The apoptotic-cell receptor CR3, but not 
v
5, is a regulator of human dendritic-cell immunostimulatory function
Blood Skoberne et al.
108: 947
Supplemental materials for: Škoberne et al
Primers and PCR
Total cellular RNA from 1 × 106 DCs was extracted using the RNeasy Mini kit (Quaigen) according to the manufacturer’s instructions. The purity and quantity of the isolated RNA was determined spectophotometricaly and then 1µg of total RNA was reverse-transcribed into cDNA using SuperScript reverse transcriptase (Life Technologies). PCR was preformed using the following primers: CCR7 F: cagccttcctgtgtggtttt: R: tgtggtgttgtctccgatgt. The following conditions were used for the amplification of cDNA: 5 min of denaturation at 95°C followed by PCR cycles of 94°C for 0.5 min, annealing for 0.5 min at a primer-specific temperature, and 72°C for 1 min and the final extension at 75°C for 5 min. All PCR reactions were performed in a Biorad iCycler thermal cycler. PCR products were analyzed on a 0.5× TBE 1% agarose gel.
Chemotaxis assay
Migration of DCs was assessed in transwell tissue-culture plates containing polycarbonate membranes with a pore size of 5µm (Coring). 50,000 DCs were placed in serum-free RPMI media in the top chambers and migration towards CCL19 (20 ng/ml in RPMI) in the lower compartment was monitored after 2h. Cells were collected and counted by trypan blue exclusion. Specific migration was calculated by subtracting number of DCs migrating to RPMI from the number of DCs migrating to chemokine solution.
Confocal microscopy
For analysis by confocal microscopy, RBCs were stained with PKH67 dye (Sigma) prior to biotinylation. After 2h co-incubation with RBC-Ab conjugates, DCs were stained with APC-conjugated HLA-DR antibodies (Pharmingen) and analysed by microscopy (LSM 510 laser scanning confocal microscope from Zeiss, with C-Apochromat 63X/1.2W corr lens). Images were acquired and colors and contrast were adjusted using LSM 510 v. 3.2" confocal software.
SUPPLEMENTAL REFERENCES
1. Chieppa M, Bianchi G, Doni A, et al. Cross-linking of the mannose receptor on monocyte-derived dendritic cells activates an anti-inflammatory immunosuppressive program. J Immunol. 2003;171:4552-4560.
2. Sallusto F, Cella M, Danieli C, Lanzavecchia A. Dendritic cells use macropinocytosis and the mannose receptor to concentrate antigen in the major histocompatibility class II compartment. Downregulation by cytokines and bacterial products. J Exp Med. 1995;182:389-400.
3. Ohl L, Mohaupt M, Czeloth N, et al. CCR7 governs skin dendritic cell migration under inflammatory and steady-state conditions. Immunity. 2004;21:279-288.
4. Misslitz A, Pabst O, Hintzen G, et al. Thymic T cell development and progenitor localization depend on CCR7. J Exp Med. 2004;200:481-491.
5. Ohl L, Henning G, Krautwald S, et al. Cooperating mechanisms of CXCR5 and CCR7 in development and organization of secondary lymphoid organs. J Exp Med. 2003;197:1199-1204.
6. Huang F-P, Platt N, Wykes M, et al. A discrete subpopulation of dendritic cells transports apoptotic intestinal epithelial cells to T cell areas of mesenteric lymph nodes. J Exp Med. 2000;191:435-442.
7. Verbovetski I, Bychkov H, Trahtemberg U, et al. Opsonization of apoptotic cells by autologous iC3b facilities clearance by immature dendritic cells, down-regulates DR and CD86, and up-regulates CC chemokine receptor 7. J Exp Med. 2002;196:1553-1561.
(1000 IU/ml) was added to the cultures. Culture supernatants were harvested after 40h and were tested in an ELISA assay for the indicated cytokines and chemokines. A representative experiment of at least two is shown.
v
5-, CD11b- or CD32-ApoS. DCs were then stained with HLA-DR-APC, mounted on slides and subjected to confocal microscopy. The CD32- and 