Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 1 February 2008, Vol. 111, No. 3, pp. 1584-1593.
Prepublished online as a Blood First Edition Paper on October 30, 2007; DOI 10.1182/blood-2007-09-112698.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Tables and Figure
Right arrow All Versions of this Article:
blood-2007-09-112698v1
111/3/1584    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saddler, C.
Right arrow Articles by Malek, S. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saddler, C.
Right arrow Articles by Malek, S. N.
Related Collections
Right arrow Neoplasia
Right arrowRelated Articles in Blood Online
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

NEOPLASIA

Comprehensive biomarker and genomic analysis identifies p53 status as the major determinant of response to MDM2 inhibitors in chronic lymphocytic leukemia

Chris Saddler1, Peter Ouillette1, Lisa Kujawski1, Sanjeev Shangary1, Moshe Talpaz1, Mark Kaminski1, Harry Erba1, Kerby Shedden2, Shaomeng Wang1, and Sami N. Malek1

1 Department of Internal Medicine, Division of Hematology and Oncology; and 2 Department of Statistics, University of Michigan, Ann Arbor


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Authorship
 References
 
Chronic lymphocytic leukemia (CLL) is the most common leukemia in the Western world and remains incurable with conventional therapies. Patients with relapsed or resistant CLL have a significantly shortened lifespan. MDM2 inhibitors have been developed and may have significant potential in the treatment of CLL. Clinical development of these compounds would be aided through knowledge of molecular predictors of activity. To understand determinants of sensitivity or resistance to MDM2 inhibitor therapy in CLL, we comprehensively analyzed a large cohort of CLL patient–derived samples for response to MDM2 inhibition and correlated these responses with clinically important biomarkers. Furthermore, we employed high-density single nucleotide polymorphism (SNP) arrays to analyze genomewide changes of copy number and allele status, including that of p53. The results of these studies conclusively demonstrate that p53 status is the major determinant of response to MDM2 inhibitors in CLL. Additional defects in the p53 regulatory cascade do not appear operational in this leukemia. Further, we identify a novel subgroup of patients with CLL with early progressive disease that appears particularly sensitive to MDM2 inhibitor treatment. These data provide definitive evidence for target-specific and predictive activity and a rationale to proceed with this potentially important class of compounds in the treatment of CLL.


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Authorship
 References
 
Chronic lymphocytic leukemia (CLL) is the most common form of adult leukemia in the Western world, and is characterized by a highly variable clinical course.1,2 Treatment of CLL is reserved for symptomatic patients or patients in advanced clinical stage. Despite improvements in response rates using chemoimmunotherapy combinations, CLL remains incurable, and patients refractory to fludarabine or patients who have suffered multiple disease relapses have a poor outlook.35 Therefore, novel therapeutics are needed to advance the outlook for afflicted patients.

Inhibitors of murine double minute 2 (Mdm2) represent a novel therapeutic approach.619 In cells with functional p53, the p53 activity is primarily inhibited through direct and tonic interaction with the MDM2 protein.2022 Treatment of various tumor cells with inhibitors of the MDM2-p53 interaction results in rising p53 levels and subsequent induction of cell-cycle arrest and apoptosis. For poorly understood reasons, nonmalignant cells appear relatively resistant to MDM2 inhibition.23,24

In CLL, in contrast to many solid tumors, p53 is mutated in only about 10% of patients at presentation and in 10% to 30% of patients with pretreated disease.2528 Thus, small-molecule inhibitors that block the MDM2-p53 interaction could represent a new therapeutic strategy for the treatment of most patients with CLL.

Human cancers are biologically heterogeneous and respond nonuniformly to therapeutic intervention. Therefore, understanding the molecular mechanisms underlying cancer susceptibility or resistance to specific drugs is essential to improve therapeutic outcome.

CLL is heterogeneous and several disease-related factors have been identified that classify CLL into biologically distinct and clinically relevant subtypes. Investigation into these subtypes has revealed clues about mechanisms of disease and patient prognosis.2,29,30

Lack of mutation in the immunoglobulin heavy-chain variable region (IgVH) genes, increased expression of zeta-associated protein of 70 kDa (ZAP-70), and mutations involving p53 and/or ATM genes are some of the molecular parameters that have been associated with an aggressive disease course, shortened disease-free intervals, and compromised survival.28,3139

Importantly, interphase fluorescent in situ hybridization (FISH) has identified chromosomal changes in approximately 80% of patients with CLL, and the presence of select chromosomal abnormalities, such as del(17p), has proven to be a prognostic indicator for response to therapy, disease progression after therapy, and survival.29,40,41

Given that loss of p53 or genes important for p53-induced apoptosis may confer resistance to therapies, including MDM2 inhibitors, we compared data from in vitro treatments of tumor cells from over 100 patients with CLL with 2 MDM2-inhibiting compounds to patient-specific, unbiased, genomewide copy number analyses using high-density single nucleotide polymorphism (SNP) arrays and measurements of clinically relevant biomarkers.4247


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Authorship
 References
 
Patients

Between January 2005 and July 2007, 179 patients with CLL were enrolled into a prospective CLL study at the University of Michigan Comprehensive Cancer Center. The trial was approved by the University of Michigan Institutional Review Board (IRBMED #2004-0962), and written informed consent was obtained from all patients prior to enrollment in accordance with the Declaration of Helsinki. Eligibility criteria required a diagnosis of CLL based on the National Cancer Institute Working Group Guidelines.48 Eligible patients needed to have an absolute lymphocytosis (greater than 5000 mature lymphocytes per microliter), and lymphocytes needed to express CD19, CD23, sIg (weak), and CD5 in the absence of pan–T-cell markers. Five patients enrolled on the study were excluded from analysis (diagnoses: large cell lymphoma, marginal zone lymphoma, small lymphocytic lymphoma, Crohn disease, and CLL with concurrent AML). Three posttreatment patient samples gave insufficient DNA for analysis and thus were excluded from analysis.

Of these 179 patients, samples from 171 cases were used for this study. For MDM2 inhibitor kill assays, 106 cases were selected to represent various CLL subtypes and were enriched for known p53 abnormalities. Eighty-five cases were previously untreated and twenty-one previously treated (Table S1, available on the Blood website; see the Supplemental Materials link at the top of the online article). The 85 untreated cases were previously analyzed for CLL biomarkers as described.49

CLL treatment was defined as cytotoxic chemotherapy and/or monoclonal antibody therapy for CLL and/or associated autoimmune cytopenias.

At enrollment, clinical information, including Rai stage, was collected on all patients.50

Cell isolation

Cell purification. Peripheral blood mononuclear cells from patients with CLL were isolated by Ficoll gradient centrifugation (GE Healthcare, Little Chalfont, United Kingdom), aliquoted into fetal calf serum (FCS) with 10% DMSO, and cryopreserved in liquid nitrogen.

Flow cytometry. Cryopreserved CLL cells were washed and stained with phycoerythrin-conjugated anti-CD19 and FITC-conjugated anti-CD3 antibodies (eBioscience, San Diego, CA). Propidium iodide was added to a concentration of 1 µg/mL to discriminate dead cells, and viable CD19+ and CD3+ single-positive cells were sorted on a high-speed FACS Aria (BD, Franklin Lakes, NJ) sorter.

Array data analysis

Affymetrix (Santa Clara, CA) data files were generated from SNP chips after hybridization via scanners at the University of Michigan Microarray Core facility and imported into the Affymetrix Gene Chip Operating Software and GeneChip DNA Analysis Software suites. dChip used native Affymetrix .CEL files and text-formatted .CHP files from GDAS to generate copy number heatmap displays.51

Loss-of-heterozygosity (LOH) analysis and LOH display across chromosomes between CD19+ tumor cell–derived DNA and buccal DNA were performed using the LOH tool.47

Mutation Surveyor software (SoftGenetics, State College, PA) was used to compare experimental p53 sequences against GenBank sequence (NM_000546 [GenBank] ) or genomic sequences, as well as by visual inspection of sequence tracings.

Assessment of association between p53 response by immunoblotting before and after MDM2 inhibition and clinical outcome

Time-to-first-treatment (TTFT) was the sole clinical end point that we used. The Kaplan-Meier method was used to estimate the survivor function to first treatment for each subgroup (CLL cases with and without aberrant p53 induction by immunoblotting), and the log-rank test was used to calculate P values to test for significant differences in the survivor function between subgroups.

Assessment of the relationship between MDM2 inhibitor ex vivo IC50 kill values and clinical outcome

Cox proportional hazards models were used to assess univariate associations between TTFT and the 50% inhibitory concentration (IC50) value for p53 wild-type samples. In these models, TTFT is related to a linear predictor of the form b*IC50. The fitted coefficient b means that given 2 untreated subjects that differ one unit in IC50, the subject with higher IC50 has approximately exp(b) times greater risk of going onto treatment. Coefficient estimates, 95% confidence intervals, and P values based on the log-rank test are given for each MDM2 inhibitor.

Determination of immunoglobulin heavy chain variable gene (IgVH) mutation status

Polymerase chain reaction (PCR) was used to amplify IgVH regions using CLL sample CD19+-sorted, cell-derived genomic DNA or cDNA as templates. Trizol was used to purify total RNA, and the Superscript III first-strand reverse transcription (RT)–PCR kit was used to generate first-strand cDNA (random primed; Invitrogen, Carlsbad, CA). Primers were a mixture of 7 FR1-primers using the BIOMED2 consortium primers and the modified J-consensus primer 5'-ACCTGAGGAGACGGTGACCAGGGT-3' (Jc).52 Amplifications were done using Platinum-PFX (Invitrogen) and optimized using gradient PCR conditions. Products were fractionated on 2% agarose gels, excised and eluted using the Qiaquick gel extraction kit, and directly sequenced using primer Jc. Products were also cloned using the Zero Blunt Topo PCR cloning kit (PCR Blunt II topo vector; Invitrogen) and multiple clones per patient were sequenced using M13 primers. Sequences were compared against the IgVH-database using the National Center for Biotechnology Information (NCBI) Ig-Blast search engine (http://www.ncbi.nlm.nih.gov/igblast/). A 98% homology to germ line was used as the cut-off for unmutated status assignment.

Determination of percentage of ZAP-70–positive cells using multiparameter flow cytometry analysis

ZAP-70 analysis was based on the method of Rassenti et al with minor modifications.36 From 200,000 to 1 million cryopreserved peripheral blood mononuclear cells (PBMCs) from patients with CLL were thawed into warmed medium, washed, and stained with directly conjugated anti-CD19PE and anti-CD3APC (eBioscience) for 5 minutes at room temperature. Cells were washed and fixed with 4% paraformaldehyde, then permeabilized with 0.1% saponin. Anti–ZAP-70 clone 1E7.2 conjugated to Alexa Fluor 488 (Invitrogen) was added in saponin for 45 minutes. Cells were again washed and resuspended in 1% paraformaldehyde and analyzed on a BD FACSCalibur flow cytometer. Healthy donor PBMCs were used to set markers such that 0.5% of events were in the upper right quadrant, with CD19+ cells along the y axis and ZAP-70–positive cells along the x axis. The percent ZAP-70–positive cells for CLLs was determined using this marker setting. Samples were classified as ZAP-70 positive if greater than 20% of CD19+ cells were also ZAP-70 positive.

p53 genomic DNA sequencing

Primers to amplify exons 5/6, 7, and 8/9 of human p53 and adjacent intronic sequences were designed using the primer 3 program. The sequence of the primers used is as follows: p53-E5/6-F, 5'-ggaggtgcttacgcatgtttt; p53-E5/6-R, 5'-gggaggtcaaataagcagca; p53-E7-F, 5'-aaaaaggcctcccctgct; p53-E7-R, 5'-tggaagaaatcggtaagaggtg; p53-E8/9-F, caagggtggttgggagtaga; p53-E8/9-R, ccccaattgcaggtaaaaca. PCR products were generated using DNA templates from FACS-sorted CD19+ or CD3+ cells. Amplifications were done using Taq polymerase. PCR amplicons were prepared for direct sequencing with internal nested sequencing primers using the exonuclease/shrimp alkaline phosphatase method (USB, Cleveland, OH).

Fluorescence in situ hybridization

Fluorescence in situ hybridization (FISH) was performed for patient samples at the Mayo Clinic, Rochester, MN, as a routine clinical test, with the following published chromosomal target regions: 6cen (D6Z1), 6q23.3 (c-myb locus), 11 cen (D11Z1), 11q13 (CCND1-XT), 11q22.3 (ATM), 12 cen (D12Z3), 12q15 (MDM2), 13q14 (D13S319), 13q34 (LAMP1), 14q32 (IGH-XT), 17 cen (D17Z1), 17p13.1 (p53).

Preparation of sample DNA for hybridization to Affymetrix 50k-XbaI–mapping arrays and assay characteristics

A novel oligonucleotide platform, the 50k SNP chip, was introduced in 2004 by Affymetrix. Selected technical characteristics of the 50k SNP chips are a total combined number of approximately 58 000 SNPs, a median intermarker distance of about 16 kb, a mean intermarker distance of 47 kb, and an average heterozygosity of 0.29.

Sorted CD19+ or CD3+ cells or buccal swabs were digested overnight in 100 mM Tris pH 8.0, 50 mM EDTA, 50 mM NaCl, 0.5% SDS, and 100 µg/mL Proteinase K (Invitrogen) at 56°C. DNA was extracted using phenol-chloroform and precipitated using ammonium acetate, ethanol, and glycogen. DNA (250 µg) was digested for 10 hours at 37°C, and the samples were subsequently ligated, PCR-amplified, fragmented, and labeled according to the manufacturer's instructions. Hybridization of labeled DNA fragments to the 50k-XbaI–mapping arrays was performed in an Affymetrix Hybridization Oven 640 for 16 hours at 48°C with rotation at 60 rpm. Washing and staining was done on an Affymetrix Fluidics Station 450. Scanning was done using an Affymetrix Scanner 3000 7G with autoloader. Data files were archived and transferred using CAB (Windows cabinet) files.

CD19+ cell purification and MDM2 inhibitor treatment

Cryopreserved PBMCs derived from patients with CLL were washed and recovered by centrifugation and then treated with antihuman CD3 (no. 130-050-101; Miltenyi Biotec, Auburn, CA) and antihuman CD14 microbeads (no. 130-050-201; Miltenyi Biotec) per manufacturer's recommendations. Cell suspensions were run through Miltenyi MACS separation LS columns (no. 130-042-401) in order to negatively enrich for CD19+ B cells. This resulted in greater than 95% CD19+ cells.

MI-63 and MI-61 were synthesized using previously published methods.15,16 Nutlin3 was provided by Dr Wang. We have previously reported that MI-63 binds to MDM2 with a Ki value of 3 nM. MI-61 is a close homologue of MI-63 and binds MDM2 with more than 3000-fold lower affinity, and was thus used as an inactive control in this study.

CD19+ cells were suspended at 5 x 105 cells per well in RPMI 1640 supplemented with 10% FCS and treated in duplicate incubations with the MI-63 compound at concentrations of 0.5, 1, 2.5, 5, and 10 µM. Cells were treated in parallel duplicate incubations with Nutlin3 at concentrations of 1, 2.5, 5, 10, and 20 µM. In addition, cells at a concentration of 2 x 106 per well were treated with 10 µM MI-63, 20 µM Nutlin3, and 10 µM MI-61, incubated for 36 hours, washed and frozen for immunoblotting at a later time.

All cells were incubated for 36 hours at 37°C, at which time they were prepared for staining with Aposcreen Annexin V-PE (no. 10 040-09; Southern Biotechnology Associates, Birmingham, AL) and PI (P4170; Sigma, St Louis, MO) and analyzed by flow cytometry using a Beckman Coulter Epics XL (Fullerton, CA). Sample response to drug was calculated based on indexing the percent live cell number in the untreated control of each CLL as 100%, and then recalculating percent live at each drug concentration for individual cases for all data points. IC50 calculations were performed using XL-fit (IDBS, Guildford, United Kingdom).

For each dose level, a 2-sample t test was performed to compare the mean response (percent cell kill) in p53 or 17p wild-type samples to the mean response in p53 mutant or 17p deleted samples. Results are displayed as the mean plus or minus one standard deviation, with an asterisk to denote the comparisons that were significant at the P ≤ .01 level.

Immunoblotting

Immunoblotting to measure p53 levels after MDM2 inhibition was performed on cell lysates from treated cells stored frozen in pellets. Cell pellets were directly lysed in 100 µL of 1x Laemmli SDS–polyacrylamide gel electrophoresis (PAGE) buffer in 100 mM Tris, pH 8.0, 100 mM NaCl, and 2 mM EDTA. Protein was fractionated on 7.5% SDS-PAGE gels and transferred onto PVDF membrane, then blocked for 1 hour in 5% nonfat dry milk in Tris-buffered saline–Tween-20 (TBS-T). Membranes were incubated in anti-p53 mouse mAb (Ab-6) in milk/TBS-T (Pantropic Mouse mAb DO-1; Calbiochem, San Diego, CA) at a dilution of 1:500, washed, and finally incubated with horseradish peroxidase (HRP)–conjugated anti–mouse Ig at 1:10 000 dilution (NXA931; GE Healthcare). The membranes were developed using ECL Plus Detection (GE Healthcare) reagents.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Authorship
 References
 
Patient characteristics

Included in this study are samples and clinical data from 171 patients with CLL who are enrolled in an ongoing prospective CLL profiling study. Characteristics for 106 patients who were analyzed for MDM2 inhibitor-mediated cell kill are summarized in Table 1 and detailed in Table S1.


View this table:
[in this window]
[in a new window]

 
Table 1. Baseline characteristics of 106 patients with CLL

 
Eighty-five (80%) patients were previously untreated, and 21 (20%) patients were pretreated with either alkylator- or purine analog–based therapies. Patient samples were characterized for p53 mutations, immunoglobulin variable gene mutations (IgVH-mutations), ZAP-70 expression, and for selected CLL-associated chromosomal aberrations using FISH, as described.49

p53 mutations in CLL are associated with monoallelic 17p deletion, with regions of copy-neutral LOH at 17p not detectable by FISH, or without detectable changes on 17p

Patients with CLL with del17p spanning the p53 gene have a poor prognosis, with an average survival of about 3 years. As a prerequisite to understanding in detail the relationship of p53 allele status, p53 mutations, and response to MDM2 inhibition in CLL, we defined 171 patients with CLL for p53 allele status, p53 LOH, and p53 mutations. We analyzed genomic profiles of patients with CLL using the Affymetrix 50k SNP platform, clinical FISH data using a probe spanning the p53 locus, and p53 sequence data for exons 5 to 9.

In Figure 1A, LOH analysis (buccal DNA versus CD19+ CLL cells) for chromosome 17p for all SNPs and for all patients is shown. Through comparison of LOH calls (Figure 1A) with clinical FISH data (Figure 1B), we noted that 3 patients (CLL nos. 33, 53, and 143) were not previously known to carry abnormalities at 17p. We therefore analyzed copy number estimates for 17p for all patients and found that CLL nos. 33 and 53 (Figure 1C red) had a normal 2N state at 17p whereas CLL no. 143 demonstrated del17p (1N). Therefore, copy-neutral LOH (uniparental disomy) exists at 17p (CLL nos. 33 and 53) and would escape detection using the clinically important FISH assay.


Figure 1
View larger version (59K):
[in this window]
[in a new window]

 
Figure 1. Comparative analysis of chromosome 17p LOH, copy number estimates, FISH, and p53 mutation analysis. Text files generated through use of the Affymetrix programs GDAS and Copy Number Tool for all patients were imported into the LOH tool, and all individual positions of LOH between buccal DNA and paired tumor DNA were graphed as a blue tick mark across the length of the chromosomes. Copy number estimates for all SNP positions for all patients were generated through dChipSNP, as described, and displayed across the length of the chromosomes. Copy losses are displayed with blue colors, copy gains with red colors. The physical position of SNPs is not linear along the displayed portions of the chromosome. (A) LOH display for chromosome 17p. Each row represents one patient. Vertical solid lines indicate 10-Mb intervals. The location of the commonly used FISH probe spanning the p53 gene at 17p13.1 is marked with a vertical arrow. (B) Chromosome 17 FISH results from all patients with del17p by clinical FISH panel (Mayo Clinic) with the estimated percentage of positive cells in parentheses. (C) Copy number display for chromosome 17p. The location of the commonly used FISH probe spanning the p53 gene at 17p13.1 is marked with a vertical arrow. The estimated copy numbers for all SNP positions for CLL no. 14 are shown below the chromosome 17p display, with the red line indicating the 2N state. (D) p53 Mutation analysis for exons 5 to 9. Sample numbers are indicated in column 1. The nucleotide and amino acid residue for that position in the cDNA NM 000546 or genomic DNA (same result) is shown in column 2. The nucleotide and amino acid residue for that position in FACS-sorted CD3+ cells (somatic control DNA) is shown in column 3, and the nucleotide and amino acid residue for that position in FACS-sorted CD19+ cells is shown in column 4. In panels A and C, patients with CLL with del17p and p53 wild-type status are indicated in green. Patients with CLL without del17p and p53 mutant status are indicated in blue. Patients with CLL with del17p and p53 mutant status are indicated in black.

 
It is commonly assumed that the del17p indicates that p53 is mutated on the retained allele. We decided to test this relationship through comparison of dChip SNP-based copy number estimates for 17p, FISH data, and p53 mutation status.

As can be seen in Figure 1C and D, 3 of 15 patients (CLL nos. 14, 74, and 84; green) with copy loss at 17p had no p53 mutations in the retained allele. The 2 patients with LOH but no 17p copy loss (CLL nos. 33 and 53; red) had either a polymorphism in the germ line (CD3+ cells as template) that encoded for an amino acid change (CLL no. 33 with either p53 R248 and Q248 in the germ line) that converted to Q248 in the CLL cells, or a homozygous mutation (CLL no. 53).

CLL nos. 16, 92, 151, and 176 (Figure 1C blue), which had neither LOH nor copy loss at 17p, carried p53 mutations.

Finally, multiple CLL cases (Figure 1A,C black), with both LOH and copy loss at 17p, carried p53 mutations on the remaining allele.

p53 protein levels in CLL samples at baseline and in response to MDM2 inhibitors

To corroborate p53 sequence data and to detect additional p53 aberrations, we measured p53 levels before and after MDM2 inhibitor treatment by immunoblotting in purified CD19+ tumor cells from all 106 CLL cases studied.

As expected, p53 levels were elevated after MDM2 inhibitor treatment in all samples with wild-type p53 status when compared with either untreated cells or cells treated with the inactive compound MI-61 (Figure 2A). p53 levels were high and were not further induced in samples with known p53 point mutations (Figure 2B).


Figure 2
View larger version (44K):
[in this window]
[in a new window]

 
Figure 2. p53 expression levels at baseline and in response to MDM2 inhibition in CLL. Total protein from untreated, MI-61–treated, and MDM2 inhibitor (MI-63, Nutlin3)–treated cell samples was fractionated by SDS-PAGE, transferred to PVDF membrane, and prepared for immunoblotting with anti-p53 mAb. Membrane was developed using HRP-conjugated antimouse Ab followed by ECL-plus. (A) Four different CLL samples with wild-type p53 exon 5 to 9 sequence; treatments for individual samples/lanes are indicated. (B) Three different CLL samples with mutant p53 exon 5 to 9 sequence; treatments for individual samples/lanes are indicated. (C) Two CLL samples (nos. 138 and 168) with frameshift mutants of p53 compared with a wild-type CLL sample (no. 46); treatments for individual samples/lanes are indicated. (D) Three CLL samples with absent p53 expression (nos. 14, 84, and 161) compared with a wild-type CLL sample (no. 46). The position of wild-type p53 is indicated by an arrow.

 
Aberrant short p53 protein was detected in 2 cases (Figure 2C) and was associated with relative resistance to MDM2 inhibitor treatment.

Finally, we detected 3 CLL cases with essentially absent p53 levels that were unchanged by MDM2 inhibitor treatment (Figure 2D). All 3 cases carried monoallelic del17p. These cases displayed relative resistance to MDM2 inhibitor treatment, comparable to p53 sequence mutants as described in "Measurements of MDM2 inhibitor-mediated cell kill in a large CLL cohort."

Measurements of MDM2 inhibitor-mediated cell kill in a large CLL cohort

Highly purified CD19+ cells (see "Methods") from 106 patients with CLL were incubated with 2 different MDM-2 inhibitors (MI-63 and Nutlin3) at the indicated concentrations (Figure 3A,B) for approximately 36 hours, and apoptotic (annexin-V staining) and necrotic (PI staining) cell death was measured using flow cytometry. Untreated aliquots of individual case cells that did not stain with annexin-V or PI were used as a baseline, indexed to 100%, to compute the cell death fraction induced by the drug for each CLL case.


Figure 3
View larger version (42K):
[in this window]
[in a new window]

 
Figure 3. p53 status is the primary determinant of MDM2 cell kill in CLL. CLL samples (n=106) were enriched for CD19+ cells through negative selection and incubated for 36 hours with various concentrations of either MI-63 or Nutlin3. Samples were prepared for Annexin-V and PI staining and analyzed by flow cytometry, and the residual live and nonapoptotic cell fraction was calculated for each concentration by comparison with the untreated control incubation. (A) MI-63 assay results. Red indicates p53 sequence mutants; green, CLL cases with absent p53 expression; black, wild-type p53 status. (B) Nutlin3 assay results. Red indicates p53 sequence mutants; green, CLL cases with absent p53 expression; black, wild-type p53 status.

 
IC50 values for MI-63–mediated kill ranged from 0.3 µM for the most sensitive case to greater than 10 µM for the most resistant case (Table S2). Similar compound sensitivity profiles for the Nutlin3 compound were 0.5 µM to greater than 40 µM.

As can be seen in Figure 3A and B, the vast majority of CLL samples with wild-type p53 (black lines) displayed susceptibility to kill by both compounds. Importantly, all 16 CLL cases with known p53 mutations (red curves) or absent p53 expression (3 cases, green curves, see also Figure 2D) were relatively resistant. Mean IC50 values for MI-63 or Nutlin3 for CLL cases without (87 cases) or with p53 abnormalities (sequence mutants or absent expression, 19 cases) were 1.52/5.4 µM and 3.55/22.9 µM, respectively.

Composite analysis of MDM2 inhibitor-induced fractional cell kill demonstrated highly statistically significant differences between the mean of the response in p53 wild-type and mutant CLL samples for both compounds (Figure 4A,B; all P values were less than .001).


Figure 4
View larger version (12K):
[in this window]
[in a new window]

 
Figure 4. p53 status is the primary determinant of MDM2 cell kill in CLL (composites). CLL samples (n=106) were enriched for CD19+ cells through negative selection and incubated for 36 hours with various concentrations of either MI-63 or Nutlin3. Samples were prepared for annexin-V and PI staining and analyzed by flow cytometry, and the residual live and nonapoptotic cell fraction was calculated for each concentration through comparison with the untreated control incubation. (A) MI-63 assay result composites. Dashed line indicates p53 sequence mutants and cases with absent p53 expression; solid line, wild-type p53 status. (B) Nutlin3 assay results. Dashed line indicates p53 sequence mutants and cases with absent p53 expression; solid line, wild-type p53 status. Standard deviations are indicated by vertical black bars. Statistically different data points (mean) are marked with asterisks. Results are displayed as the mean plus or minus one standard deviation, with an asterisk to denote the comparisons that were significant at the P ≤ .001 level.

 
Only a few CLL cases with wild-type p53 status and wild-type p53 induction by immunoblotting in response to MDM2 inhibition displayed resistance to MDM2 inhibitor treatment that was comparable to the known p53 mutant cases (Figure 3A,B). Therefore, p53 status emerged as the major determinant of responsiveness to MDM2 inhibitors in CLL.

The influence of established clinically important biomarkers on response to MDM2 inhibitors in CLL

We also assessed whether the presence or absence of unfavorable biomarkers used clinically in CLL, including unmutated immunoglobulin variable genes (IgVH-unmutated), expression of ZAP-70, or presence of select FISH findings, predicted for MDM2 treatment response (Figure 5A-F).


Figure 5
View larger version (28K):
[in this window]
[in a new window]

 
Figure 5. CLL cell kill by MDM2 inhibitors is independent of IgV-mutation status or ZAP-70 expression but dependent on the presence of del17p. CLL samples (n=106) were enriched for CD19+ cells through negative selection and incubated for 36 hours with various concentrations of either MI-63 or Nutlin3. Samples were prepared for annexin-V and PI staining and analyzed by flow cytometry, and the residual live and nonapoptotic cell fraction was calculated for each concentration through comparison with the untreated control incubation. (A) MI-63 assay results, composites, excluding cases with p53 aberrations. Red indicates the IgVH-mutated CLL group; black, the IgVH-unmutated CLL group. (B) Nutlin3 assay results, composites, excluding cases with p53 aberrations. Red indicates the IgVH-mutated CLL group; black, the IgVH-unmutated CLL group. (C) MI-63 assay results, composites, excluding cases with p53 aberrations. Red indicates the ZAP-70–negative CLL group; black, the ZAP-70–positive CLL group. (D) Nutlin3 assay results, composites, excluding cases with p53 aberrations. Red indicates the ZAP-70–negative CLL group; black, the ZAP-70–positive CLL group. (E) MI-63 assay results, composites, including cases with p53 aberrations; various hierarchical FISH categories are indicated. (F) Nutlin3 assay results, composites, including cases with p53 aberrations; various hierarchical FISH categories are indicated. Standard deviations are indicated by vertical black bars. Results are displayed as the mean plus or minus one standard deviation, with an asterisk to denote the comparisons that were significant at the P ≤ .001 level.

 
As can be seen in Figure 5A through D, after exclusion of CLL cases with either known p53 mutations or absent p53 expression, neither IgV-mutation status nor ZAP-70 expression status influenced susceptibility to MDM2 treatment.

Conversely, patients with del17p by hierarchical FISH (not excluding cases with p53 aberrations, as these molecular abnormalities demonstrated 100% linkage) displayed relative resistance to MDM2 inhibitor treatment (mean IC50 values of 5.7/23.1 µM for MI-63 and Nutlin3, respectively). Comparing the response of the patients with del17p to all other FISH categories combined demonstrated a highly significant difference for comparison of the mean for all drug concentrations (all P values were less than .001).

CLL cases in other hierarchical FISH categories, including cases with del11q (spanning ATM), del13q14, trisomy 12, or a normal FISH, appeared equally sensitive to MDM2 inhibitor treatment (mean IC50 values of 1.3/2.8 µM, 1.6/4.1 µM, 1.7/3.7 µM, and 1.3/2.6 µM for MI-63 and Nutlin3, respectively).

The response to MDM2 inhibitors is independent of prior therapies for CLL

While an increased incidence of acquired adverse FISH abnormalities including del17p or p53 mutations is known to occur in CLL at time of relapse, little is known about additional molecular changes that may adversely affect susceptibility to MDM2 inhibitor treatment.

Stratified analysis of the MDM2 inhibitor-mediated cell kill sensitivity presented in "The influence of established clinically important biomarkers on response to MDM2 inhibitors in CLL" by treatment status (untreated vs pretreated and excluding patients with known p53 mutations) uncovered that prior therapies did not influence response to MDM2 inhibition (Figure S1A,B).

Aberrant MDM2 inhibitor-induced p53 protein induction predicts for rapid CLL disease progression

To determine the clinical prognostic importance of detecting p53 aberrations through immunoblotting before and after MDM2 inhibitor treatment in CLL, we employed the Kaplan-Meier method and display time-to-first-therapy (TTFT) data for the 19 patients with aberrant p53 induction versus the remaining 87 cases with wild-type p53 induction in Figure 6.


Figure 6
View larger version (14K):
[in this window]
[in a new window]

 
Figure 6. Aberrant induction or expression of p53 in response to MDM2 inhibition predicts for aggressive disease. Display of time-to-first-therapy estimates for CLL cases with aberrant p53 induction (blue line) by immunoblotting as opposed to cases with p53 wild-type immunoblotting pattern (red line), using the Kaplan-Meier method.

 
TTFT was 29 months for the group of patients with aberrant p53 induction as opposed to not reached for the group with wild-type p53 response (P = .02), indicating an aggressive disease course for patients with aberrant p53 function.

High sensitivity to MDM2 inhibitors in CLL cases without p53 aberration predicts for aggressive CLL

Further correlative analysis of TTFT versus sensitivity to MDM2 inhibitors ex vivo for all CLL cases with wild-type p53 immunoblotting response before and after MDM2 inhibitor treatment (excluding the cases with aberrant p53 response) gave unexpected results: Untreated patients who displayed high sensitivity to MDM2-inhibitor treatment ex vivo progressed significantly more rapidly and required therapy earlier than patients with relatively less sensitive CLL cells. Using Cox proportional hazard modeling, a highly statistically significant correlation was found between low IC50 values and shorter TTFT (MI-63: P = .006, coefficient of –1.71 [range –3.07 - –0.35]; Nutlin3: P = .02, coefficient –0.50 [range –0.98 - –0.03]; see "Methods").

In Figure 7A-D, we have graphically displayed Kaplan-Meier estimates of TTFT estimates for p53 wild-type patients with IC50 values below or above the median for either MI-63 or Nutlin-3 (Figure 7A,B) and for p53 wild-type patients grouped by IC50 value quartiles (Figure 7C,D). Either display representatively demonstrates the shortened time to first therapy for the p53 wild-type patient groups with low ex vivo MDM2 inhibitor IC50 kill values as opposed to patients with cells with high ex vivo IC50 values.


Figure 7
View larger version (23K):
[in this window]
[in a new window]

 
Figure 7. Patients with wild-type p53 and with low MDM2 inhibitor ex vivo cell kill IC50 values have more aggressive disease. Representative display of time-to-first-therapy (TTFT) estimates for 87 CLL cases with p53 wild-type immunoblotting pattern, using the Kaplan-Meier method, grouped by MDM2 inhibitor treatment. (A) MI-63 display of TTFT for groups below (green) and above (red) the median IC50 value. (B) Nutlin3 display of TTFT for groups below (green) and above (red) the median IC50 value. (C) MI-63 display of TTFT for quartiles of IC50 values (Q1-Q4, with Q1 lowest to Q4 highest). (D) Nutlin3 display of TTFT for quartiles of IC50 values (Q1-Q4, with Q1 lowest to Q4 highest).

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Authorship
 References
 
This study examines the efficacy of in vitro MDM2 inhibitor-mediated cell kill of purified primary CLL tumor cells in a large cohort of patients with CLL for whom comprehensive clinical risk data are available and for whom high-quality genomewide subchromosomal copy number and LOH data have been accumulated.

From this it has been possible to firmly conclude that p53 status is the major determinant of responsiveness to MDM2 inhibitor treatment in CLL.

This conclusion applies to treatment-naive as well as chemotherapy-pretreated CLL. Defects in the p53 regulatory network, including defects in p53-induced apoptotic effector molecules, do not appear to play a significant role in CLL response to MDM2 inhibition.5358 This is in concordance with 3 previous reports of pilot studies.55,59,60 MDM2 inhibitors therefore potentially offer efficacious cancer cell killing for the majority of patients with CLL with high-risk or relapsed disease.

Our integrated genomic profiling analysis of chromosome arm 17p together with p53 sequence data and p53 immunoblotting supports the conclusion that all del17p cases (by FISH) have aberrant p53 function; given that 4 cases of p53 mutants/absent expression without del17p were identified (including 2 cases with copy-neutral LOH at 17p and homozygous p53 mutations) that demonstrated resistance to MDM2 inhibition, we conclude that patients with CLL with del17p are resistant to MDM2 inhibition secondary to associated p53 abnormalities. Therefore, the clinically important del17p subgroup of patients with CLL, which is in need of new therapies, is unlikely to benefit from MDM2 inhibitor therapy.

These data also support the routine clinical use of p53 immunoblotting on purified CLL cells before and after MDM2 inhibitor treatment as an important addition to the current panel of clinically useful biomarkers. Immunoblotting for p53 detected all p53 sequence mutants as well as CLL with p53 expression defects in our study. Importantly, all CLL cases demonstrating aberrant as compared with wild-type p53 induction were relatively resistant to MDM2 inhibitor kill. Finally, CLL cases with aberrant p53 immunoblotting results demonstrated an aggressive disease course.

We also conclude that p53 immunoblotting before and after MDM2 inhibitor treatment more comprehensively interrogates p53 defects than either FISH for del17p or p53 exon resequencing.61

During these studies we identified for the first time a strong correlation between high sensitivity to MDM2 inhibitor cell kill ex vivo and aggressive CLL in cases with wild-type p53 function. This is a novel finding and of potentially significant clinical importance, as these patients with an early need for therapy may benefit from MDM2 inhibitor therapy.

As previously reported in a small patient sampling, ZAP-70 expression or monoallelic ATM loss did not affect MDM2 inhibitor susceptibility.59 We confirm and extend this observation using our larger patient cohort. Furthermore, we report that the mutation status of the IgVH genes does not predict MDM2 inhibitor mediated cell kill in CLL.

It is important to note that we attempted to detect residual effects of these biomarkers (ZAP-70 and IgVH) on MDM2 inhibitor sensitivity by excluding patients with p53 abnormalities. In clinical practice, however, p53 status is not comprehensively analyzed and therefore routinely confounds the effect of these markers on various clinical outcome parameters.

In summary, our study provides clinically relevant data in the context of planned clinical trials with MDM2 inhibitors that allows stratification of patients with CLL into 2 groups: those with and those without p53 defects. Early-phase trials of MDM2 inhibitors in CLL therefore should incorporate pretrial in vitro measurements of p53 induction in response to MDM2 inhibition on patient specimens into the clinical trial schema.


    Authorship
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Authorship
 References
 
Contribution: C.S., P.O., and S.M. performed the laboratory research and wrote the paper; H.E., M.K., M.T., L.K., and S.M. enrolled patients and contributed and analyzed clinical data; K.S. assisted with statistical analysis; S.S. and S.W. provided the MDM2 inhibitors; S.M., S.S., and S.W. conceived the study.

Conflict-of-interest disclosure: S.W. is a shareholder and founder of Ascenta Therapeutics. He is a consultant to Ascenta Therapeutics and the principal investigator of a research contract between Ascenta Therapeutics and the University of Michigan. The other authors declare no competing financial interests.

Correspondence: Sami N. Malek, Department of Internal Medicine, Division of Hematology and Oncology, University of Michigan, 1500 E Medical Center Dr, Ann Arbor, MI 48109-0936; e-mail: smalek{at}med.umich.edu.


    Acknowledgments
 
This work was supported by a Leukemia and Lymphoma Society of America Special Fellow Award (S.M.), a Leukemia Research Foundation New Investigator Award (S.M.), the National Institutes of Health (NIH; 1 R21 CA124420-01A1; S.M.), NIH through the University of Michigan's Cancer Center Support Grant (5 P30 CA46592), and a Leukemia and Lymphoma Society Translational Research Grant (S.W. and S.M.).


    Footnotes
 
Submitted September 13, 2007; accepted October 19, 2007.

Prepublished online as Blood First Edition Paper, October 30, 2007 DOI: 10.1182/blood-2007-09-112698

The online version of this article contains a data supplement.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 USC section 1734.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Authorship
 References
 

  1. Chiorazzi N, Allen SL, Ferrarini M. Clinical and laboratory parameters that define clinically relevant B-CLL subgroups. Curr Top Microbiol Immunol 2005; 294:109–133.[Medline] [Order article via Infotrieve]

  2. Chiorazzi N, Rai KR, Ferrarini M. Chronic lymphocytic leukemia. N Engl J Med 2005; 352:804–815.[Free Full Text]

  3. Wierda W, O'Brien S, Wen S, et al. Chemoimmunotherapy with fludarabine, cyclophosphamide, and rituximab for relapsed and refractory chronic lymphocytic leukemia. J Clin Oncol 2005; 23:4070–4078.[Abstract/Free Full Text]

  4. Keating MJ, O'Brien S, Albitar M, et al. Early results of a chemoimmunotherapy regimen of fludarabine, cyclophosphamide, and rituximab as initial therapy for chronic lymphocytic leukemia. J Clin Oncol 2005; 23:4079–4088.[Abstract/Free Full Text]

  5. Byrd JC, Rai K, Peterson BL, et al. Addition of rituximab to fludarabine may prolong progression-free survival and overall survival in patients with previously untreated chronic lymphocytic leukemia: an updated retrospective comparative analysis of CALGB 9712 and CALGB 9011. Blood 2005; 105:49–53.[Abstract/Free Full Text]

  6. Vassilev LT. MDM2 inhibitors for cancer therapy. Trends Mol Med 2007; 13:23–31.[CrossRef][Medline] [Order article via Infotrieve]

  7. Toledo F and Wahl GM. MDM2 and MDM4: p53 regulators as targets in anticancer therapy. Int J Biochem Cell Biol 2007; 39:1476–1482.[CrossRef][Medline] [Order article via Infotrieve]

  8. Yang Y, Ludwig RL, Jensen JP, et al. Small molecule inhibitors of HDM2 ubiquitin ligase activity stabilize and activate p53 in cells. Cancer Cell 2005; 7:547–559.[CrossRef][Medline] [Order article via Infotrieve]

  9. Fotouhi N and Graves B. Small molecule inhibitors of p53/MDM2 interaction. Curr Top Med Chem 2005; 5:159–165.[CrossRef][Medline] [Order article via Infotrieve]

  10. Vogelstein B and Kinzler KW. Cancer genes and the pathways they control. Nat Med 2004; 10:789–799.[CrossRef][Medline] [Order article via Infotrieve]

  11. Vassilev LT, Vu BT, Graves B, et al. In vivo activation of the p53 pathway by small-molecule antagonists of MDM2. Science 2004; 303:844–848.[Abstract/Free Full Text]

  12. Vassilev LT. Small-molecule antagonists of p53-MDM2 binding: research tools and potential therapeutics. Cell Cycle 2004; 3:419–421.[Medline] [Order article via Infotrieve]

  13. Wasylyk C, Salvi R, Argentini M, et al. p53 mediated death of cells overexpressing MDM2 by an inhibitor of MDM2 interaction with p53. Oncogene 1999; 18:1921–1934.[CrossRef][Medline] [Order article via Infotrieve]

  14. Lane DP and Fischer PM. Turning the key on p53. Nature 2004; 427:789–790.[CrossRef][Medline] [Order article via Infotrieve]

  15. Ding K, Lu Y, Nikolovska-Coleska Z, et al. Structure-based design of spiro-oxindoles as potent, specific small-molecule inhibitors of the MDM2-p53 interaction. J Med Chem 2006; 49:3432–3435.[CrossRef][Medline] [Order article via Infotrieve]

  16. Ding K, Lu Y, Nikolovska-Coleska Z, et al. Structure-based design of potent non-peptide MDM2 inhibitors. J Am Chem Soc 2005; 127:10130–10131.[CrossRef][Medline] [Order article via Infotrieve]

  17. Lu Y, Nikolovska-Coleska Z, Fang X, et al. Discovery of a nanomolar inhibitor of the human murine double minute 2 (MDM2)-p53 interaction through an integrated, virtual database screening strategy. J Med Chem 2006; 49:3759–3762.[CrossRef][Medline] [Order article via Infotrieve]

  18. Koblish HK, Zhao S, Franks CF, et al. Benzodiazepinedione inhibitors of the Hdm2:p53 complex suppress human tumor cell proliferation in vitro and sensitize tumors to doxorubicin in vivo. Mol Cancer Ther 2006; 5:160–169.[Abstract/Free Full Text]

  19. Chen L, Yin H, Farooqi B, Sebti S, Hamilton AD, Chen J. p53 alpha-Helix mimetics antagonize p53/MDM2 interaction and activate p53. Mol Cancer Ther 2005; 4:1019–1025.[Abstract/Free Full Text]

  20. Haupt Y, Maya R, Kazaz A, Oren M. Mdm2 promotes the rapid degradation of p53. Nature 1997; 387:296–299.[CrossRef][Medline] [Order article via Infotrieve]

  21. Honda R, Tanaka H, Yasuda H. Oncoprotein MDM2 is a ubiquitin ligase E3 for tumor suppressor p53. FEBS Lett 1997; 420:25–27.[CrossRef][Medline] [Order article via Infotrieve]

  22. Kubbutat MH, Jones SN, Vousden KH. Regulation of p53 stability by Mdm2. Nature 1997; 387:299–303.[CrossRef][Medline] [Order article via Infotrieve]

  23. Secchiero P, Corallini F, Gonelli A, et al. Antiangiogenic activity of the MDM2 antagonist nutlin-3. Circ Res 2007; 100:61–69.[Abstract/Free Full Text]

  24. Efeyan A, Ortega-Molina A, Velasco-Miguel S, Herranz D, Vassilev LT, Serrano M. Induction of p53-dependent senescence by the MDM2 antagonist nutlin-3a in mouse cells of fibroblast origin. Cancer Res 2007; 67:7350–7357.[Abstract/Free Full Text]

  25. Gaidano G, Ballerini P, Gong JZ, et al. p53 mutations in human lymphoid malignancies: association with Burkitt lymphoma and chronic lymphocytic leukemia. Proc Natl Acad Sci U S A 1991; 88:5413–5417.[Abstract/Free Full Text]

  26. Wattel E, Preudhomme C, Hecquet B, et al. p53 mutations are associated with resistance to chemotherapy and short survival in hematologic malignancies. Blood 1994; 84:3148–3157.[Abstract/Free Full Text]

  27. Dohner H, Fischer K, Bentz M, et al. p53 gene deletion predicts for poor survival and non-response to therapy with purine analogs in chronic B-cell leukemias. Blood 1995; 85:1580–1589.[Abstract/Free Full Text]

  28. Cordone I, Masi S, Mauro FR, et al. p53 expression in B-cell chronic lymphocytic leukemia: a marker of disease progression and poor prognosis. Blood 1998; 91:4342–4349.[Abstract/Free Full Text]

  29. Grever MR, Lucas DM, Dewald GW, et al. Comprehensive assessment of genetic and molecular features predicting outcome in patients with chronic lymphocytic leukemia: results from the US Intergroup Phase III Trial E2997. J Clin Oncol 2007; 25:799–804.[Abstract/Free Full Text]

  30. Byrd JC, Mrozek K, Dodge RK, et al. Pretreatment cytogenetic abnormalities are predictive of induction success, cumulative incidence of relapse, and overall survival in adult patients with de novo acute myeloid leukemia: results from Cancer and Leukemia Group B (CALGB 8461). Blood 2002; 100:4325–4336.[Abstract/Free Full Text]

  31. Damle RN, Wasil T, Fais F, et al. Ig V gene mutation status and CD38 expression as novel prognostic indicators in chronic lymphocytic leukemia. Blood 1999; 94:1840–1847.[Abstract/Free Full Text]

  32. Hamblin TJ, Davis Z, Gardiner A, Oscier DG, Stevenson FK. Unmutated Ig V(H) genes are associated with a more aggressive form of chronic lymphocytic leukemia. Blood 1999; 94:1848–1854.[Abstract/Free Full Text]

  33. Crespo M, Bosch F, Villamor N, et al. ZAP-70 expression as a surrogate for immunoglobulin-variable-region mutations in chronic lymphocytic leukemia. N Engl J Med 2003; 348:1764–1775.[Abstract/Free Full Text]

  34. Austen B, Powell JE, Alvi A, et al. Mutations in the ATM gene lead to impaired overall and treatment-free survival that is independent of IGVH mutation status in patients with B-CLL. Blood 2005; 106:3175–3182.[Abstract/Free Full Text]

  35. Wiestner A, Rosenwald A, Barry TS, et al. ZAP-70 expression identifies a chronic lymphocytic leukemia subtype with unmutated immunoglobulin genes, inferior clinical outcome, and distinct gene expression profile. Blood 2003; 101:4944–4951.[Abstract/Free Full Text]

  36. Rassenti LZ, Huynh L, Toy TL, et al. ZAP-70 compared with immunoglobulin heavy-chain gene mutation status as a predictor of disease progression in chronic lymphocytic leukemia. N Engl J Med 2004; 351:893–901.[Abstract/Free Full Text]

  37. Oscier DG, Gardiner AC, Mould SJ, et al. Multivariate analysis of prognostic factors in CLL: clinical stage, IGVH gene mutational status, and loss or mutation of the p53 gene are independent prognostic factors. Blood 2002; 100:1177–1184.[Abstract/Free Full Text]

  38. Del Principe MI, Del Poeta G, Buccisano F, et al. Clinical significance of ZAP-70 protein expression in B-cell chronic lymphocytic leukemia. Blood 2006; 108:853–861.[Abstract/Free Full Text]

  39. Orchard JA, Ibbotson RE, Davis Z, et al. ZAP-70 expression and prognosis in chronic lymphocytic leukaemia. Lancet 2004; 363:105–111.[CrossRef][Medline] [Order article via Infotrieve]

  40. Dohner H, Stilgenbauer S, Benner A, et al. Genomic aberrations and survival in chronic lymphocytic leukemia. N Engl J Med 2000; 343:1910–1916.[Abstract/Free Full Text]

  41. Shanafelt TD, Witzig TE, Fink SR, et al. Prospective evaluation of clonal evolution during long-term follow-up of patients with untreated early-stage chronic lymphocytic leukemia. J Clin Oncol 2006; 24:4634–4641.[Abstract/Free Full Text]

  42. Zhao X, Li C, Paez JG, et al. An integrated view of copy number and allelic alterations in the cancer genome using single nucleotide polymorphism arrays. Cancer Res 2004; 64:3060–3071.[Abstract/Free Full Text]

  43. Nannya Y, Sanada M, Nakazaki K, et al. A robust algorithm for copy number detection using high-density oligonucleotide single nucleotide polymorphism genotyping arrays. Cancer Res 2005; 65:6071–6079.[Abstract/Free Full Text]

  44. Di X, Matsuzaki H, Webster TA, et al. Dynamic model based algorithms for screening and genotyping over 100 K SNPs on oligonucleotide microarrays. Bioinformatics 2005; 21:1958–1963.[Abstract/Free Full Text]

  45. Pfeifer D, Pantic M, Skatulla I, et al. Genome-wide analysis of DNA copy number changes and LOH in CLL using high-density SNP arrays. Blood 2007; 109:1202–1210.[Abstract/Free Full Text]

  46. Matsuzaki H, Dong S, Loi H, et al. Genotyping over 100,000 SNPs on a pair of oligonucleotide arrays. Nat Methods 2004; 1:109–111.[CrossRef][Medline] [Order article via Infotrieve]

  47. Ross CW, Ouillette PD, Saddler CM, Shedden KA, Malek SN. Comprehensive analysis of copy number and allele status identifies multiple chromosome defects underlying follicular lymphoma pathogenesis. Clin Cancer Res 2007; 13:4777–4785.[Abstract/Free Full Text]

  48. Cheson BD, Bennett JM, Grever M, et al. National Cancer Institute-sponsored Working Group guidelines for chronic lymphocytic leukemia: revised guidelines for diagnosis and treatment. Blood 1996; 87:4990–4997.[Free Full Text]

  49. Ouillette P, Erba H, Kujawski L, Kaminski M, Shedden K, Malek S. Integrated genomic profiling of chronic lymphocytic leukemia identifies subtypes of deletion 13q14. Cancer Research 2008; 68:4.

  50. Rai KR, Sawitsky A, Cronkite EP, Chanana AD, Levy RN, Pasternack BS. Clinical staging of chronic lymphocytic leukemia. Blood 1975; 46:219–234.[Abstract/Free Full Text]

  51. Lin M, Wei LJ, Sellers WR, Lieberfarb M, Wong WH, Li C. dChipSNP: significance curve and clustering of SNP-array-based loss-of-heterozygosity data. Bioinformatics 2004; 20:1233–1240.[Abstract/Free Full Text]

  52. Matthews C, Catherwood M, Morris TC, Alexander HD. Routine analysis of IgVH mutational status in CLL patients using BIOMED-2 standardized primers and protocols. Leuk Lymphoma 2004; 45:1899–1904.[CrossRef][Medline] [Order article via Infotrieve]

  53. Tovar C, Rosinski J, Filipovic Z, et al. Small-molecule MDM2 antagonists reveal aberrant p53 signaling in cancer: implications for therapy. Proc Natl Acad Sci U S A 2006; 103:1888–1893.[Abstract/Free Full Text]

  54. Hu B, Gilkes DM, Farooqi B, Sebti SM, Chen J. MDMX overexpression prevents p53 activation by the MDM2 inhibitor Nutlin. J Biol Chem 2006; 281:33030–33035.[Abstract/Free Full Text]

  55. Coll-Mulet L, Iglesias-Serret D, Santidrian AF, et al. MDM2 antagonists activate p53 and synergize with genotoxic drugs in B-cell chronic lymphocytic leukemia cells. Blood 2006; 107:4109–4114.[Abstract/Free Full Text]

  56. Watanabe T, Ichikawa A, Saito H, Hotta T. Overexpression of the MDM2 oncogene in leukemia and lymphoma. Leuk Lymphoma 1996; 21:391–397 color plates XVI following 395.[Medline] [Order article via Infotrieve]

  57. Pomerantz J, Schreiber-Agus N, Liegeois NJ, et al. The Ink4a tumor suppressor gene product, p19Arf, interacts with MDM2 and neutralizes MDM2's inhibition of p53. Cell 1998; 92:713–723.[CrossRef][Medline] [Order article via Infotrieve]

  58. Pettitt AR, Sherrington PD, Stewart G, Cawley JC, Taylor AM, Stankovic T. p53 dysfunction in B-cell chronic lymphocytic leukemia: inactivation of ATM as an alternative to TP53 mutation. Blood 2001; 98:814–822.[Abstract/Free Full Text]

  59. Secchiero P, Barbarotto E, Tiribelli M, et al. Functional integrity of the p53-mediated apoptotic pathway induced by the non-genotoxic agent nutlin-3a in B-cell chronic lymphocytic leukemia (B-CLL). Blood 2006; 107:4122–4129.[Abstract/Free Full Text]

  60. Kojima K, Konopleva M, McQueen T, O'Brien S, Plunkett W, Andreeff M. Mdm2 inhibitor Nutlin-3a induces p53-mediated apoptosis by transcription-dependent and transcription-independent mechanisms and may overcome Atm-mediated resistance to fludarabine in chronic lymphocytic leukemia. Blood 2006; 108:993–1000.[Abstract/Free Full Text]

  61. Thornton PD, Gruszka-Westwood AM, Hamoudi RA, et al. Characterisation of TP53 abnormalities in chronic lymphocytic leukaemia. Hematol J 2004; 5:47–54.[CrossRef][Medline] [Order article via Infotrieve]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?

Related Articles in Blood Online:

SNP309 as predictor for sensitivity of CLL cells to the MDM2 inhibitor nutlin-3a
Irina Seyfried, Sebastian Hofbauer, Markus Stoecher, Richard Greil, and Inge Tinhofer
Blood 2008 112: 2168. [Full Text] [PDF]

MDM2-SNP 309 allele status does not affect sensitivity to MDM2 inhibitors in CLL
Sami N. Malek
Blood 2008 112: 2169. [Full Text] [PDF]



This article has been cited by other articles:


Home page
BloodHome page
T. Zenz, S. Habe, T. Denzel, J. Mohr, D. Winkler, A. Buhler, A. Sarno, S. Groner, D. Mertens, R. Busch, et al.
Detailed analysis of p53 pathway defects in fludarabine-refractory chronic lymphocytic leukemia (CLL): dissecting the contribution of 17p deletion, TP53 mutation, p53-p21 dysfunction, and miR34a in a prospective clinical trial
Blood, September 24, 2009; 114(13): 2589 - 2597.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. Secchiero, E. Melloni, M. G. di Iasio, M. Tiribelli, E. Rimondi, F. Corallini, V. Gattei, and G. Zauli
Nutlin-3 up-regulates the expression of Notch1 in both myeloid and lymphoid leukemic cells, as part of a negative feedback antiapoptotic mechanism
Blood, April 30, 2009; 113(18): 4300 - 4308.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Bea, I. Salaverria, L. Armengol, M. Pinyol, V. Fernandez, E. M. Hartmann, P. Jares, V. Amador, L. Hernandez, A. Navarro, et al.
Uniparental disomies, homozygous deletions, amplifications, and target genes in mantle cell lymphoma revealed by integrative high-resolution whole-genome profiling
Blood, March 26, 2009; 113(13): 3059 - 3069.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
F. Corallini and C. Celeghini
The potential role of Nutlins in the treatment of B-chronic lymphocytic leukemia (B-CLL)
J. Leukoc. Biol., September 1, 2008; 84(3): 651 - 651.
[Full Text] [PDF]


Home page
BloodHome page
I. Seyfried, S. Hofbauer, M. Stoecher, R. Greil, and I. Tinhofer
SNP309 as predictor for sensitivity of CLL cells to the MDM2 inhibitor nutlin-3a
Blood, September 1, 2008; 112(5): 2168 - 2168.
[Full Text] [PDF]


Home page
BloodHome page
S. N. Malek
MDM2-SNP 309 allele status does not affect sensitivity to MDM2 inhibitors in CLL
Blood, September 1, 2008; 112(5): 2169 - 2169.
[Full Text] [PDF]


Home page
BloodHome page
L. Kujawski, P. Ouillette, H. Erba, C. Saddler, A. Jakubowiak, M. Kaminski, K. Shedden, and S. N. Malek
Genomic complexity identifies patients with aggressive chronic lymphocytic leukemia
Blood, September 1, 2008; 112(5): 1993 - 2003.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Shangary, D. Qin, D. McEachern, M. Liu, R. S. Miller, S. Qiu, Z. Nikolovska-Coleska, K. Ding, G. Wang, J. Chen, et al.
Temporal activation of p53 by a specific MDM2 inhibitor is selectively toxic to tumors and leads to complete tumor growth inhibition
PNAS, March 11, 2008; 105(10): 3933 - 3938.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Tables and Figure
Right arrow All Versions of this Article:
blood-2007-09-112698v1
111/3/1584    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saddler, C.
Right arrow Articles by Malek, S. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saddler, C.
Right arrow Articles by Malek, S. N.
Related Collections
Right arrow Neoplasia
Right arrowRelated Articles in Blood Online
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2008 by American Society of Hematology         Online ISSN: 1528-0020