Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts

Blood, Vol. 108, Issue 1, 228-237, July 1, 2006
This Article
Right arrow Abstract
Right arrow Full Text
Services
Right arrow Email this article to a friend
Right arrow Alert me to new issues of the journal
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via CrossRef

CD25 and indoleamine 2,3-dioxygenase are up-regulated by prostaglandin E2 and expressed by tumor-associated dendritic cells in vivo: additional mechanisms of T-cell inhibition
Blood von Bergwelt-Baildon et al. 108: 228

Supplemental materials for: von Bergwelt-Baildon et al

Supplemental information on methods

Peripheral blood samples
Blood samples were collected from healthy blood donors at the Center for Transfusion Medicine (University of Cologne) after informed written consent was obtained. All blood samples in form of standard buffy coat preparations were taken between 8 and 11 am and processed immediately.

In vitro generation of monocyte-derived dendritic cells
PBMC were isolated from buffy coats by Ficoll-Paque (Amersham Pharmacia Biotech, Uppsala, Sweden) density-gradient centrifugation. Subsequently, the monocytes were obtained using CD14 MicroBeads (Miltenyi Biotec, Bergisch Gladbach, Germany) by high-gradient magnetic cell sorting on LS Separation Columns (Miltenyi Biotec) according to the manufacturer’s protocols. Monocyte-derived DC (mo-DC) were generated according to standard protocols (Sallusto, 1994 #193). Briefly, purified CD14+ monocytes (purity grade > 95 %, as revealed by flow cytometry) were cultured at 2 × 106 cells/ml in serum-free medium (CellGro® DC Medium, CellGenix, Freiburg, Germany) supplemented with 2 mM GlutaMAX I (GibcoBRL, Life Technologies, Eggenstein, Germany), 800 U/ml GM-CSF (Leucomax 300, Novartis Pharma GmbH, Germany), and 500 U/ml IL-4 (CellGenix) in 6 well Nunclon™ culture plates (Nunc, Life Technologies, Karlsruhe, Germany), further referred to as “DC medium, ” (Figure S1). On day seven immature mo-DC (imDC) were harvested, counted and transferred at 1.5 — 2 × 106 cells /ml to DC medium, 10 µg/ml anti-CD40 antibody (CD40, BD Biosciences Pharmingen, Heidelberg, Germany) and 20 ng/ml TNF (Sigma Aldrich, Taufkirchen, Germany) for maturation. For some experiments, monocyte-derived DC were matured in the presence of 20 ng/ml TNF, or in a cytokine cocktail, containing 20 ng/ml TNF, 1000 U/ml IL6 and 10 ng/ml IL1 (the latter two from R&D Systems). Where indicated, 1 µg/ml of prostaglandin E2 (PGE2, Sigma Aldrich) was added to the cultures. After 3 additional days of culture, mature mo-DC (maDC) were harvested and used for RNA preparation, flow cytometric analysis, or functional assays. To obtain cell supernatants free of exogenous PGE2 added during culture, DC were harvested at day 10, washed extensively (“washout”) and incubated at 2 × 106 / ml in DC medium for an additional 24 hours. For some experiments, 1-methyl-D,L-tryptophan (1-MT, Sigma, range 0.1 to 1 mM) or recombinant IL-2 (Chiron, Emeryville, CA, 20 IU/ml) were added. Resulting supernatants were used for functional assays.

Enrichment of BDCA-1+ myeloid dendritic cells from peripheral blood
Positive sorting of circulating BDCA-1+ myeloid DC was performed with CD1c (BDCA-1) Dendritic Cell Isolation Kit according to the manufacturer’s protocols (Miltenyi Biotec). Briefly, monocyte depleted PBMC were incubated with CD19 MicroBeads and CD1c (Anti-BDCA-1)-biotin antibody, CD19+ B cells were then depleted resulting in a cell population significantly enriched for BDCA-1+ CD19 cells. Only cell preparations with a purity of > 98% BDCA-1+ cells were further processed. After sorting, BDCA-1+ myeloid DC were incubated overnight at 1 × 106 cells/ml in CellGro medium with the addition of TNF, CD40 and/or PGE2 as indicated.

Assessment of DC immunophenotype and morphology
The phenotype of the in vitro generated monocyte-derived DC and the BDCA-1+ myeloid DC was examined by flow cytomety (FACSCalibur) using the following mAbs: CD83 (Immunotech, Marseille, France); CD3, CD11c, CD14, CD16, CD19, CD25, CD54, CD56, CD123, Anti-HLA-DR, (Becton Dickinson, Heidelberg, Germany); CD14, CD40, CD80, CD86 (BD Pharmingen, Heidelberg, Germany); CCR6 (R&D Systems); Anti-BDCA-1 (CD1c, Miltenyi); isotype control antibodies used included IgG1 and IgG2a, labeled with appropriate fluorochromes (Becton Dickinson). All flow cytometric data were assessed with the BD CellQuest™ 3.3 software package (BD Biosciences). Monocyte-derived DC were also photographed with magnification 40× — 60× using an inverted phase microscope Zeiss Telaval 31 (Carl Zeiss, Oberkochen, Germany) with Olympus digital camera to assess cell morphology.

RNA preparation, microarray hybridization and microarray data processing
Enriched monocytes and BDCA-1+ myeloid DC were collected immediately after separation, activated BDCA-1+ DC were gathered after 18 hrs of culture, immature monocyte-derived DC were harvested on day 7 prior to start of maturation, and matured DC on day 10, respectively. Cells were lyzed in TRIzol® reagent (Invitrogen Life Technologies, Karlsruhe, Germany) and stored at —80°C until further processing. Target preparation and array hybridization was performed as described previously (Debey, 2004 #109). Data files were further analyzed with DNA-Chip Analyzer (dCHIP 1.2®). The following filtering criteria were used for selection of differentially expressed genes: lower bound of the 90% confidence interval of the fold change > 2, absolute difference in signal intensity between group means > 100, p value ≤ 0.05 (unpaired t-test) and present call % ≥ 50.

ELISA and Cytometric Bead Array (CBA) for cytokines
Production of IL-12 (p70) by monocyte-derived DC during maturation was measured by human IL-12 Eli-Pair (Diaclone Research, Besancon Cedex, France). Measurement of soluble CD25 (sCD25) in DC supernatants was performed with sIL-2R Eli-Pair, IL-2 production was assessed by IL-2 Eli-Pair (both from Diaclone Research). The concentration of TNF and IFN in cell culture supernatants was measured using the human Th1/Th2 Cytokine kit II (BD PharMingen) according to manufacturer’s instructions. All samples were analyzed at least in duplicates.

Semi-quantitative RT-PCR
Semi-quantitative RT-PCR was performed with a Qiagen One-Step RT-PCR kit (Qiagen). The PCR products were analyzed in the linear phase of amplification. A total of 250 ng RNA was amplified using the following primers:
GAPDH forward, TGATGACATCAAGAAGGTGGTGAA;
GAPDH reverse, TCCTTGGAGGCCATGTGGGCCAT;
INDO forward, CTTCCTGGTCTCTCTATTGG;
INDO reverse, GAAGTTCCTGTGAGCTGGTG;
INDO_2 forward, GAGGAGCAGACTACAAGAAT;
INDO_2 reverse, ATTGCCTTGAATACAGTAGG;
INDO_3 forward, ATATTTGTCTGGCTGGAAAG;
INDO_3 reverse, TTTGTGGCTCTGTTACAATC.
After reverse transcription, the following thermal profile was used: 1 min 94°C, 1 min 55°C, 1 min 72°C (28 cycles) and a final elongation step at 72°C for 10 min.

Preparation of cell extracts and immunoblot analysis
DC were collected by centrifugation and washed with phosphate buffered saline (PBS), pH 7.5. After centrifugation the remaining buffer was completely removed by aspiration and the cell pellet was stored frozen at —80°C until extract preparation. Frozen cells (approximately 5—10 × 106 cells/sample) were mixed with 200—300 µl of ice-cold homogenization buffer (20 mM Tris-HCl, pH 7.5 containing 1% Triton X-100, 0.5 mM EDTA, 1 mM DTT, and freshly added protease inhibitors 1 mM PMSF, 10 µg/ml aprotinin, 5 µg/ml pepstatin A, and 25 µg/ml leupeptin). The extract was prepared by incubation for 10 min on ice to allow for membrane disruption and by additional sonication (2×5 sec on ice). This homogenate was spun at 15,000 × g for 10 min at 4°C, and the resulting supernatant was used for immunoblot analysis. Protein concentration in samples was determined with Roti-Quant reagent (Carl Roth GmbH, Karlsruhe, Germany) following the manufacturers protocol using bovine serum albumin as a standard. The identification of IDO in samples was done by separation of whole cell extracts on a 10% SDS-polyacrylamide gel followed by transfer of proteins to a PVDF membrane (Westran Clear Signal, Schleicher&Schuell BioScience GmbH, Dassel, Germany). In parallel, a duplicate gel was prepared and stained with Coomassie stain using Roti-Blue reagent (Carl Roth GmbH) to assess the quality and equal loading of extracts. The membranes were blocked for 2 hours at room temperature with 0.5 % milk powder in PBS pH 7.5/0.1% Tween 20 buffer and incubated overnight at 4°C with anti-IDO monoclonal antibody generated against the human IDO fragment (amino acids 78—184) fused to GST (MAB5412, Chemicon, Hofheim, Germany) at 1:2000 dilution or with polyclonal antibody generated against the recombinant human IDO (Serotec, Oxford, UK) at dilution 1:200 in PBS/0.1% Tween buffer containing 5% BSA. Bound antibodies on immunoblots were detected with alkaline phosphatase (AP) conjugated secondary antibodies (Sigma, Taufkirchen, Germany), which were diluted at 1:10,000 in PBS/Tween/BSA buffer and incubated with a membrane for 30 min at room temperature. Signals were developed by enhanced chemiluminescence using the AP-substrate, CDP-Star (Tropix, Bedford, MA) and the Kodak BioMax Light-1 imaging film (Sigma).

Determination of tryptophan concentration in DC supernatants
Supernatants, derived from imDC and differentially treated maDC (at day 10 of culture and 24 hrs after “washout”), respectively BDCA-1+ myeloid DC (after short-time in vitro stimulation), were collected, diluted 1:30 in doubly-distilled water and measurement of tryptophan concentration was performed by reversed-phase high-pressure liquid chromatography on a System Gold HPLC Workstation (Beckman, Munich, Germany) using a narrow-bore Ultrasphere ODS column (150 × 2 mm, Beckman), principally as previously described (Terness, 2002 #94). Aliquots of 50 µl were injected and eluted by a gradient of acetonitril in aq. trifluoroacetic acid (0.1%) from 2% to 40% (duration 10 min) and from 40% to 80% (duration 4 min) using a flow rate of 0.5 ml/min. Fluorescence was measured at 278/363 nm by online detection with the RF-10AXL fluorescence detector (Shimadzu, Duisburg, Germany). Each sample was analyzed in duplicate.

Functional assays with supernatants derived from monocyte-derived DC
To study the influence of soluble factors associated with PGE2 treated matured DC we determined primary T cell proliferation after stimulation with artificial antigen presenting cells (aAPC) in the presence of the supernatants, derived from DC matured either in the presence or absence of PGE2 24 hrs after “washout. ” CD4+ T cells were isolated by negative selection using RosetteSep® (StemCell Technologies) labeling of human cells and were routinely > 90% CD4+ and < 5% CD8+ as determined by flow cytometry. Primary human CD4+ T cells were cultured in fresh DC medium or in the supernatants derived from differentially matured DC. CD4+ T cells were stimulated with aAPC at a ratio of 1:3 (cells to beads) comprised of magnetic beads (Dynal Biotech, Lake Success, NY) coated with the following antibodies: anti-CD3 (OKT3), anti-CD28 (9.3; a kind gift of Drs. Carl June and Jim Riley, both Abramson Cancer Research Center, University of Pennsylvanis, Philadelphia) and anti-MHC I (W6/32) (Chemnitz, 2004 #173). Prior to stimulation with aAPCs CD4+ T cells were labeled with carboxy fluorescein diacetate succinimidyl ester (CFSE, Molecular Probes) according to manufacturer’s protocol. After four days of culture T cell proliferation was assessed by flow cytometry detecting the decrease in CFSE fluorescence with every cell division. In some experiments tryptophan concentration in the supernatant of PGE2 treated monocyte derived DC was adjusted to the level determined in the supernatant of corresponding maDC by adding exogenous tryptophan (Sigma). For analysis of T cell subpopulations T cells were stained with CCR7 and CD45RA mAb (BD Pharmingen) and assessed by flow cytometry.

Culture and assessment of cell proliferation and viability of CTLL-2 cells
The murine IL-2—dependent T-cell line CTLL-2 was obtained from ATCC and cultured in RPMI 1640 medium (Invitrogen, Karlsruhe, Germany) containing 0.1 mg/mL streptomycin, 100 U/mL penicillin (PAA, Linz, Austria), 10% fetal calf serum (FCS; Invitrogen), and recombinant human IL-2 (Chiron, Emeryville, CA). When used in functional assays, CTLL-2 cells were washed extensively and then cultured in supernatants derived from the indicated DC. Supernatants were diluted with CTTL-2 culture medium at a 1:1 ratio. Cell proliferation was determined by cell counting (performed by two independent investigators) and viability assessed by flow cytometry measuring propidium iodide positive cells.

Mixed lymphocyte reaction
Freshly isolated allogeneic CD4+ T cells (2 × 105 cells/well) were incubated with DC matured in the presence or absence of PGE2 at different ratios. Assays were performed either in fresh DC medium, or in supernatants of corresponding DC subsets, derived 24 hrs after “wash out.” Prior to the MLR CD4+ T cells were labeled with CFSE. After 4—6 days of culture T cell proliferation was assessed by flow cytometry.

Immunohistochemical analysis
After obtaining informed consent, 5% formalin fixated paraffin-embedded tissue samples with three different tumor entities were taken from the archive of the Institute of Pathology, University of Cologne, Cologne, Germany. Each five samples of breast cancer, colon cancer and gastric cancer were selected when an intense peritumoral inflammatory reaction was visible. For immunostaining sections (5 µm thick) were cut and deparaffinized. After pre-treatment with citrate-buffer and pressure-cooking sections were incubated with S100 (DakoCytomation, Glostrup, Denmark) or IDO (Serotec, Oxford, UK) or CD25 (Novocastra, Newcastle upon Tyne, UK) respectively (each overnight at 4°C). Primary antibodies were detected using APAAP-Komplex and Vector Red (Vector laboratories, Burlingame, CA, USA) for a red staining as well as Vector Blue for a blue staining. Paraffin-embedded human tonsils served as positive controls. For double-staining sections from the same paraffin-blocks were again pre-treated with citrate-buffer and pressure-cooking and then incubated with S100 / IDO (both overnight) or CD25 / S100 respectively. First primary antibodies were detected using APAAP-Komplex and Vector Red for a red staining. All sections were washed in TBS-buffer and put into normal swine serum for 30 min for blocking unspecific staining reactions and washed in TBS again. Second primary antibodies were detected using strepavidin-alkaline phosphatase conjugate with Vector Blue, resulting in a blue staining. Slides were then covered with glycerol gelatin. Again paraffin-embedded human tonsils served as positive controls. Diagnosis was assessed by a pathologist experienced in morphology.

Files in this Data Supplement:

  • Table S1 (JPG, 151 KB) -

  • Figure S1. Experiment design (JPG, 66.8 KB) -

    Monocyte-derived DC (mo-DC) were generated from CD14+ monocytes by culturing in a serum-free medium with GM-CSF and IL4; 50% of the medium with fresh cytokines were replenished every other day. From day 7 immature mo-DC were cultured with anti-CD40 antibody (CD40) and TNF with/without PGE2 for maturation. After 3 additional days mature mo-DC were harvested. To obtain cell supernatants free of exogenous stimuli added during culture, DC were harvested at day 10, washed extensively (“washout”) and cultured for additional 24 hours.





This Article
Right arrow Abstract
Right arrow Full Text
Services
Right arrow Email this article to a friend
Right arrow Alert me to new issues of the journal
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via CrossRef

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2009 by American Society of Hematology         Online ISSN: 1528-0020