Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 15 February 2008, Vol. 111, No. 4, pp. 2246-2252.
Prepublished online as a Blood First Edition Paper on November 28, 2007; DOI 10.1182/blood-2007-05-092759.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
blood-2007-05-092759v1
111/4/2246    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Roos, G.
Right arrow Articles by Stilgenbauer, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Roos, G.
Right arrow Articles by Stilgenbauer, S.
Related Collections
Right arrow Neoplasia
Right arrowRelated Articles in Blood Online
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

NEOPLASIA

Short telomeres are associated with genetic complexity, high-risk genomic aberrations, and short survival in chronic lymphocytic leukemia

Göran Roos1, Alexander Kröber2, Pawel Grabowski1, Dirk Kienle2, Andreas Bühler2, Hartmut Döhner2, Richard Rosenquist3, and Stephan Stilgenbauer2

1 Department of Medical Biosciences, Umeå University, Umeå, Sweden; 2 Universität Ulm, Innere Medizin III, Ulm, Germany; and 3 Department of Genetics and Pathology, Uppsala University, Uppsala, Sweden


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Authorship
 References
 
Telomere length is associated with mutation status of the immunoglobulin heavy chain variable (IGHV) gene and clinical course in B-cell chronic lymphocytic leukemia (B-CLL). In a B-CLL cohort of 152 patients, we analyzed telomere length, genomic aberrations, IGHV mutation status, CD38 and ZAP-70 expression to study the prognostic impact and associations among these factors. An inverse correlation existed between telomere length and IGHV homology (P < .001), CD38 (P < .001), and ZAP-70 expression (P = .01). Patients with telomere lengths below median (ie, "short telomeres") and above median (ie, "long telomeres") had similar incidences of genomic aberrations (74% vs 68%), 13q– (57% vs 49%), and +12q (5% vs 12%). In contrast, 13q– as a single aberration was more frequent in patients with long telomeres (51% vs 21%; P = .006), whereas 11q– (27% vs 9%; P = .014), 17p– (17% vs 0%; P < .001), and 2 or more genomic aberrations (39% vs 8%; P < .001) were more frequent in patients with short telomeres. Compared with patients with long telomeres, treatment-free survival (TFS) and overall survival (OS) was significantly shorter (P < .001 and P = .015, respectively) in the group with short telomeres, and telomere length was an independent prognostic indicator for TFS. These observations have biological and prognostic implications in B-CLL.


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Authorship
 References
 
B-cell chronic lymphocytic leukemia (B-CLL), the most common leukemia in adults in the Western world, is characterized by a monoclonal expansion of mature B lymphocytes expressing CD19, CD5, and CD23 on the cell surface.1 B-CLL is a clinically heterogeneous disease with survival times ranging from months to normal lifespan.2 As a consequence of the variable clinical course, it has become very crucial to identify reliable prognostic factors useful in planning therapeutic strategies and predicting the outcome. A number of biological features of B-CLL have been described, and several of them can be used to discern different groups of patients with significant differences in clinical course and outcome. The immunoglobulin heavy chain variable (IGHV) gene mutation status analysis reveals 2 subgroups of B-CLL,35 with a more favorable clinical course for patients with mutated IGHV genes.69

The surface marker CD38 has been proposed as a surrogate marker for IGHV gene mutation status in B-CLL,3 but the association between these markers was shown to be rather weak.711 Furthermore, CD38 has been shown to be an independent prognostic marker, although no consensus has been reached concerning cut-off levels.7,8,1113 Expression of the protein tyrosine kinase ZAP-70 is strongly associated with IGHV gene mutation status and can be used as an independent prognostic factor.1416 Although discordant results have been reported lately, certain IGHV gene usage (eg, IgHV3-21) and presence of high-risk genomic aberrations (eg, 11q– and 17p–) can explain these findings at least in part.17,18

In mature B-cell neoplasms, telomere length correlates with histopathogenesis according to the germinal center.19 This feature includes B-CLL showing a strong correlation between telomere length and IGHV gene mutation status.6,1922 Short telomeres are associated with unmutated IGHV genes and have a significantly shorter median survival time compared with patients with long telomeres.6,2022

A hallmark of B-CLL is the occurrence of specific genomic aberrations, and using fluorescence in situ hybridization (FISH), genetic abnormalities have been detected in approximately 80% of patients with B-CLL.23 The most frequent aberration is deletion of 13q14, which observed as a sole abnormality is associated with favorable outcome, whereas patients with deletions of 17p and 11q experience an aggressive disease.2431 Of interest, the genetic subgroups demonstrate characteristic gene-expression profiles implicating different pathogenetic mechanisms.32

Short telomeres are associated with genetic instability in cell culture, and for solid tumors, telomere dysfunction was found to cause bridge-breakage events leading to a reorganization of the tumor cell genome.33 A similar scenario could prevail in CLL, and in the present study, we investigated the association between telomere length and genetic aberrations, IGHV gene mutation status, and its "surrogate" markers CD38 and ZAP-70. A novel association was identified between telomere length and the type of genomic aberration (high or low risk) as well as karyotype complexity.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Authorship
 References
 
Patients and tumor samples

In this study, we analyzed samples from 152 consenting patients with CLL diagnosed and treated at the University Hospital in Ulm, Germany. Survival data were available for 147 patients. Details on patient characteristics and correlation of clinical as well as biological parameters with telomere length are given in "Results." Approval was obtained from the University of Ulm institutional review board for these studies. Informed consent was obtained in accordance with the Declaration of Helsinki.

Telomere length determination by quantitative real-time PCR

Telomere length assessment was performed using a quantitative real-time polymerase chain reaction method (Tel-PCR).34 The technique was evaluated in an earlier study on B-CLL from our laboratory,21 showing a significant correlation with Southern blot data. In the present study, modifications to the original protocol included new sets of primers (R. M. Cawthon, written personal communication, October 2004): tel 1b, CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT; tel 2b, GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT; HBG3, TGTGCTGGCCCATCACTTTG; and HBG4, ACCAGCCACCACTTTCTGATAGG.

The primer concentrations were: 100 nM tel 1b primer and 900 nM tel 2b primer for telomere amplification; and 400 nM HBG3 primer and 400 nM HBG4 primer for single copy gene amplification. Genomic Escherichia coli DNA was added to the reaction mix to act as a carrier DNA in order to reduce variation between replicates (R. M. Cawthon, written personal communication, October 2004). All samples were analyzed in triplicates (35 ng DNA/aliquot). The Tel-PCR method provides a relative telomere length value (T/S).

IGHV gene mutation analysis

IGHV gene sequencing was performed as previously described.7 An IGHV gene sequence showing less than 98% homology with the corresponding germ-line gene was considered to be mutated.

Analysis of genomic aberrations

The analysis of genomic aberrations was performed using FISH as previously described.31 The imbalances studied were del(17)(p13), +12q, del(11)(q22-q23), and del(13)(q14).

ZAP-70 expression analysis

Flow cytometry was performed as previously described.17 The antibodies used were: anti–ZAP-70 antibody (clone 2F3.2; Upstate, Hamburg, Germany), goat anti mouse-FITC (Dako, Hamburg, Germany), anti-CD3-PE (clone SK7; BD Bioscience, Heidelberg, Germany), anti-CD56-PE (clone My 31; BD Bioscience), anti-CD19–ECD (clone HD237; Beckman Coulter, Fullerton, CA) and anti-CD5–PC5 (clone BL1a; Beckman Coulter).

CD38 expression analysis

CD38 expression was analyzed as previously described7 using the following antibody conjugates: anti-CD5–FITC (clone L17F12), anti-CD19–PerCPCy5.5 (clone SJ25C1), and anti-CD38–PE (clone HB-7; all from Becton Dickinson, Heidelberg, Germany). A cut off at 7% was used based on data in Kröber et al.7

Statistical analyses

The endpoints were overall survival (OS) and treatment-free survival (TFS) from the point of diagnosis. Survival curves were plotted according to the Kaplan-Meier method, and the differences in OS and TFS were analyzed by the log-rank test. Differences between groups were analyzed using the Mann-Whitney U test. For multivariate analysis, the Cox proportional hazards regression model was used.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Authorship
 References
 
Patients

Telomere length and IGHV gene mutation status were assessed in all 152 samples. ZAP-70 and CD38 expression data were available for 152 and 144 patients, respectively. Major B-CLL genomic aberrations were analyzed in all but one patient. Full clinical data were available in 147 patients: the median age at diagnosis was 56 years (range, 25–79 years), and the median time from diagnosis to study was 18 months (range, 0–334 months). The male-female ratio was 2.2. Median follow-up time was 52.0 months, median TFS was 41.4 months (95% CI: 31.3–86.1, 81 events), and median OS was 301 months (95% CI: 171 to infinity, 21 events). Treatment prior to study had been administered to 27 (18%) patients with a median of 3 lines of therapy (range, 1–5 lines of therapy). The median time from prior therapy to study was 36.3 months (range, 4–168 months). First-line and subsequent treatments were heterogeneous precluding detailed analyses on the relation between type of prior therapy and telomere length (data not shown). There was no significant correlation between telomere length and number of prior lines of therapy but the group with prior therapy overall showed a trend toward shorter telomeres (P = .055). Data on staging according to Binet were available for 140 patients (96 were stage A and 44 were stage B or C). The incidences of genetic parameters in the different stage groups followed the expected distribution (data not shown).

Telomere length determination

Telomere length was assessed for all 152 patients enrolled in the study, with a median T/S value of 0.3575 (range, 0.0598–1.2305). When converting T/S values to telomere restriction fragment (TRF) length values in kilobase pairs, using the previously published formula,21 the mean telomere length was 4.4 kbp (range, 3.32–7.1 kbp).

IGHV gene mutation status

IGHV gene mutation analysis was successful in all patients in the study. A total of 80 patients presented unmutated IGHV genes (more than 98% homology to germ line), and in 72 patients the IGHV genes were mutated.

Association between telomere length and other clinical parameters

No significant association between telomere length and age or sex was found in the examined cohort (P = .114 and .723, respectively; data not shown). We could show a clear correlation between telomere length and Binet staging (P = .01), CD38 (P < .001), and ZAP-70 expression (P < .001; Figure 1A-C). We could also confirm the difference in telomere length distribution between patients with mutated and unmutated IGHV genes in this independent data set (P < .001), where the mutated cases had longer telomeres (Figure 1D). Several patients showing discordance between telomere length and IGHV mutation status were noted: 21 patients with long telomeres (values above median T/S) and unmutated IGHV genes, and 17 patients presented short telomeres (values below median T/S) and mutated IGHV genes.


Figure 1
View larger version (19K):
[in this window]
[in a new window]

 
Figure 1. Telomere length distribution in relation to established prognostic factors. (A) Telomere length versus stage. (B) Telomere length versus CD38 expression. (C) Telomere length versus ZAP-70 expression. (D) Telomere length versus IGHV mutation status. The boxes shown present median value and interquartile range, and the whiskers minimum and maximal values, except for outliers.

 
Association between telomere length and genomic aberrations

The analysis of genomic aberrations was successful in all patients studied (n = 151). The poor prognostic markers del(17)(p13) and del(11)(q22-q23) were found in 13 and 8 patients, respectively. del(13)(q14) was present in 54 patients and +12 was present in 27 patients; in 44 patients, no abnormality was shown by FISH. We observed a significant difference in telomere length distribution between patients with more than one aberration compared with the patients with normal karyotype or only one abnormality (P < .001; Figure 2A,B). After exclusion of 13q– patients, it was found that the presence of any other cytogenetic abnormality increased the likelihood of shortened telomere length (Figure 2C,D). We could also establish that short telomeres were associated with genetic complexity, indicated by a high number of aberrations and occurrence of unfavorable chromosomal abnormalities such as del(11)(q22-q23) and del(17)(p13) (Table 1). In the subgroup presenting deletion of 17p, all 13 patients demonstrated short telomeres (P < .001; Table 1). Another unfavorable abnormality, del(11q), was significantly more prevalent in patients displaying short telomeres (P = .002; Table 1). No substantial difference in distribution of +12 between groups was discerned (P = .985; Table 1). Deletion 13q, associated with better prognosis, was more frequent among patients with long telomeres (P < .001; Table 1).


Figure 2
View larger version (29K):
[in this window]
[in a new window]

 
Figure 2. Telomere length and genomic aberrations detected by FISH. (A) Telomere length in relation to number of genomic aberrations. (B) Distribution of patients with long and short telomeres in relation to number of genomic aberrations. (C) Telomere length in relation to number of genomic aberrations after exclusion of 13q– patients. (D) Distribution of patients with long and short telomeres in relation to number of genomic aberrations after exclusion of 13q– patients. The boxes shown in panels A and C present medium value and interquartile range, and the whiskers minimum and maximal values, except for outliers.

 


View this table:
[in this window]
[in a new window]

 
Table 1. Distribution of FISH-detected genomic aberrations in relation to telomere length and survival

 
Prognostic implications of telomere length, CD38 expression, ZAP-70 expression, IGHV mutation status, and high-risk genomic aberrations in univariate and multivariate analyses

When the material was divided at the median telomere length, a significant difference in OS (P = .015; Figure 3A) and TFS (P < .001; Figure 3B) was observed. Furthermore, the prognostic impact of telomere length on TFS was unchanged after excluding the patients presenting unfavorable genetic abnormalities (P = .006; data not shown). All the other parameters studied (IGHV mutation status, ZAP-70, CD38, and high-risk genomic aberrations) showed a highly significant association to OS and TFS as previously demonstrated (data not shown in figures).


Figure 3
View larger version (18K):
[in this window]
[in a new window]

 
Figure 3. Survival after subdivision of the patients with CLL into 2 groups with a cut-off value at the median telomere length. (A) OS. (B) TFS.

 
The proportional hazards regression model of Cox was used to investigate the prognostic impact of short telomere length, Binet stage B/C, CD38 and ZAP-70 positivity, unmutated IGHV genes, and presence of high-risk genomic aberrations (17p– or 11q–) on TFS in our cohort of patients with B-CLL. When all factors were incorporated in the model, Binet stage B/C and short telomeres were identified as independent prognostic factors for TFS (Table 2). As advanced stage is clinically the primary marker for initiation of treatment and therefore directly related to TFS, we performed an additional analysis excluding stage. This resulted in the identification of the presence of high-risk genomic aberrations as the sole significant prognostic factor (Table 2). Multivariate analysis was not performed for OS due to too few events in the individual risk groups.


View this table:
[in this window]
[in a new window]

 
Table 2. Multivariate analysis of TFS including the high-risk parameters studied

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Authorship
 References
 
In the present study, we show that telomere length correlated strongly with established prognostic markers (IGHV mutation status, CD38, and ZAP-70) as well as the clinical course in B-CLL where short telomere length predicted an unfavorable clinical outcome. Interestingly, a novel association was identified between telomere length and the type of genomic aberration (high or low risk) as well as karyotype complexity. However, what could be the biological background for the latter finding?

The original "mortality stages 1 and 2 (M1 and M2) model" states that human cells must overcome 2 mechanisms to become immortalized, namely senescence induction (M1) and cell death due to critically short telomeres (M2).35,36 M1 can be overcome by, for example, p53 and Rb inactivation,36 whereas M2 is characterized by very short telomeres, genetic instability, and high cell death. Immortalization usually occurs by up-regulation of telomerase activity, giving telomere length stabilization. Malignant tumors generally demonstrate active telomerase and shorter telomeres than their normal cellular counterparts.3740 Telomere shortening also plays a role in epithelial carcinogenesis by promoting chromosomal rearrangements in mice,41 a scenario also indicated in human tumorigenesis.33,42

In hematopoietic malignancies, an increased frequency of genetic alterations has been coupled to short telomeres.4345 Accordingly, we could demonstrate that short telomeres were associated with a higher number of genomic aberrations in CLL. The collected data are basically in agreement with the M1/M2 model and can be interpreted as an accumulative effect of 2 main events: (1) genetic alterations force cells to bypass senescence (M1), leading to additional telomere attrition; and (2) short telomeres induce genetic instability. Our most interesting observation was the strong association between telomere length and specific cytogenetic abnormalities, since short telomeres and 17p– or 11q– abnormalities were coupled, whereas 13q– single patients were characterized by long telomeres. Thus, bad prognostic cytogenetics was linked to short telomeres and good prognostic cytogenetic features was linked to long telomeres. Ricca et al have reported a nonsignificant trend toward an association between short telomere length and high-risk cytogenetics, partially supporting our findings.46

Normal germinal-center B cells are telomerase activity positive, and significant telomere elongation occurs during the germinal-center reaction concomitant with induction of the IG gene hypermutation machinery.47,48 Thus, B cells with mutated IGHV genes have longer telomeres than B cells with unmutated genes. These characteristics have been argued to form a basis for the strong association demonstrated here and elsewhere between telomere length and IGHV gene mutation status,6,21,22 indicating that the telomere length is "preset" depending on the germinal-center experience of the original B cell giving rise to a CLL clone. It is conceivable that the CLL-initiating B cells differ in telomere length from start.

A kinetic study of CLL demonstrated that the cellular birth rate was considerable in many patients, indicating a dynamic clonal progression, and a correlation between birth rate and disease activity seemed to exist.49 These data suggest that cell kinetic characteristics can contribute to differences in telomere length. Furthermore, cytogenetic subgroups of B-CLL have demonstrated interesting gene expression profiles. Patients with 11q– showed decreased expression of ATM, and p53 expression was low in 17p– patients, indicating a reduced DNA damage response in both cytogenetic groups32 in accordance with a deregulated senescence checkpoint. 17p– was also associated with an up-regulation of c-myc, a putative positive regulator of hTERT, and since p53 is a negative regulator of hTERT, a possible combined effect is telomerase activation.5052 This scenario fits with earlier data on high telomerase and short telomeres in poor-prognosis CLL,22 which also strengthens the notion that these patients start with short telomeres.

In the present study, we found a strong correlation between short telomeres and the expression of ZAP-70 and CD38, both established indicators of B-CLL prognosis. CD38 together with ZAP-70 appear to be partners in a pathway that may sustain signals mediated by the B-cell receptor promoting cell proliferation.53 11q– or 17p– aberration in combination with overexpression of ZAP-70 and/or CD38 give cells a survival advantage and facilitates cell-cycle progression, one consequence of which is telomere attrition. Thus, a number of factors characterizing the poor-prognostic group of CLL contribute to the "short telomere phenotype." Finally, it cannot be fully excluded that short telomeres in patients with 11q– or 17p– may be the result of selection, since it might be a prerequisite with 17p– (p53 low) and/or 11q– (reduced ATM) to survive for cells with very short telomeres.

Using univariate analysis, all parameters investigated in the present CLL cohort (telomere length, IGHV mutation status, ZAP-70, CD38, and cytogenetic group) could subdivide the material into groups with significantly different outcomes with respect to TFS in line with a number of previous studies.3,5,7,10,13,1517 In multiparameter analysis, including all negative prognostic indicators studied, only Binet stage B/C and short telomeres were independent indicators of TFS, and when excluding stage, only high-risk genomic aberrations seemed to be an independent parameter. Surprisingly, the IGHV mutation status had no independent prognostic value for TFS in either model. Thus, there are a number of prognostic factors identified in CLL with mutation status as the "role model," with the other factors often called surrogate markers for mutation status. In the future, it is less likely that one parameter will be used as "the marker" for subdivision of CLL into prognostic subgroups giving guidance for therapy, and a more possible scenario is a prognostic index using a combination of markers. In this context, our present study suggests that telomere length, easily determined by a rapid PCR method, must be taken into serious consideration.

Telomerase is a promising target for cancer therapy.54 Regarding CLL, the "short telomere phenotype" should be of interest, since these patients constitute a bad prognosis group needing better treatment strategies. Increased telomere attrition rate by inhibiting telomerase would theoretically lead to accentuated cell death in this patient cohort.


    Authorship
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Authorship
 References
 
Contribution: G.R. and S.S. designed research, analyzed data, and wrote the paper; P.G. performed research, analyzed data, and wrote the paper; A.K., D.K., A.B., and H.D. performed research and analyzed data; and R.R. analyzed data and wrote the paper.

Conflict-of-interest disclosure: The authors declare no competing financial interests.

Correspondence: Göran Roos, Department of Medical Biosciences, Umeå University, S-90187, Umeå, Sweden; e-mail: goran.roos{at}medbio.umu.se.


    Acknowledgments
 
Silja Groner is thankfully acknowledged for data collection and management.

This study was supported by grants from the Swedish Cancer Society, the Medical Faculty, Umeå University, Lion's Cancer Research Foundation at Umeå University, Krebshilfe (106142), José Carreras Leukämie-Stiftung (R 05/25), DFG STI 296/1-1, and by grant LSHC-CT-2004-502943 Mol Cancer Med from the European Union.


    Footnotes
 
Submitted May 30, 2007; accepted November 16, 2007.

Prepublished online as Blood First Edition Paper, November 28, 2007 DOI: 10.1182/blood-2007-05-092759

A.K. and P.G. contributed equally to this work.

An Inside Blood analysis of this article appears at the front of this issue.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 USC section 1734.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Authorship
 References
 

  1. Matutes E and Polliack A. Morphological and immunophenotypic features of chronic lymphocytic leukemia. Rev Clin Exp Hematol 2000; 4:22–47.[CrossRef][Medline] [Order article via Infotrieve]

  2. Kipps TJ. Chronic lymphocytic leukemia. Curr Opin Hematol 2000; 7:223–234.[CrossRef][Medline] [Order article via Infotrieve]

  3. Damle RN, Wasil T, Fais F, et al. Ig V gene mutation status and CD38 expression as novel prognostic indicators in chronic lymphocytic leukemia. Blood 1999; 94:1840–1847.[Abstract/Free Full Text]

  4. Fais F, Ghiotto F, Hashimoto S, et al. Chronic lymphocytic leukemia B cells express restricted sets of mutated and unmutated antigen receptors. J Clin Invest 1998; 102:1515–1525.[Medline] [Order article via Infotrieve]

  5. Hamblin TJ, Davis Z, Gardiner A, Oscier DG, Stevenson FK. Unmutated Ig VH genes are associated with a more aggressive form of chronic lymphocytic leukemia. Blood 1999; 94:1848–1854.[Abstract/Free Full Text]

  6. Hultdin M, Rosenquist R, Thunberg U, et al. Association between telomere length and V(H) gene mutation status in chronic lymphocytic leukaemia: clinical and biological implications. Br J Cancer 2003; 88:593–598.[CrossRef][Medline] [Order article via Infotrieve]

  7. Kröber A, Seiler T, Benner A, et al. VH mutation status, CD38 expression level, genomic aberrations, and survival in chronic lymphocytic leukemia. Blood 2002; 100:1410–1416.[Abstract/Free Full Text]

  8. Oscier DG, Gardiner AC, Mould SJ, et al. Multivariate analysis of prognostic factors in CLL: clinical stage, IGVH gene mutational status, and loss or mutation of the p53 gene are independent prognostic factors. Blood 2002; 100:1177–1184.[Abstract/Free Full Text]

  9. Thunberg U, Johnson A, Roos G, et al. CD38 expression is a poor predictor for VH gene mutational status and prognosis in chronic lymphocytic leukemia. Blood 2001; 97:1892–1894.[Free Full Text]

  10. Hamblin TJ, Orchard JA, Ibbotson RE, et al. CD38 expression and immunoglobulin variable region mutations are independent prognostic variables in chronic lymphocytic leukemia, but CD38 expression may vary during the course of the disease. Blood 2002; 99:1023–1029.[Abstract/Free Full Text]

  11. Jelinek DF, Tschumper RC, Geyer SM, et al. Analysis of clonal B-cell CD38 and immunoglobulin variable region sequence status in relation to clinical outcome for B-chronic lymphocytic leukaemia. Br J Haematol 2001; 115:854–861.[CrossRef][Medline] [Order article via Infotrieve]

  12. Matrai Z. CD38 as a prognostic marker in CLL. Hematology 2005; 10:39–46.[Medline] [Order article via Infotrieve]

  13. Ibrahim S, Keating M, Do KA, et al. CD38 expression as an important prognostic factor in B-cell chronic lymphocytic leukemia. Blood 2001; 98:181–186.[Abstract/Free Full Text]

  14. Crespo M, Bosch F, Villamor N, et al. ZAP-70 expression as a surrogate for immunoglobulin-variable-region mutations in chronic lymphocytic leukemia. N Engl J Med 2003; 348:1764–1775.[Abstract/Free Full Text]

  15. Orchard JA, Ibbotson RE, Davis Z, et al. ZAP-70 expression and prognosis in chronic lymphocytic leukaemia. Lancet 2004; 363:105–111.[CrossRef][Medline] [Order article via Infotrieve]

  16. Wiestner A, Rosenwald A, Barry TS, et al. ZAP-70 expression identifies a chronic lymphocytic leukemia subtype with unmutated immunoglobulin genes, inferior clinical outcome, and distinct gene expression profile. Blood 2003; 101:4944–4951.[Abstract/Free Full Text]

  17. Kröber A, Bloehdorn J, Hafner S, et al. Additional genetic high-risk features such as 11q deletion, 17p deletion, and V3–21 usage characterize discordance of ZAP-70 and VH mutation status in chronic lymphocytic leukemia. J Clin Oncol 2006; 24:969–975.[Abstract/Free Full Text]

  18. Rassenti LZ, Huynh L, Toy TL, et al. ZAP-70 compared with immunoglobulin heavy-chain gene mutation status as a predictor of disease progression in chronic lymphocytic leukemia. N Engl J Med 2004; 351:893–9.[Abstract/Free Full Text]

  19. Ladetto M, Compagno M, Ricca I, et al. Telomere length correlates with histopathogenesis according to the germinal center in mature B-cell lymphoproliferative disorders. Blood 2004; 103:4644–4649.[Abstract/Free Full Text]

  20. Grabowski P, Hultdin M, Karlsson K, et al. Telomere length as a prognostic parameter in chronic lymphocytic leukemia with special reference to VH gene mutation status. Blood 2005; 105:4807–4812.[Abstract/Free Full Text]

  21. Damle RN, Batliwalla FM, Ghiotto F, et al. Telomere length and telomerase activity delineate distinctive replicative features of the B-CLL subgroups defined by immunoglobulin V gene mutations. Blood 2004; 103:375–382.[Abstract/Free Full Text]

  22. Bechter OE, Eisterer W, Pall G, et al. Telomere length and telomerase activity predict survival in patients with B cell chronic lymphocytic leukemia. Cancer Res 1998; 58:4918–4922.[Abstract/Free Full Text]

  23. Oscier D. Biology and prognostic factors in CLL. Hematology 2005; 10:197–199.[CrossRef][Medline] [Order article via Infotrieve]

  24. Rai KR, Döhner H, Keating MJ, Montserrat E. Chronic lymphocytic leukemia: case-based session. Hematology 2001; 2001:140–156.[CrossRef]

  25. Döhner H, Stilgenbauer S, James MR, et al. 11q deletions identify a new subset of B-cell chronic lymphocytic leukemia characterized by extensive nodal involvement and inferior prognosis. Blood 1997; 89:2516–2522.[Abstract/Free Full Text]

  26. Juliusson G, Oscier DG, Fitchett M, et al. Prognostic subgroups in B-cell chronic lymphocytic leukemia defined by specific chromosomal abnormalities. N Engl J Med 1999; 323:720–724.

  27. Montillo M, Hamblin T, Hallek M, Montserrat E, Morra E. Chronic lymphocytic leukemia: novel prognostic factors and their relevance for risk-adapted therapeutic strategies. Haematologica 2005; 90:391–399.[Abstract/Free Full Text]

  28. Döhner H, Stilgenbauer S, Döhner K, Bentz M, Lichter P. Chromosome aberrations in B-cell chronic lymphocytic leukemia: reassessment based on molecular cytogenetic analysis. J Mol Med 1999; 77:266–281.[CrossRef][Medline] [Order article via Infotrieve]

  29. Stilgenbauer S, Döhner K, Bentz M, Lichter P, Döhner H. Molecular cytogenetic analysis of B-cell chronic lymphocytic leukemia. Ann Hematol 1998; 76:101–110.[CrossRef][Medline] [Order article via Infotrieve]

  30. Stilgenbauer S, Bullinger L, Lichter P, Döhner H. German CLL Study Group(GCLLSG). Genetics of chronic lymphocytic leukemia: genomic aberrations and V(H) gene mutation status in pathogenesis and clinical course. Leukemia 2002; 16:993–1007.[CrossRef][Medline] [Order article via Infotrieve]

  31. Döhner H, Stilgenbauer S, Benner A, et al. Genomic aberrations and survival in chronic lymphocytic leukemia. N Engl J Med 2000; 343:1910–1916.[Abstract/Free Full Text]

  32. Kienle DL, Korz C, Hosch B, et al. Evidence for distinct pathomechanisms in genetic subgroups of chronic lymphocytic leukemia revealed by quantitative expression analysis of cell cycle, activation, and apoptosis-associated genes. J Clin Oncol 2005; 23:3780–3792.[Abstract/Free Full Text]

  33. Gisselsson D, Jonson T, Petersen A, et al. Telomere dysfunction triggers extensive DNA fragmentation and evolution of complex chromosome abnormalities in human malignant tumors. Proc Natl Acad Sci U S A 2001; 98:12683–12688.[Abstract/Free Full Text]

  34. Cawthon RM. Telomere measurement by quantitative PCR. Nucl Acids Res 2002; 30:e47.[Abstract/Free Full Text]

  35. Wright WE, Pereira-Smith OM, Shay JW. Reversible cellular senescence: implications for immortalization of normal human diploid fibroblasts. Mol Cell Biol 1989; 9:3088–3092.[Abstract/Free Full Text]

  36. Shay JW, Pereira-Smith OM, Wright WE. A role for both RB and p53 in the regulation of human cellular senescence. Exp Cell Res 1991; 196:33–39.[CrossRef][Medline] [Order article via Infotrieve]

  37. Gertler R, Rosenberg R, Stricker D, et al. Telomere length and human telomerase reverse transcriptase expression as markers for progression and prognosis of colorectal carcinoma. J Clin Oncol 2004; 22:1807–1814.[Abstract/Free Full Text]

  38. Norrback KF and Roos G. Telomeres and telomerase in normal and malignant haematopoietic cells. Eur J Cancer 1997; 33:774–780.[CrossRef][Medline] [Order article via Infotrieve]

  39. Brummendorf TH, Holyoake TL, Rufer N, et al. Prognostic implications of differences in telomere length between normal and malignant cells from patients with chronic myeloid leukemia measured by flow cytometry. Blood 2000; 95:1883–1890.[Abstract/Free Full Text]

  40. Ohyashiki JH, Sashida G, Tauchi T, Ohyashiki K. Telomeres and telomerase in hematologic neoplasia. Oncogene 2002; 21:680–687.[CrossRef][Medline] [Order article via Infotrieve]

  41. Artandi SE, Chang S, Lee SL, et al. Telomere dysfunction promotes non-reciprocal translocations and epithelial cancers in mice. Nature 2000; 406:641–645.[CrossRef][Medline] [Order article via Infotrieve]

  42. Stewenius Y, Gorunova L, Jonson T, et al. Structural and numerical chromosome changes in colon cancer develop through telomere-mediated anaphase bridges, not through mitotic multipolarity. Proc Natl Acad Sci U S A 2005; 102:5541–5546.[Abstract/Free Full Text]

  43. Wu KD, Orme LM, Shaughnessy J Jr, et al. Telomerase and telomere length in multiple myeloma: correlations with disease heterogeneity, cytogenetic status, and overall survival. Blood 2003; 101:4982–4989.[Abstract/Free Full Text]

  44. Swiggers SJ, Kuijpers MA, de Cort MJ, Beverloo HB, Zijlmans JM. Critically short telomeres in acute myeloid leukemia with loss or gain of parts of chromosomes. Genes Chromosomes Cancer 2006; 45:247–256.[CrossRef][Medline] [Order article via Infotrieve]

  45. Sieglova Z, Zilovcova S, Cermak J, et al. Dynamics of telomere erosion and its association with genome instability in myelodysplastic syndromes (MDS) and acute myelogenous leukemia arising from MDS: a marker of disease prognosis? Leuk Res 2004; 28:1013–1021.[CrossRef][Medline] [Order article via Infotrieve]

  46. Ricca I, Rocci A, Drandi D, et al. Telomere length identifies two different prognostic subgroups among VH-unmutated B-cell chronic lymphocytic leukemia patients. Leukemia 2007; 21:697–705.[Medline] [Order article via Infotrieve]

  47. MacLennan IC. Germinal centers. Annu Rev Immunol 1994; 12:117–139.[CrossRef][Medline] [Order article via Infotrieve]

  48. Norrback KF, Hultdin M, Dahlenborg K, et al. Telomerase regulation and telomere dynamics in germinal centers. E J Haematol 2001; 67:309–317.[CrossRef]

  49. Messmer BT, Messmer D, Allen SL, et al. In vivo measurements document the dynamic cellular kinetics of chronic lymphocytic leukemia B cells. J Clin Invest 2005; 115:755–764.[CrossRef][Medline] [Order article via Infotrieve]

  50. Xu D, Popov N, Hou M, et al. Switch from Myc/Max to Mad1/Max binding and decrease in histone acetylation at the telomerase reverse transcriptase promoter during differentiation of HL60 cells. Proc Natl Acad Sci U S A 2001; 98:3826–3831.[Abstract/Free Full Text]

  51. Xu D, Wang Q, Gruber A, et al. Downregulation of telomerase reverse transcriptase mRNA expression by wild type p53 in human tumor cells. Oncogene 2000; 19:5123–5133.[CrossRef][Medline] [Order article via Infotrieve]

  52. Kyo S, Takakura M, Taira T, et al. Sp1 cooperates with c-Myc to activate transcription of the human telomerase reverse transcriptase gene (hTERT). Nucl Acids Res 2000; 28:669–677.[Abstract/Free Full Text]

  53. Deaglio S, Vaisitti T, Aydin S, Ferrero E, Malavasi F. In-tandem insight from basic science combined with clinical research: CD38 as both marker and key component of the pathogenetic network underlying chronic lymphocytic leukemia. Blood 2006; 108:1135–1144.[Abstract/Free Full Text]

  54. Keith WN, Bilsland A, Hardie M, Evans TR. Drug insight: cancer cell immortality-telomerase as a target for novel cancer gene therapies. Nat Clin Pract Oncol 2004; 1:88–96.[CrossRef][Medline] [Order article via Infotrieve]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?

Related Articles in Blood Online:

Short telomeres in B-CLL: the chicken or the egg?
Bernd Jahrsdörfer and George J. Weiner
Blood 2008 111: 5756. [Full Text] [PDF]

Response: Or both?
Göran Roos, Richard Rosenquist, and Stephan Stilgenbauer
Blood 2008 111: 5756-5757. [Full Text] [PDF]

Do short telomeres shorten CLL survival?
Thomas S. Lin
Blood 2008 111: 1755. [Full Text] [PDF]



This article has been cited by other articles:


Home page
BloodHome page
B. Jahrsdorfer and G. J. Weiner
Short telomeres in B-CLL: the chicken or the egg?
Blood, June 15, 2008; 111(12): 5756 - 5756.
[Full Text] [PDF]


Home page
BloodHome page
G. Roos, R. Rosenquist, and S. Stilgenbauer
Response: Or both?
Blood, June 15, 2008; 111(12): 5756 - 5757.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
blood-2007-05-092759v1
111/4/2246    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Roos, G.
Right arrow Articles by Stilgenbauer, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Roos, G.
Right arrow Articles by Stilgenbauer, S.
Related Collections
Right arrow Neoplasia
Right arrowRelated Articles in Blood Online
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2008 by American Society of Hematology         Online ISSN: 1528-0020