
 Top
 Abstract
 Introduction
 Methods
 Results and discussion
 Authorship
 References
 

  1. Einsele H and Hebart H. Cellular immunity to viral and fungal antigens after stem cell transplantation. Curr Opin Hematol 2002; 9:485–489.[CrossRef][Medline] [Order article via Infotrieve]

  2. Kesh S, Mensah NY, Peterlongo P, et al. TLR1 and TLR6 polymorphisms are associated with susceptibility to invasive aspergillosis after allogeneic stem cell transplantation. Ann N Y Acad Sci 2005; 1062:95–103.[CrossRef][Medline] [Order article via Infotrieve]

  3. Kaur S, Gupta VK, Shah A, Thiel S, Sarma PU, Madan T. Elevated levels of mannan-binding lectin (MBL) and eosinophilia in patients of bronchial asthma with allergic rhinitis and allergic bronchopulmonary aspergillosis associate with a novel intronic polymorphism in MBL. Clin Exp Immunol 2006; 143:414–419.[CrossRef][Medline] [Order article via Infotrieve]

  4. Madan T, Kaur S, Saxena S, et al. Role of collectins in innate immunity against aspergillosis. Med Mycol 2005; 43:155–163.[CrossRef]

  5. Seo KW, Kim DH, Sohn SK, et al. Protective role of interleukin-10 promoter gene polymorphism in the pathogenesis of invasive pulmonary aspergillosis after allogeneic stem cell transplantation. Bone Marrow Transplant 2005; 36:1089–1095.[CrossRef][Medline] [Order article via Infotrieve]

  6. Thiede C, Bornhäuser M, Ehninger G. Evaluation of STR informativity for chimerism testing–comparative analysis of 27 STR systems in 203 matched related donor recipient pairs. Leukemia 2004; 18:248–254.[CrossRef][Medline] [Order article via Infotrieve]

  7. Ascioglu S, Rex JH, de Pauw B, et al. Defining opportunistic invasive fungal infections in immunocompromised patients with cancer and hematopoietic stem cell transplants: an international consensus. Clin Infect Dis 2002; 34:7–14.[CrossRef][Medline] [Order article via Infotrieve]

  8. Loeffler J, Steffens M, Arlt EM, et al. Polymorphisms in the genes encoding chemokine receptor 5, interleukin-10, and monocyte chemoattractant protein 1 contribute to cytomegalovirus reactivation and disease after allogeneic stem cell transplantation. J Clin Microbiol 2006; 44:1847–1850.[Abstract/Free Full Text]

  9. Ljungman P, Griffiths P, Paya C. Definitions of cytomegalovirus infection and disease in transplant recipients. Clin Infect Dis 2002; 34:1094–1097.[CrossRef][Medline] [Order article via Infotrieve]

  10. Roghmann M, Ball K, Erdman D, Lovchik J, Anderson LJ, Edelman R. Active surveillance for respiratory virus infections in adults who have undergone bone marrow and peripheral stem cell transplantation. Bone Marrow Transplant 2003; 32:105–1088.

  11. Becker T and Knapp M. A powerful strategy to account for multiple testing in the context of haplotype analysis. Am J Hum Genet 2004; 75:561–570.[CrossRef][Medline] [Order article via Infotrieve]

  12. Grigoleit U, Riegler S, Einsele H, et al. Human cytomegalovirus induces a direct inhibitory effect on antigen presentation by monocyte-derived immature dendritic cells. Br J Haematol 2002; 119:189–198.[CrossRef][Medline] [Order article via Infotrieve]

  13. Loeffler J, Swatoch P, Akhawi-Araghi D, Hebart H, Einsele H. Automated RNA extraction by MagNA Pure followed by rapid quantification of cytokine and chemokine gene expression with use of fluorescence resonance energy transfer. Clin Chem 2003; 49:955–958.[Free Full Text]

  14. Johnson MR, Wang K, Smith JB, Heslin MJ, Diasio RB. Quantitation of dihydropyrimidine dehydrogenase expression by real-time reverse transcription polymerase chain reaction. Anal Biochem 2000; 278:175–184.[CrossRef][Medline] [Order article via Infotrieve]

  15. National Center for Biotechnology Information, US National Library of Medicine. www.ncbi.nlm.nih.gov/projects/SNP Accessed April 2007.

  16. Feise RJ. Do multiple outcome measures require p-value adjustment? BMC Med Res Methodol 2002; 2:8–11.[CrossRef][Medline] [Order article via Infotrieve]

  17. Rothman KJ. No adjustments are needed for multiple comparisons. Epidemiology 1990; 1:43–46.[Medline] [Order article via Infotrieve]

  18. Loetscher M, Gerber B, Loetscher P, et al. Chemokine receptor specific for IP10 and mig: structure, function, and expression in activated T-lymphocytes. J Exp Med 1996; 184:963–969.[Abstract/Free Full Text]

  19. Hebart H, Bollinger C, Fisch P, et al. Analysis of T-cell responses to Aspergillus fumigatus antigens in healthy individuals and patients with hematologic malignancies. Blood 2002; 100:4521–4528.[Abstract/Free Full Text]

  20. Upton A, Kirby KA, Carpenter P, Boeckh M, Marr KA. Invasive aspergillosis following hematopoietic cell transplantation: outcomes and prognostic factors associated with mortality. Clin Infect Dis 2007; 44:531–540.[CrossRef][Medline] [Order article via Infotrieve]

  21. Marr KA, Carter RA, Boeckh M, Martin P, Corey L. Invasive aspergillosis in allogeneic stem cell transplant recipients: changes in epidemiology and risk factors. Blood 2002; 100:4358–4366.[Abstract/Free Full Text]

  22. Vaid M, Kaur S, Sambatakou H, Madan T, Denning DW, Sarma PU. Distinct alleles of mannose-binding lectin (MBL) and surfactant proteins A (SP-A) in patients with chronic cavitary pulmonary aspergillosis and allergic bronchopulmonary aspergillosis. Clin Chem Lab Med 2007; 45:183–186.[CrossRef][Medline] [Order article via Infotrieve]

  23. Bochud PY, Chien JW, Janer M, Marr KA, Aderem A, Boeckh M. Donor's toll-like receptor (TLR) 4 haplotypes increase the incidence of invasive mold infections (IMI) in hematopoietic stem cell transplant (HCT) recipients. Paper presented at the Annual Interscience Conference on Antimicrobial Agents and Chemotherapy (ICAAC) of the American Society of Microbiology (ASM) September 27-30, 2006 San Francisco, CA. Abstract B-1329.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
A. J. Hartigan, J. Westwick, G. Jarai, and C. M. Hogaboam
CCR7 Deficiency on Dendritic Cells Enhances Fungal Clearance in a Murine Model of Pulmonary Invasive Aspergillosis
J. Immunol., October 15, 2009; 183(8): 5171 - 5179.
[Abstract] [Full Text] [PDF]


Home page
Clin. Microbiol. Rev.Home page
S. J. Park and B. Mehrad
Innate Immunity to Aspergillus Species
Clin. Microbiol. Rev., October 1, 2009; 22(4): 535 - 551.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
H. Ramaprakash, T. Ito, T. J. Standiford, S. L. Kunkel, and C. M. Hogaboam
Toll-Like Receptor 9 Modulates Immune Responses to Aspergillus fumigatus Conidia in Immunodeficient and Allergic Mice
Infect. Immun., January 1, 2009; 77(1): 108 - 119.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
M. Ruhwald, T. Bodmer, C. Maier, M. Jepsen, M. B. Haaland, J. Eugen-Olsen, P. Ravn, and on behalf of TBNET
Evaluating the potential of IP-10 and MCP-2 as biomarkers for the diagnosis of tuberculosis
Eur. Respir. J., December 1, 2008; 32(6): 1607 - 1615.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Table
Right arrow All Versions of this Article:
blood-2007-05-090928v1
111/2/534    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mezger, M.
Right arrow Articles by Loeffler, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mezger, M.
Right arrow Articles by Loeffler, J.
Related Collections
Right arrow Brief Reports
Right arrow Chemokines, Cytokines, and Interleukins
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2008 by American Society of Hematology         Online ISSN: 1528-0020