Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 15 February 2008, Vol. 111, No. 4, pp. 2488-2489.

This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tam, W.
Right arrow Articles by Nie, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tam, W.
Right arrow Articles by Nie, K.
Related Collections
Right arrowRelated Articles in Blood Online
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

CORRESPONDENCE

Significance of PRDM1β expression as a prognostic marker in diffuse large B-cell lymphomas

To the editor:

PRDM1β is a functionally impaired isoform of PRDM1,1 the master regulator of plasma cell differentiation.2 The paper by Liu et al3 suggested that PRDM1β expression correlates with chemotherapy resistance in patients with the non–germinal center B-cell (GCB)–type diffuse large B-cell lymphomas (DLBCL), which can be overcome by rituximab through down-regulation of PRDM1β. However, contrary to what is suggested by Liu et al, the use of PRDM1β mRNA as a prognostic marker in DLBCL may not have a biologic basis because of the very low abundance of the PRDM1β protein.

Quantitative analysis of PRDM1{alpha} and PRDM1β transcripts by real-time PCR performed on a panel of DLBCL and Burkitt lymphoma (BL) cell lines (Figure 1A,B) showed that with the exception of OCI-Ly3, PRDM1{alpha} and PRDM1β mRNA levels are generally low, ranging from less than 1% to approximately 15% and 0% to approximately 3.0% of their respective levels in U266 myeloma cells.


Figure 1
View larger version (41K):
[in this window]
[in a new window]

 
Figure 1. Low levels of PRDM1β expression in B lymphoma cell lines. (A,B) PRDM1{alpha} and PRDM1β mRNA in DLBCL cell lines (OCI-Ly1, OCI-Ly2, OCI-Ly3, OCI-Ly4, OCI-Ly7, OCI-Ly8, OCI-Ly18 and SUDHL-6) and Burkitt lymphoma cell lines (Daudi and Namalwa) were quantified by Taqman reverse-transcriptase-polymerase chain reaction, normalized with beta-glucuronidase, and expressed as a percentage relative to U266. For PRDM1{alpha} mRNA quantification: forward primer, TCCAGCACTGTGAGGTTTCA; reverse primer, TCAAACTCAGCCTCTGTCCA; probe, ATGGACATGGAGGATGCGGATATG. For PRDM1β mRNA quantification: forward primer, CCCGAACATGAAAAGACGAT; reverse primer, ATAGCGCATCCAGTTGCTTT; probe, TCCAGAGGGGAGCTTCACCACTTC. In OCI-Ly3, PRDM1{alpha} mRNA is not detectable by the primers shown above because of a chromosomal inversion breakpoint at intron 2 of the PRDM1 gene. Error bars indicate SE. (C) Western blotting of total protein extracts using the ROS monoclonal anti-PRDM1 antibody. The positions for PRDM1{alpha} and PRDM1β are indicated. Asterisk marks the nonspecific band. Ponceau S staining of the membrane is shown for protein loading control. (D) Examples of immunoperoxidase staining on paraffin tissue sections for PRDM1 in U266 cells (i) and representative DLBCL cases (ii-iv). U266 cells show uniform strong staining, while all or most of the tumor cells in DLBCL are negative for or weakly express PRDM1. A few scattered PRDM1+ cells serve as internal controls for the DLBCL cases. The DLBCL cases shown have the immunohistochemical profile of non-GCB-type DLBCL. Micrographs were acquired with a Nikon Microphot SA microscope (Nikon Instruments, Melville, NY) and a SPOT Insight Color Mosaic QE 4.2 camera and image acquisition software system (Diagnostic Instruments, Sterling Heights, MI).

 
Western blots using the monoclonal ROS anti-PRDM1 antibody4 demonstrated that, despite the relatively high levels of PRDM1β mRNA in U266, PRDM1β is only weakly expressed, suggesting that it is not translated efficiently. PRDM1β in the other cell lines is virtually undetectable (Figure 1C), in agreement with their relative transcript levels, and in the case of OCI-Ly3, consistent with the presence of gene alterations that abrogate the synthesis of both full-length PRDM1{alpha} and PRDM1β.5,6 Liu et al have found more readily detectable levels of PRDM1β expression in B lymphoma cell lines. We believe the discrepancy is mainly due to differences in identification and interpretation of the PRDM1β signals in Western blots.

The band indicated as PRDM1β by Liu et al (Figures 2C,D and 3C3) may be nonspecific because (1) it has a different size in U266;(2) its intensities in Daudi and Namalwa relative to U266 correlate poorly with PRDM1β transcript levels as determined by our qRT-PCR assays3; and (3) the intensity of this band relative to PRDM1{alpha} in Namalwa is inconsistent between assays. Nonspecific bands can be detected by anti-PRDM1 antibodies, especially when total cell extracts are used. Our Western blots identified such a band below PRDM1{alpha} that is detectable in all cell lines (Figure 1C), including OCI-Ly3 (see above).

PRDM1β mRNA expression in primary DLBCL cases was also relatively low, averaging 16.4% (± 2.2%, mean ± SE) that of U266. In addition, regardless of the levels of PRDM1β mRNA, PRDM1 expression in DLBCL tends to be absent or very weak in most of the lymphoma cells (Figure 1D). Thus, PRDM1β may not be present in DLBCL cells in a quantity high enough to have a biologically significant effect on chemotherapy resistance. In addition, because of the likelihood of a misinterpretation of the PRDM1β signal (see above), the data on the down-regulation of PRDM1β by rituximab or NF-{kappa}B inhibitor becomes questionable. Nevertheless, PRDM1β mRNA may serve as a prognostic marker, possibly as a reflection of some signaling pathways. Alternatively, PRDM1β expression may simply be a surrogate marker for PRDM1{alpha} expression. The authors have stated that there is no correlation between PRDM1{alpha} expression and survival in non-GCB DLBCL; however, PRDM1{alpha} expression was assessed in an all-or-none fashion and not in a continuous quantitative manner. At this moment, the value and significance of PRDM1β expression, if any, as a prognostic marker in DLBCL needs to be interpreted with caution and requires further investigation.

Authorship

Conflict-of-interest disclosure: The authors declare no competing financial interests.

Correspondence: Wayne Tam, MD, PhD, Department of Pathology and Laboratory Medicine, Weill Medical College of Cornell University, Starr 711A, 525 East 68th Street, New York, NY 10021; e-mail: wtam{at}med.cornell.edu.

Wayne Tam, Mario Gomez, and Kui Nie

References

  1. Györy I, Fejer G, Ghosh N, Seto E, Wright KL. Identification of a functionally impaired positive regulatory domain I binding factor 1 transcription repressor in myeloma cell lines. J Immunol 2003; 170:3125–3133.[Abstract/Free Full Text]

  2. Kallies A and Nutt SL. Terminal differentiation of lymphocytes depends on Blimp-1. Curr Opin Immunol 2007; 19:156–162.[CrossRef][Medline] [Order article via Infotrieve]

  3. Liu YY, Leboeuf C, Shi JY, et al. Rituximab plus CHOP (R-CHOP) overcomes PRDM1-associated resistance to chemotherapy in patients with diffuse large B-cell lymphoma. Blood 2007; 110:339–344.[Abstract/Free Full Text]

  4. Garcia JF, Roncador G, Sanz AI, et al. PRDM1/BLIMP-1 expression in multiple B and T-cell lymphoma. Haematologica 2006; 91:467–474.[Abstract/Free Full Text]

  5. Pasqualucci L, Compagno M, Houldsworth J, et al. Inactivation of the PRDM1/BLIMP1 gene in diffuse large B cell lymphoma. J Exp Med 2006; 203:311–317.[Abstract/Free Full Text]

  6. Tam W, Gomez M, Chadburn A, Lee JW, Chan WC, Knowles DM. Mutational analysis of PRDM1 indicates a tumor-suppressor role in diffuse large B-cell lymphomas. Blood 2006; 107:4090–4100.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?

Related Articles in Blood Online:

Response: Multiple role of PRDM1β involvement in diffuse large B-cell lymphoma
Wei-Li Zhao, Anne Janin, and Sai-Juan Chen
Blood 2008 111: 2489-2490. [Full Text] [PDF]

A set of genes that regulate cell proliferation predicts treatment outcome in childhood acute lymphoblastic leukemia
Christian Flotho, Elaine Coustan-Smith, Deqing Pei, Cheng Cheng, Guangchun Song, Ching-Hon Pui, James R. Downing, and Dario Campana
Blood 2007 110: 1271-1277. [Abstract] [Full Text] [PDF]




This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tam, W.
Right arrow Articles by Nie, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tam, W.
Right arrow Articles by Nie, K.
Related Collections
Right arrowRelated Articles in Blood Online
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2008 by American Society of Hematology         Online ISSN: 1528-0020