|
|
Blood, Vol. 107, Issue 5, 1925-1932, March 1, 2006

The structure of the GPIbfilamin A complex
Blood Nakamura et al.
107: 1925
Supplemental materials for: Nakamura et al
Experimental Procedures Antibodies Anti-GFP mouse mAb (clone JL-8, BD Biosciences), anti-GPIb goat pAb (C-20, (Santa Cruz Biotechnology), HRP-conjugated anti-mouse or anti-rabbit IgG (Bio-Rad) were used for immunoprecipitation or immunoblotting. Anti-GPIb mouse mAb (clone WM23) was a gift from Dr. Michael Berndt (Monash University, Australia). An anti-FLNa mouse mAb (clone 3-14) was prepared as previously described1, and its reactive epitope was mapped to domain 3 of human FLNa by immunoblotting with recombinant FLNa domain 3. Another anti-FLNb mouse mAb (clone 1-11c) was raised against recombinant human FLNb as previously described1. Domain 3 of FLNAwas expressed as a GST-fusion protein in E.coli and purified by glutathione-Sepharose affinity chromatography. After cleavage of GST by thrombin, the domain was immobilized on CNBr-activated Sepharose 4B (Sigma, 10 mg ml—1). IgG (mAb3-14) against FLNA domain 3 was purified from mouse hybridoma tissue culture supernatant using domain 3-conjugated Sepharose 4B and immobilized on GammaBind Plus Sepharose 4B (Amersham Biosciences, 5 mg IgG ml—1) by cross-linking with dimethyl pimelimidate (Pierce)2. DNA constructs The pEGFP-FLNa vector was derived from pFASTBAC HTb-FLNa constructed using PCR. The cDNA fragment was amplified using pFASTBAC FLNa as a template, a forward primer, CGCGGATCCATGAGTAGCTCCCACTCTC, containing a BamHI site, and a reverse primer, GTCCAGATGAGGCCCAGGATCAG. The amplified fragment was purified, BamHI/SalI-digested, and ligated into BamHI/SalI sites of the pFASTBAC HTb vector (Invitrogen) to generate pFASTBAC HTb-FLNa/SalI, and its sequence was confirmed by sequencing. The 3’-site of FLNa cDNA was prepared by cutting pFASTBAC FLNa with SalI and HindII, and subsequently ligated into the pFASTBAC HTb-FLNa/SalI opened with SalI and HindII, thereby generating pFASTBAC HTb-FLNa. Enhanced GFP fusions were generated in pEGFP-C1 vector (BD Biosciences) by two steps. The 66-base BamHI/Sal fragment of pFASTBAC HTb-FLNa vector was first subcloned into BglII/SalI sites of pEGFP-C1 vector. Next, the SalI/XbaI fragment from this plasmid was ligated with the SalI/XbaI fragment of pFASTBAC HTb-FLNa vector to generate pEGFP-FLNa. Double mutant (G1897D and C1912D) pEGFP-FLNa vectors were generated using the QuickChange site-directed mutagenesis kit (Stratagene, TX). First, the 3’-site of FLNa cDNA was prepared by cutting pFASTBAC FLNa with ClaI and XbaI, and subsequently ligated into the pBlueScriptII(+) opened with ClaI and XbaI, thereby generating pBlueScriptII(+)-FLNa(CalI/XbaI) vector. Mutagenesis was performed using primers, CAGGAGAGGGGGACCTGTCTCTGGC and GCCAGAGACAGGTCCCCCTCTCCTG for G1897D, CCGTCCAAAGCAGAAATGAGCTGCACTGACAAC and GTTGTCAGTGCAGCTCATTTCTGCTTTGGACGG for I1910M, CCAAAGCAGAAATCAGCGACACTGACAACCAGGATGG and CCATCCTGGTTGTCAGTGTCGCTGATTTCTGCTTTGG for C1912D and pBlueScriptII(+)-FLNa(CalI/XbaI) vector as a template. The ClaI/XbaI fragment from the mutated vector was ligated with the ClaI/XbaI fragment of pEGFP-FLNa vector to generate the mutant pEGFP-FLNa. Expression and purification of full length FLNa and its domains Full-length human FLNa was expressed and purified as previously described3. The fragments encoding FLNa domain 17 (residues 1863-1956), 18 (1957-2044), 19 (2045-2140), and 17-19 (1863-2140) were amplified from a cDNA of human FLNA4. The mutant FLNa-17 construct was generated by PCR using the mutant pEGFP-FLNa described below as template. The fragments were cloned in pGEX-4T1 (Amersham Biosciences) or pMALc (New England BioLabs) plasmids. The inserts were verified by DNA sequencing. The proteins were expressed in Escherichia coli DH5a at 37°C and purified in accordance with manufacturers’ instructions. Tag-free proteins were expressed in Escherichia coli BL21(DE3) at 37°C using a modified pGEX-4T1-HTb plasmid. Protein expression was induced for 3 h at 37°C in the presence of 0.5mM IPTG. The protein was purified on glutathione Sepharose column (Amersham Biosciences) and eluted with 10 mM glutathione in 50 mM Tris-HCl (pH8.0). EDTA (0.5 mM) was added to the eluate, and the protein was cleaved with Tobacco Etch virus (TEV) protease at room temperature overnight. MgCl2 (3 mM) and imidazole (5 mM) were added to the solution, and glutathione S-transferase (GST)-His6-tag and His6-TEV were removed by passing the solution through a Ni-NTA agarose column (Qiagen). The flowthrough fractions were concentrated using an Amicon Ultra-15 (Millipore) with a molecular-weight cutoff of 5,000 Da and applied onto a Superdex 75 HR 10/30 (Amersham Biosciences) equilibrated with 10 mM Tris-HCl, 120 mM NaCl, 0.5 mM EGTA, 1 mM DTT, 0.01 % sodium azide, pH7.4. For the crystallization experiments the FLNA domain 17 was expressed in Escherichia coli BL21, purified with the glutathione Sepharose as above and further purified by gel-filtration chromatography on Superdex 75 16/60 column in 20 mM Tris, 50 mM NaCl, 1mM DTT, pH 8.0. The best fractions were concentrated to 40 mg ml-1. For NMR measurements 15N or 15N/13C-labeled proteins were expressed in minimal media containing 15NH4Cl and 13C-glucose (Spectra Stable Isotopes, Columbia, MD) Expression and purification of GST-GPIbα515-610 The expression plasmid pDX-GPIb containing full length wild type GP Ib cDNA was used as a template to generate a PCR fragment encompassing nucleotides 1633 to 1923 (amino acids 515-610) with 5’ primer 5’-GGGATCCCATGTGAAACCACAGGCC-3’, and 3’ primer 5’-GGAATTCTCAGAGGCTGTGGCCAGA-3’. The PCR product was cloned in-frame into pGEX 5X bacterial expression vector (Amersham, NJ, USA) and labeled pGEX 5X-Ib 515-610.
Expression of the recombinant GST fusion protein was induced in BL21 cells containing pGEX 5X-Ib 515-610. The bacteria were grown to an OD600 of 0.6, and recombinant protein (GST-Ib 515-610) induced by addition of isopropyl-beta-D-thiogalactopyranoside (IPTG) to a final concentration of 1 mM and incubation at 37°C, with shaking for 7 h. The cells were pelleted by centrifugation at 3,000 g for 10 minutes and lysed by resuspending in phosphate-buffered saline (140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4), pH 7.4, 1% Triton X-100 in the presence of a protease inhibitor cocktail (Roche Diagnostics, Germany). The lysate was rocked at 4°C for 1 h, and insoluble material pelleted by centrifugation at 15,400 g for 15 minutes.
Purification of GST-Ib 515-610 fusion protein was carried out according to the manufacturers’ instructions. Briefly, 2 ml (packed volume) of glutathione sepharose 4B (Amersham, NJ, USA) equilibrated with PBS was incubated with the clarified lysate by rocking overnight at 4°C. After centrifugation at 500 g for 5 minutes, the lysate was removed and the resin washed 2 times with 40 ml PBS and centrifuged at 500 g for 5 min. The glutathione Sepharose was loaded into a glass 10 mm diameter column and washed with a further 75 ml PBS. GST fusion proteins were eluted with 10 ml 10 mM glutathione in 50 mM Tris pH 8.0 and dialyzed against PBS overnight at 4°C. Synthesis of GPIbα peptide and binding assays GPIb 556-578 peptide (LRGSLPTFRSSLFLWVRPNGRV of human GPIb ) was chemically synthesized and purified (Tufts University Core Facility, Boston, USA). For binding assays, 1.0 mg of the peptide was coupled to 1.0 ml of NHS-Sepharose 4B (Amersham Biosciences) according to manufacturer’s instructions. Cell culture and transfection Chinese hamster ovary (CHO) cells expressing GPIb IX (CHO-GPIb IX) were provided by Dr. Shuju Feng (Baylor collage of medicine) and maintained in MEM medium containing 5% fetal bovine serum, penicillin (100 units ml-1, streptomycin (100 µg ml-1), and Zeocin™ (200 µg ml-1)5.
CHO-GPIb IX cells (cell density 20-30%, 2 × 10 cells), grown in 35 mm dishes, were transiently transfected using Genejuice (Novagen) transfection reagent according to the manufacturer’s instructions. NMR All NMR samples were prepared in 50 mM sodium phosphate buffer at pH 6.7 containing 95% H2O/5% D2O and 10 mM dithiothreitol to prevent protein multimerisation through intermolecular disulfide bond formation. The final protein concentration of the NMR samples was 0.3-1.2 mM. The spectra were measured with Unity INOVA 500 MHz (relaxation data at 23°C) and 800 MHz (all other spectra at 20°C) spectrometers. All spectra were processed with VNMR (Varian Inc., Palo Alto, CA, USA) and analyzed with Sparky 3.106 (T. D. Goddard and D. G. Kneller, University of California, San Francisco).
The sequential backbone resonance assignment was made using 3D HNCA, iHNCA, HN(CO)CA, HNCACB, HN(CO)CACB and HNCO spectra. Resonances of the aliphatic amino acid side chains were assigned from 3D CC(CO)NH, HCC(CO)NH and HCCH-COSY spectra. The structural restraints were extracted from cross-peak integrals of 3D 15N-edited and 13C-edited NOESY spectra. The NOESY spectra were also used for aromatic side-chain resonance assignment. The T1 and T2 relaxation times were determined from the 15N-labelled sample by acquiring a series of 15N-HSQC spectra as described by Kay et al. and Farrow et al.6,7.
The structure calculations were made with the program CYANA 2.08-10 using the automated NOE assignment and structure calculation algorithm. In addition to NOE data (1919 cross-peaks) 54 backbone dihedral angle restraints estimated from -carbon chemical shifts11 were used. The seven cycles of structure calculation comprised of 10,000 steps of torsion angle dynamics and finally 1000 steps of conjugate gradient minimization. Based on the lowest target function values 20 final structures were extracted from 300 initial random conformers. These structures had an average target function of 0.17 ± 0.01 and backbone RMSD (residues 1868-1954) of 1.03 ± 0.17. There were no violated distance or angle constraints.
Structure refinement of the 20 final CYANA structures was made with AMBER 8.0 (D.A. Case et al., University of California, San Francisco, 2004) program using the generalized Born continuum solvent model. After initial energy minimization of 2000 steps the molecular dynamics run of 10,000 steps of 1 fs was conducted. The procedure involved an initial heating of the structures to 600 K over 2.5 ps using value of 0.3-0.4. The experimental restraints (917 NOE derived upper distance bounds) were introduced into the calculations progressively by increasing their weight from 0.1 to 1.0 over the first 1500 steps. After the heating phase the system was slowly cooled to 100 K during the steps 2501-9000 using value of 4. The temperature bath was set to 0 K for the final 1000 steps during which the value was lowered from 1 to 0.05. Crystallization For crystallization, Filamin A 17 and GPIb 556-577 peptide were taken in concentration 2 mM and 1.8 mM, respectively and mixed. Synthetic peptide has been dissolved in water. Brush-shaped small crystals were grown by hanging drop vapor-diffusion after mixing the protein-peptide complex in a 1 : 1 ratio with the reservoir solution of 1.75 Ammonium Phosphate (pH 8.2). To produce crystals suitable for x-ray analysis microseeding technique were applied, and rod-shaped crystals grown in 1.25 Ammonium Phosphate, pH 8.2. Data collection, structure determination and refinement For data collection, crystals were immersed in reservoir solution containing 20% glycerol and flash frozen at 100 K. The dataset was collected at the ESRF beamline ID23-1, Grenoble (wavelength 0.9795 Å), using the 225 mm marMosaic detector (Mar-USA, Inc.), and was processed and scaled using XDS program package12. The Program phaser was used for molecular replacement13. Human filamin C domain 24 (PDBid 1V05)14 was used as a model. The electron density map produced could be used for automatic model building in Arp/Warp 6.1.115. Further refinement was done in program O16 and Refmac5.217. The final model contained 2 molecules in the asymmetric unit, each consisting of Filamin A17–GPIb peptide complex. In the model the longest peptide contains 17 residues of the 21 in the original peptide. The longest filamin A 17 molecule contains 90 of 94 residues present in construct. The following residues have side chains missing from the electron density: A1881Asn, A1882Lys, A1892Asp, A1916Gln, B1891Lys, B1892Asp, B1909Glu, B1916Gln, B1917Asp, B1940Glu. These residues are mostly located in flexible loop regions. For a final model a restrained isotropic refinement was performed using Refmac5.2 to 2.315A with weight matrix 0.1. The Ramachandran plot of the final model show 87.7% of residues in most favored regions and 12.3% in additional allowed regions. Structure figures were generated with PyMOL (DeLano, W.L. The PyMOL Molecular Graphics System,2002, DeLano Scientific, San Carlos, CA) the surface potential was calculated using GRASP18 and superimposition of molecules was performed on program O. Isothermal titration calorimetry Thermodynamic analysis of the interaction between filamin A domain 17 and GPIba was carried out using a VP-ITC titration calorimeter (MicroCal, Northampton, MA) at 25°C. Samples for ITC experiments were exhaustively dialyzed against 100 mM Na Phosphate (pH 7.4). Prior to the titration experiments, the samples were degassed for 8 min under vacuum (ThermoVac, MicroCal). GPIba peptide (1.2 mM) in a 250 µl rotating syringe was titrated into a sample cell containing filamin A17 (80 M) by using 18 injections of 7 l, except first injection of 2 l. Injections lasted 14 s with 240 s intervals in between. Heat generated by peptide dilution was determined in separate experiments by injecting 1.2mM GPIb solution into a 100 mM Na Phosphate (pH 7.4) buffer-filled sample chamber. All data were corrected for the heat of peptide dilution. Data were fitted by using ψ2 (chi-sqr) minimization on a model assuming a single set of sites to calculate the binding affinity Kα. Data acquisition and analysis were performed by using Origin version 5.0 (MicroCal) software. References 1. Nakamura F, Hartwig JH, Stossel TP, Szymanski PT. Ca2+ and calmodulin regulate binding of filamin a to actin filaments. J Biol Chem. 2005. 2. Schneider C, Newman RA, Sutherland DR, Asser U, Greaves MF. A one-step purification of membrane proteins using a high efficiency immunomatrix. J Biol Chem. 1982;257:10766-10769. 3. Nakamura F, Osborn E, Janmey PA, Stossel TP. Comparison of filamin A-induced cross-linking and Arp2/3 complex-mediated branching on the mechanics of actin filaments. J Biol Chem. 2002;277:9148-9154. 4. Gorlin JB, Yamin R, Egan S, et al. Human Endothelial Actin-Binding Protein (ABP-280, Nonmuscle Filamin) - A Molecular Leaf Spring. J Cell Biol. 1990;111:1089-1105. 5. Feng S, Resendiz JC, Lu X, Kroll MH. Filamin A binding to the cytoplasmic tail of glycoprotein Ibalpha regulates von Willebrand factor-induced platelet activation. Blood. 2003;102:2122-2129. 6. Kay LE, Nicholson LK, Delaglio F, Bax A, Torchia DA. Pulse sequences for removal of the effects of cross correlation between dipolar and chemical-shift anisotropy relaxation mechanisms on the measurement of heteronuclear T1 and T2 values in proteins. Journal of Magnetic Resonance (1969). 1992;97:359. 7. Farrow NA, Muhandiram R, Singer AU, et al. Backbone dynamics of a free and phosphopeptide-complexed Src homology 2 domain studied by 15N NMR relaxation. Biochemistry. 1994;33:5984-6003. 8. Herrmann T, Guntert P, Wuthrich K. Protein NMR structure determination with automated NOE assignment using the new software CANDID and the torsion angle dynamics algorithm DYANA. J Mol Biol. 2002;319:209-227. 9. Guntert P, Mumenthaler C, Wuthrich K. Torsion angle dynamics for NMR structure calculation with the new program DYANA. J Mol Biol. 1997;273:283-298. 10. Guntert P. Automated NMR protein structure calculation. Progress in Nuclear Magnetic Resonance Spectroscopy. 2003;43:105. 11. Fucini P, Renner C, Herberhold C, Noegel AA, Holak TA. The repeating segments of the F-actin cross-linking gelation factor (ABP-120) have an immunoglobulin-like fold. Nat Struct Biol. 1997;4:223-230. 12. Kabsch W. Automatic processing of rotation diffraction data from crystals of initially unknown symmetry and cell constants. J Appl Crystallog. 1993;26:795-800. 13. Storoni LC, McCoy AJ, Read RJ. Likelihood-enhanced fast rotation functions. Acta Crystallogr D Biol Crystallogr. 2004;60:432-438. 14. Pudas R, Kiema TR, Butler PJ, Stewart M, Ylänne J. Structural basis for vertebrate filamin dimerization. Structure (Camb). 2005;13:111-119. 15. Perrakis A, Morris R, Lamzin VS. Automated protein model building combined with iterative structure refinement. Nat Struct Biol. 1999;6:458-463. 16. Jones TA, Zou J-Y, Cowan SW, Kjeldgaard M. Improved methods for the building of protein models in electron density maps and the location of errors in these models. Acta Crystallogr A. 1991;47:110-119. 17. Murshudov GN, Vagin AA, Dodson EJ. Refinement of Macromolecular Structures by the Maximum-Likelihood Method. Acta Crystallogr D. 1997;53:240-255. 18. Nicholls A, Sharp KA, Honig B. Protein folding and association: insights from the interfacial and thermodynamic properties of hydrocarbons. Proteins. 1991;11:281-296. 19. McCoy AJ, Fucini P, Noegel AA, Stewart M. Structural basis for dimerization of the Dictyostelium gelation factor (ABP120) rod. Nat Struct Biol. 1999;6:836-841.
Files in this Data Supplement:
|
|