|
|
Blood, Vol. 107, Issue 9, 3546-3554, May 1, 2006
Bone marrow mononuclear cells are recruited to the sites of VEGF-induced neovascularization but are not incorporated into the newly formed vessels
Blood Zentilin et al.
107: 3546
Supplemental materials for: Zentilin et al
Files in this Data Supplement:
- Figure S1. NG immunostaining (JPG, 144 KB)
-
Immunofluorescence analysis was performed at one month after AAV-VEGF transduction.
A. Simultaneous detection of NG2 and CD31. The microvasculature present in the area of active neoangiogenesis contains cells positive for NG2 in close contact with CD31 positive endothelium. Blue: DAPI, Red: NG2, Green: CD31.
B. Simultaneous detection of NG2 and  -SMA.The NG2-positive pericytes are also visible in the wall of the small arteries, induced by VEGF stimulation. Blue: DAPI, Red: -SMA, Green: NG2.
- Figure S2. Representative profiles of flow cytometry analysis (JPG, 97 KB)
-
Mononuclear cells from peripheral blood (PBMCs) and Spleen of chimeric, bone marrow transplanted Balb/c mice were injected with AAV-LacZ or AAV-VEGF into the tibialis anterior muscle one month before analysis. Animals were then treated with Erythropoietin (EPO), as described in the text.
A. Light scatter dot plot showing the gated region (circled in red) considered for the subsequent marker analysis.
B. Representative dot plots of single immunostainings for Flk1 on the gated region shown in panel A for PBMCs obtained from AAV-LacZ and AAV-VEGF mice, either treated or not treated with EPO.
C. Representative dot plots of double immunostainings for Flk1 and CD34 on the gated region shown in panel A for PBMCs and Spleen mononuclear cells of AAV-LacZ and AAV-VEGF mice, either treated or not treated with EPO.
- Figure S3. Quantitative analysis of chemokines expressed by AAV-VEGF-injected muscles by Real-time PCR quantification (JPG, 78.2 KB)
-
Male BALB/C mice were injected in the right tibialis anterior muscle with 5 × 1011AAV-VEGF165 particles, while the controlateral muscle was injected with the same number of particles of AAV-LacZ. After 14 or 28 days, animals were sacrificed and total RNA was extracted from the tibialis anterior muscles, reverse-transcribed and analyzed by Real Time PCR performed with the TaqMan technique using the Assay-by-Designed methodology (Applied Biosystems). Samples were analyzed for the expression of chemokines and chemokine receptors, using GAPDH and 18S as internal controls for RNA input.
The sequence of the probes used in these assays are the following:
JE-MCP1 CCL2 GTTGGCTCAGCCAGATGCAGTTAAC
MIP1BETA CCL TCAGCACCAATGGGCTCTTGACCC
MIG-CXCL9 AACTGAAATCATTGCTACACTGAAG
RANTEC-CCL5 CTGCTTTGCCTACCTCTC
CCR1 CAGAATTTGACTATGGGGACTCCAC
CCR2 CCAGGACAGTTACCTTTG
CCR3 TGGAGAGTTTTCCTGCAGTCCTCGC
CCR5 ACAGCCCTGTGCCTCT
The results obtained are expressed as mean ± s.d. of the fold enrichment in each animal, evaluated as the ratio of the mRNA level in the AAV-VEGF treated leg versus the untreated leg (n=3 per group).
The results show that the expression of MIP1 , RANTES, MIG chemokines, as well as of CCR1, CCR2, CCR5 chemokine receptors are remarkably increased in the VEGF-treated animals.
|
|
