|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, 4 June 2009, Vol. 113, No. 23, pp. 5776-5782. Prepublished online as a Blood First Edition Paper on March 30, 2009; DOI 10.1182/blood-2008-12-193607.
HEMATOPOIESIS AND STEM CELLS A genetic screen in zebrafish defines a hierarchical network of pathways required for hematopoietic stem cell emergence1 Stem Cell Program and Division of Hematology/Oncology, Children's Hospital and Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA; 2 Cardiovascular Research Center, Massachusetts General Hospital, Harvard Medical School, Charlestown; and 3 Center for Cancer Research, Massachusetts Institute of Technology, Cambridge
Defining the genetic pathways essential for hematopoietic stem cell (HSC) development remains a fundamental goal impacting stem cell biology and regenerative medicine. To genetically dissect HSC emergence in the aorta-gonad-mesonephros (AGM) region, we screened a collection of insertional zebrafish mutant lines for expression of the HSC marker, c-myb. Nine essential genes were identified, which were subsequently binned into categories representing their proximity to HSC induction. Using overexpression and loss-of-function studies in zebrafish, we ordered these signaling pathways with respect to each other and to the Vegf, Notch, and Runx programs. Overexpression of vegf and notch is sufficient to induce HSCs in the tbx16 mutant, despite a lack of axial vascular organization. Although embryos deficient for artery specification, such as the phospholipase C gamma-1 (plc  1) mutant, fail to specify HSCs, overexpression of notch or runx1 can rescue their hematopoietic defect. The most proximal HSC mutants, such as hdac1, were found to have no defect in vessel or artery formation. Further analysis demonstrated that hdac1 acts downstream of Notch signaling but upstream or in parallel to runx1 to promote AGM hematopoiesis. Together, our results establish a hierarchy of signaling programs required and sufficient for HSC emergence in the AGM.
Specification of definitive hematopoietic stem cells (HSCs) capable of generating the blood cell lineages is a vertebrate-specific process that occurs in the aorta-gonad-mesonephros (AGM) region of the developing embryo.1 In the mouse, HSCs are located near the ventral endothelium of the dorsal aorta on embryonic day (E) 10, approximately the same time that HSC activity is present in the AGM region.2–4 The proto-oncogene c-myb and the transcription factor runx1 are both excellent markers of these emerging HSCs and are essential for mammalian HSC development.5 Runx1 is thought to operate very early in HSC specification as the mouse knockout lacks intraaortic hematopoietic clusters.4 Based on analysis of a point mutant, c-Myb is thought to act in concert with p300 to regulate the proliferation and differentiation of HSCs.6 Similarly, zebrafish have an AGM-like region in the ventral wall of the dorsal aorta also marked by c-myb and runx1 expression.5,7–11 Lineage tracing experiments have shown cells exiting this region and ultimately seeding the kidney and thymus, the sites of definitive hematopoiesis in the zebrafish.12–14 Consistent with the mouse knockout data, morpholino knockdown of runx1 translation in zebrafish results in the loss of c-myb cells in the aortic region as well as a loss of definitive marker expression in the thymus.8
Although many studies have focused on the molecular events important for HSC emergence from the AGM, very little is understood about the signals essential for specifying these cells.15 Some progress has been made through the analysis of several zebrafish mutants. In zebrafish, definitive HSCs are located between and in the axial vasculature,14 which is developmentally derived from intermediate mesoderm. Mutants with defects in vascular formation and patterning show deficiencies in HSC specification. For example, the cloche (clo) mutant lacks endothelium and thus a vasculature, has no AGM HSCs and does not undergo definitive hematopoiesis.11 Loss of vasculature organization, such as that in the spadetail (spt) mutant harboring a mutation in the tbx16 locus, also impacts formation of c-myb–expressing HSCs.11 Another zebrafish mutant, phospholipase C gamma-1 (plc
Mutants have been isolated that show defects in definitive hematopoiesis; however, where these genes lie in proximity to HSC specification remains unclear. Work on both mouse and zebrafish notch pathway mutants have demonstrated a Notch signaling requirement for AGM HSC specification.8,9,16,17 The absence of HSCs in these mutants may be an indirect result of defects in arterial specification. Whereas some studies suggest notch signaling is required for establishing proper artery identity,18–20 experiments analyzing the effect of overexpression of an activated form of notch (NICD) demonstrate that these 2 pathways can be uncoupled. In these studies, activation of NICD in zebrafish can expand c-myb+ and runx1+ progenitors in the vein independently of arterial marker expansion.8 Moreover, runx1 overexpression can rescue AGM HSCs in the mindbomb mutant, which is defective for an E3 ubiquitin ligase essential for Notch signaling.21 These conclusions were confirmed in the notch1 knockout mouse, in which overexpression of runx1 rescued AGM cluster formation.22 Furthermore, Gata-2 in AGM-derived HSCs is regulated by RBPj
Herein, we performed a screen on a collection of insertional mutant zebrafish lines to identify novel pathways essential for AGM HSC formation. From this screen, we were able to establish a hierarchy of programs required for HSC emergence, describe distinct steps essential for HSC induction, and present new mutants in AGM hematopoiesis. We find that overexpression of vegf, notch, or runx1 can rescue HSC induction in tbx16, a class of the HSC mutants lacking vascular organization. Activated notch and runx1 rescues HSCs in mutants lacking plc
Zebrafish maintenance, lines, and insertional shelf screen Embryos and adult fish were raised and maintained under standard laboratory conditions. Ethical approval was obtained from the Institutional Animal Care and Use Committees of Children's Hospital at Harvard Medical School. We used the following lines: insertional mutant collection for screening24,25 (Table S1Table S1, available on the Blood website; see the Supplemental Materials link at the top of the online article) and Tg(hsp70:gal4); Tg(uas:notch1a-intra).26 Heterozygous pairs from the mutant lines were crossed and their progeny blindly screened by in situ hybridization. After in situ hybridization, only a subset of the lines could be critically evaluated for HSC defects as a portion exhibited a bloodless (bls)–like phenotype (Excel spreadsheet for lines unable to be evaluated), suggesting the presence of a second mutation in the background.27 To exclude contamination by this second mutation, we performed an exhaustive genotyping analysis after the initial in situ hybridization. Stained embryos were arrayed in a 96-well plate based on c-myb expression and individually genotyped for the viral insertion to confirm proper segregation of the genotype (wt, heterozygote, or mutant) with the phenotype (normal or loss of c-myb expression). Lines with unclear genotype and/or phenotype analysis were unable to be evaluated and were discarded from our screen numbers. Expression analyses of HSC markers were repeated multiple times on the mutants identified by the screen and always verified by genotyping (n > 50 on at least 3 sets of clutches from different heterozygous matings). Genotyping conditions and primer sequences for all 9 lines are available on request. In situ hybridization, morpholinos, and mRNAs
Whole-mount in situ hybridization was performed as described.28 Digoxigenin-labeled antisense RNA probes were synthesized using a DIG RNA Labeling Kit (SP6/T7; Roche Diagnostics, Indianapolis, IN). Antisense morpholinos were synthesized as follows: tbx16 (www.openbiosystems.com; 5'AAGACAAGTACTCACCTCTGATAGC3'), targets the exon 1 donor spicing site; plc Embryo heat-shock experiments Tg(hsp70:gal4) adults were mated to Tg(uas:nicd) fish and their embryos harvested. For the epistasis experiments, the resulting clutches were injected with the gene-specific morpholino between the 1- to 2-cell stage. Between the 6- and 12-somite stage, embryos were collected in 50-mL BD Biosciences Discovery Labware tubes (Bedford, MA) containing approximately 5 mL of E3 and submerged in a 39°C water bath for 30 minutes. Subsequently, embryos were placed in Petri dishes, allowed to develop until 38 to 40 hpf, collected in 4% paraformaldehyde, and processed by in situ hybridization. Individual embryos were photographed in glycerol using a Nikon Coolpix camera (Nikon, Tokyo, Japan) mounted on a Nikon E600 compound microscope. After photography, embryos were individually arrayed and genotyped.
A forward genetic screen identifies genes crucial for AGM HSC specification To uncover essential genes for HSC induction during embryogenesis, we screened 194 independent insertional mutant zebrafish lines in which the defective genes have been isolated24,25 ("Methods" and Document S1Document S1: a complete list of genes screened). Heterozygous adults were mated, their embryos collected, and processed by in situ hybridization for alterations in c-myb expression (Figure 1A). Although most mutations had no effect on HSC induction (n = 185), 9 loci were found to be essential for AGM hematopoiesis (Figure 1B). One insertion identified was in the mind bomb (mib) locus,8 which encodes an E3 ligase essential for Notch signaling.21 As the HSC phenotype of an ENU-induced mib allele was previously characterized,8 we did not include insertional allele data as they were similar.
Mutants from each line showed loss of AGM c-myb and runx1 expression compared with wild-type siblings (Figures 1C, S1S1). Differentiated thymic T cells that express rag1 and are exclusively derived from definitive HSCs were also absent from each mutant examined at 4 days after fertilization (Figures 1C, S1S1). Thus, our screen defined a set of genes required for specification of the definitive HSC fate, and analysis of these mutants will provide a better understanding of stem cell emergence during vertebrate embryogenesis. Mutants define critical stages of HSC emergence
Several early embryonic events, including endothelial cell fate specification, vasculogenesis, and the establishment of artery identity, must occur for the mesoderm to generate definitive HSCs. To assess the stage at which each mutant is defective, we performed in situ hybridization on embryos generated by heterozygous matings to examine markers of vessel formation (flk1; Figure 2A) and artery identity (efrinb2a; Figure 2B). One of the hallmarks of proper arterial fate specification is the presence of branching intersomitic vessels from the dorsal aorta.29 Artery identity is disrupted in tbx16–/– animals as indicated by the loss of intersomitic flk1-expressing vessels and efrinb2a transcripts (Figure 2G,H). Similar to the previously described spadetail/tbx16b104 deficiency,30 tbx16 mutants induce endothelial cells, as shown by flk1 expression, but fail to organize them into a proper vasculature (Figure 2G), positioning this locus most distal to HSC specification (class I; Figure 2I). plc
Vegf acts downstream of tbx16-directed specification of paraxial mesoderm
Recent coexpression9 and fate-mapping31 studies have highlighted the shared ancestry between the endothelial and hematopoietic lineages. The Vegf signaling pathway, which is mediated by plc
Notch acts downstream of tbx16 and vegf signaling for HSC specification
As previous reports established the Notch-Runx pathway as critical and sufficient for HSC specification during embryogenesis, we next focused on one mutant from each class and analyzed its genetic relationship relative to Notch and Runx in HSC development. tbx16hi3714 represents the class I mutants and generates a weaker morphologic phenotype than the spadetail/tbx16b104 deficiency.30 Both genetic lines, however, maintain trunk endothelial cell induction,32 display a disorganized vasculature,11 and show loss of definitive HSCs.10,11 plc
To position these genes in a genetic hierarchy relative to each other and the Notch-Runx pathway, we performed classic epistasis experiments. Heat induction of the constitutively active zebrafish Notch1 receptor intracellular domain (NICD) via a Gal4/UAS transgenic system26 expands HSCs in the AGM as shown by expansion of c-myb and runx1 transcripts (Figure 4A,B).8 To knock down tbx16 or plc
Hdac1 regulates HSC formation after artery specification
hdac1, which encodes an enzyme responsible for catalyzing the removal of acetyl groups from core histones and transcription factors,34 represents the class III mutants. Biochemical evidence suggests that HDAC1 normally functions as a transcriptional repressor and attenuates Notch signaling by sequestering a Notch pathway activator, RBPj To investigate potential interactions, we crossed the hdac1 mutation onto the Tg(hsp70:gal4);Tg(uas:NICD) background and analyzed HSC specification in their progeny after heat induction. Both control hdac1–/– siblings (Figure 5A,B) and Tg(hsp70:gal4);Tg(uas:NICD);hdac1–/– animals (Figure 5C,D) showed loss of c-myb and runx1 expression, suggesting that hdac1 is required downstream of Notch signaling for HSC emergence.
Runx1 function is required for Notch to induce and expand HSC numbers and runx1 overexpression can rescue HSCs in the absence of Notch signaling.8,22 As runx1 transcripts are lost in hdac1 mutants, we tested whether synthetic runx1 RNA could rescue the hdac1–/– HSC phenotype. Injection of runx1 RNA into 1- to 4-cell wild-type embryos expanded c-myb expression throughout the aortic wall and vein (Figure 5E,F). Uninjected hdac1–/– animals failed to specify HSCs (Figure 5G); however, overexpression of runx1 in the mutant background partially rescued c-myb transcripts in the AGM (Figure 5H). This reemergence of myb+ cells indicates that hdac1 acts genetically upsteam of or in parallel to runx1 in HSC induction. Our work demonstrates that hdac1, a novel HSC regulator, acts mostly proximally to HSC induction.
HSC emergence in the vertebrate AGM may require genes that are more broadly critical for stem cell specification and self-renewal. Our studies uncovered a new set of pathways required for HSC formation during vertebrate development. In total, our screen identified 9 genes required for AGM HSCs in zebrafish. By focusing on 3 of these genes, we established distinct stages required for HSC formation and developed a genetic paradigm by which HSCs are induced during development. The remaining genes await further study to determine their specific role in HSC formation. Whereas 3 loci involved in ribosomal subunit biogenesis were identified in our screen (rps29, wdr43-like, possible homolog to yeast ribosome biogenesis factor UTP5, and nop-1438), 26 other ribosomal subunit/biogenesis factors (supplemental data) were excluded, strongly arguing that only certain subunits are required for definitive hematopoiesis. Lending credence to this hypothesis, mutations in rps1939 and other specific ribosomal proteins40 lead to Diamond-Blackfan anemia, and knockdown of rps14 has been associated with the erythroid differentiation defect found in 5q- syndrome.41 tbx16/spadetail represents the most distal pathway to AGM hematopoiesis as it has been shown to directly regulate paraxial mesoderm convergence during early gastrulation.30 Loss of proper convergence movements results in a broadened fli1-expressing endothelial progenitor domain during early somitogenesis32 and subsequent disorganization of the trunk vasculature.11,30 Whether tbx16 exerts a cell-autonomous and/or nonautonomous effect on definitive HSC specification is not known. During primitive hematopoiesis, tbx16 plays both an autonomous and nonautonomous role in specifying the red blood cell lineage within intermediate mesoderm.32 During embryogenesis, mesoderm from the AGM becomes regionalized into specific fates. Many studies show that a "hemogenic endothelial cell" acts as a bipotential precursor to the HSC and vascular lineages. Other studies show that a subaortic mesenchymal cell population independently migrates though endothelial cells to become hematopoietic.13,42 We hypothesize that tbx16 plays an indirect role in HSC induction by providing a proper vascular environment in which definitive hematopoiesis can initiate. Our genetic studies demonstrate that loss of HSCs in tbx16 mutants can be rescued by Vegf signaling. Although the vegf-plcg1 pathway has been shown to regulate aortic identity,19,29 vegf has also been identified as up-regulated in human AGM HSC intraaortic clusters.43 It is unclear whether Vegf signaling is only required for establishment of arterial fate, which in turn is necessary for AGM HSCs formation, or whether it may have a more direct function in specifying AGM HSCs. Mice deficient in the Vegf receptor, flk-1, die very early during embryogenesis from severe vascular and hematopoietic defects.44 Accordingly, analysis of chimeric mice revealed that flk1–/– cells fail to contribute to primitive yolk sac, definitive fetal liver, or adult hematopoiesis.44 Although this finding initially suggested a direct role for Vegf signaling in hematopoiesis, further analysis found that flk1–/– ES cells were capable of differentiating into primitive red blood cells in vitro. Furthermore, as the flk1–/– cells were also found to be absent from the vasculature in chimeras, it is not possible to distinguish whether the definitive hematopoietic defect is primary (cell-autonomous) or secondary to an endothelial deficiency.44 Similarly, in zebrafish loss of the vegf-plcg1 pathway has no effect on primitive hematopoiesis but is required for artery identity and definitive hematopoiesis.9,19,29 Because overexpression of Vegf has also been found to expand arterial fates29 and c-myb expression (shown here) in wild-type embryos, it appears that the function of Vegf in artery fate decisions is linked to AGM HSC emergence. Unlike Vegf signaling, the role of Notch signaling in artery identity can be uncoupled from AGM HSC formation. Overexpression of an activated form of Notch expands AGM HSCs, but not arterial marker expression8 and loss of the Notch ligand, Jagged1, results in impaired AGM hematopoiesis without concomitant defects in aortic identity.23 Our work has shown that Notch signaling can rescue AGM HSCs in the absence of vegf-plcg1 signaling, demonstrating that Notch signaling can bypass the need for the Vegf-plcg1 pathway in AGM hematopoiesis. A novel HSC regulator, hdac1, is required for runx1 expression downstream of the Notch pathway. Previous studies have shown that HDAC factors biochemically interact with Runx proteins to actively repress Runx-target gene transcription.45,46 Specifically, Runx1 was found to strongly associate with HDAC1 via immunoprecipitation,47 suggesting that Runx factors recruit distinct HDACs to mediate repression. Based on these studies, loss of HDAC1 would seemingly result in an increase in Runx1-target gene activation and stem cell emergence, yet our results suggest the opposite. We find that runx1 expression fails to initiate in the hdac1 mutant and HSCs do not form. Moreover, injection of runx1 RNA rescues some c-myb+ cells in the AGM of hdac1 mutants but does not fully suppress the HSC deficiency. There are several plausible mechanisms that can be envisioned. One possibility is that HDAC1 represses transcription of a factor that normally silences runx1 transcription. In this case, loss of hdac1 would lead to increased levels of a runx1 transcriptional repressor. Alternatively, HDACs have been found to directly regulate whether a transcription factor will act to promote or repress target gene activity by altering acetylation.48 Because HDAC1 and Runx1 proteins have been found to physically interact,45,46 it is plausible that HDAC1 is required to convert Runx1 from a repressor to an activator (or vice versa). In this case, loss of hdac1 would lead to constitutive Runx1 repressor activity such that no target genes are transcribed. Although future biochemical studies would be required to address the precise HDAC1/RUNX1 interplay within HSCs, our genetic results show that HDAC1 activity is extremely proximal to and required for HSC emergence. There has been considerable effort aimed at understanding the developmental origins of the AGM cells using many vertebrate model organisms. Our work using forward genetic screening in zebrafish demonstrates that 2 processes, the proper formation of the vasculature, which is dependent on the tbx16 pathway, as well as the proper patterning and specification of the hemogenic endothelium, which requires the VEGF/Notch programs, are absolutely essential for the emergence of AGM HSCs. The output of these pathways is the induction of runx1 expression, which is critical for HSC formation. Our work now places hdac1 between these 2 pathways and runx1 induction and identifies it as an essential regulator of HSC formation.
Contribution: C.E.B., J.L.G., A.C.H.S., M.D.K., E.A.M., E.J.P., and A.H.A. performed the screen; C.E.B., J.L.G., A.C.H.S., and T.J.C. performed overexpression studies; C.E.B., J.L.G., and A.C.H.S. performed the mutant analyses; and C.E.B., J.L.G., and L.I.Z. conceived of experiments, analyzed experiments, and wrote the manuscript. Conflict-of-interest disclosure: The authors declare no competing financial interests. Correspondence: Leonard I. Zon, Stem Cell Program and Division of Hematology/Oncology, Children's Hospital and Dana-Farber Cancer Institute, 320 Longwood Ave, Enders Bldg Rm 761, Harvard Medical School, Boston, MA 02115; e-mail: zon{at}enders.tch.harvard.edu.
The authors thank Xiaoying Bai and Trista North for critical reading of the manuscript and C. Belair, B. Barut, and A. McCollum for fish care and laboratory management. This work was supported by the National Heart, Lung, and Blood Institute (grant 5 R01 HL48801). C.E.B. is supported by the National Institute of Diabetes and Digestive and Kidney Diseases (Research Career Award 1 K01 DK067179). A.H.A. is supported by a National Institutes of Health grant from the National Center for Research Resources (2 R01 RR012589). L.I.Z. is supported by Howard Hughes Medical Institute.
Submitted December 8, 2008; accepted March 19, 2009.
Prepublished online as Blood First Edition Paper, March 30, 2009
DOI: 10.1182/blood-2008-12-193607
The online version of this article contains a data supplement.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 USC section 1734.
  CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2009 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
-dependent Notch function.
in subpanels i and ii. (Column 3) Dorsal view, anterior up; 4 dpf; bilateral rag1 expression in thymi is indicated by 
