|
|
Blood, Vol. 107, Issue 9, 3531-3536, May 1, 2006
Hepatocyte growth factor is a lymphangiogenic factor with an indirect mechanism of action
Blood Cao et al.
107: 3531
Supplemental materials for: Cao et al
Supplementary Methods Real-time PCR and reverse transcriptase PCR (RT-PCR)
Mouse brain endothelial cells, 3T3 fibroblasts and vascular smooth muscle cells stimulated with 100 ng/ml HGF overnight and non-stimulated control cells (R&D Systems Inc. Minneapolis) were used for real time PCR analysis. Total RNA was isolated with Rneasy Mini Kit (Qiagen, Valencia, CA), and cDNA was sythesized using the MMLV reverse transciptase (Invitrogen, Carlsbad, CA) according to protocols of the kits. The sequences of primers were as follows: VEGF-C primers; forward: 5´-CAGCTGCGGAAAGGCG-3´ and reverse: TTTACACTGTCCCCTGTCCTGG; VEGF-D primers; forward: 5-AAATCGCGCACTCTGAGGA-3´, reverse: 5´-TGGCAAGACTTTTGAGCTTCAA-3´, and PDGF-B primers; forward: 5´-AAGCTCGGGTGACCATTCG-3´, reverse: 5´-ACTTTCGGTGCTTGCCTTTG-3´. The sequences of FAM probes are as follows: VEGF-C; FAM-5´-CTGGCAGCAGCCCACCCTCAAT-3´, VEGF-D; FAM-5´-TGGAAGCTGTGGCGATGCCG-3´, and PDGF-B FAM-5´-TGAGAATCCGCCGGCCCC-3´. As an internal loading control, 18S ribosomal RNA reagents were used. Reactions were performed using TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, CA) in multiplex using an ABI 7700 Prism Sequence Detection System (Perkin Elmer). The following amplification cycles were used: incubation (95 °C, 10 min), 50 cycles of denaturation (95°C, 15 s), and annealing/extension (60°C, 60 s). Relative standard curves were prepared by serial dilution of positive RNA. Immunohistochemical analysis of tumor tissues
Mammary tissue and tumors were harvested from mice shortly after scarification. For immunostaining, both mammary and tumor tissues were fixed overnight with 3% PFA and processed by a standard protocol for paraffin embedding. The embedded tissue sections were deparaffinized and boiled in an antigen retrieval solution, incubated overnight with a monoclonal rat anti-mouse cytokeratin 8 (K8) antibody (Troma 1), followed by incubation for 1 h with a biotinylated secondary antibody. Positive signals were developed with Vectastain ABC and DAB reagents according to the manufacturer’s instruction. Supplementary Results HGF did not affect expression levels of VEGF-C, VEGF-D or PDGF-B in endothelial cells, vascular smooth muscle cells and 3T3 fibroblasts
To study if HGF could directly induce the expression three known lymphangiogenic factors, VEGF-C, VEGF-D and PDGF-BB, in blood vessel endothelial and vascular smooth muscle cells were isolated and treated with HGF. HGF-stimulated and non-stimulated mouse endothelial cells, vascular smooth muscle cells (VSMCs) or 3T3 fibroblasts were used for quantitatively analysis of expression of VEGF-C, VEGF-D and PDGF-BB (Figure S1). While both VSMCs and 3T3 cells expressed detectable levels of VEGF-C (Fig. S1A) and VEGF-D (Fig. S1B), endothelial cells did not express a detectable level of either factors. In contrast, endothelial cells seemed to express higher levels of PDGF-B than those of VSMCs and 3T3 fibroblasts (Fig. S1C). In all these cell lines, the levels of expression of VEGF-C, VEGF-D and PDGF-B did not change after stimulation with HGF (Fig. S1A-C). These data demonstrate that HGF does not affact the expression levels of these direct lymphangiogenic factors in these cell lines. WAP-HGF transgenic tumors
After several cycles of pregnancy female WAP-HGF mice develop mammary gland tumors, which express cytokeratin 8 (K8), also detectable in healthy mammary gland epithelium (Fig. S2A-F). In addition to promoting primary tumor growth, overexpression of HGF in mammary glands also led to pulmonary metastases evidenced by K8 positive signals (Fig. S2G-H).
Files in this Data Supplement:
- Figure S1. Quantitative analysis of expression VEGF-C, VEGF-D and PDGF-BB in HGF-treated and non-treated cells (JPG, 33.8 KB)
-
Total RNA extracted from HGF-stimulated and non-stimulated VSMC, 3T3 fibroblasts, and endothelial cells were used for detection of expression levels of VEGF-C (A), VEGF-D (B) and PDGF-B (C) using a quantitative PCR method.
- Figure S2. Overexpression of HGF in mice resultes in the formation of mammary gland tumors and pulmonary metastasis (JPG, 102 KB)
-
Female FVB/N mice overexpressing HGF under the control of a mammary specific promoter, the WAP promoter) develop mammary gland tumors after several cycles of pregnancies (A and B). Immunohistochemical staining of healthy mammary gland (C) and mammary tumors (E) with an anti-K8 antibody. A Lung metastatic tumor (pointed by an arrow) shows K-8 positive staining (G). A non-specific IgG were used to stain the same sections of C, E, and G, respectively (D, F, and H). ***p<0.001. To study if HGF could directly induce the expression three known lymphangiogenic factors, VEGF-C, VEGF-D and PDGF-BB, in blood vessel endothelial cells, mouse endothelial and vascular smooth muscle cells were isolated and treated with HGF. Real time PCR analysis showed that the expression levels of these lymphangiogenic factors were affected by HGF stimulation, suggesting that HGF did not induce the expression of these gene products in vascular endothelial and smooth muscle cells. It is worth to mention both VEGF-C and VEGF-D remain at undetectable levels in stimulated and non-stimulated endothelial cells (Figure S1). Our results indicate that HGF did not induce expression of VEGF-C, VEGF-D or PDGF-BB and most likely the indirect lymphangiogenic effect of HGF is mediated by other cell types.
|
|
