Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nakao, S.
Right arrow Articles by Matsuda, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nakao, S.
Right arrow Articles by Matsuda, T.
Related Collections
Right arrow Immunobiology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 89 No. 10 (May 15), 1997: pp. 3691-3699

Isolation of a T-Cell Clone Showing HLA-DRB1*0405-Restricted Cytotoxicity for Hematopoietic Cells in a Patient With Aplastic Anemia

By Shinji Nakao, Akiyoshi Takami, Hideyuki Takamatsu, Weihua Zeng, Naomi Sugimori, Hiroto Yamazaki, Yuji Miura, Mikio Ueda, Shintaro Shiobara, Takeshi Yoshioka, Toshihiko Kaneshige, Masaki Yasukawa, and Tamotsu Matsuda

From the Third Department of Medicine and Blood Transfusion Section, Kanazawa University School of Medicine, Kanazawa, Japan; the Shionogi Biomedical Laboratory, Osaka, Japan; and the First Department of Medicine, Ehime University School of Medicine, Ehime, Japan.


    ABSTRACT
Abstract
Introduction
Methods
Results
Discussion
References

The existence of T cells capable of inhibiting in vitro hematopoiesis has been shown in aplastic anemia (AA), although whether such inhibition is mediated by a specific immune reaction involving an HLA allele remained unknown. We isolated a CD4+ Vbeta 21+ T-cell clone that was most dominant among Vbeta 21+ T cells in the bone marrow (BM) of an AA patient whose HLA-DRB1 alleles included 1501 and 0405. The T-cell clone named NT4.2 lysed an autologous Epstein-Barr virus-transformed lymphoblastoid cell line (LCL) and phytohemagglutinin-stimulated lymphocytes (PHA-blasts) as well as allogeneic LCLs sharing HLA-DRB1*0405. Cytotoxicity against LCL cells and PHA-blasts by NT4.2 was blocked by anti-HLA-DR monoclonal antibody (MoAb) or anti-CD3 MoAb. NT4.2 also lysed autologous BM mononuclear cells enriched with CD34+ cells that had been cultured for one week in the presence of colony-stimulating factors as well as allogeneic CD34+ cells of a normal individual carrying HLA-DRB1*0405, cultured in the same way. Moreover, NT4.2 strongly inhibited colony formation by hematopoietic progenitor cells derived from cultured CD34+ cells sharing HLA-DRB1*0405. These results indicate that the AA patient has T cells capable of killing hematopoietic cells in an HLA-DRB1*0405-restricted manner and that such cytotoxic T cells may contribute to the pathogenesis of AA.

    INTRODUCTION
Abstract
Introduction
Methods
Results
Discussion
References

TWENTY-FIVE YEARS AGO an immune mechanism was implicated in the development of aplastic anemia (AA) by Mathe et al.1 Since then, clinical evidence supporting immune mechanism(s) has accumulated.2 Recent reports of markedly high response rates to combined immunosuppressive therapy in patients with AA suggest that bone marrow (BM) failure in the majority of AA patients may be immune mediated.3,4 Various findings have been reported to account for immune-mediated suppression of hematopoiesis in AA in vitro. These include inhibition of hematopoietic progenitor cell growth by patient lymphocytes,5,6 overproduction of myelosuppressive cytokines by patient lymphocytes,7-9 and an increased proportion of activated suppressor T cells.10-12 In addition, correlation of some laboratory findings with the response to immunosuppressive therapy in patients with AA has indicated a pathogenic role for myelosuppressive T cells in vitro.13,14 However, these may be secondary phenomena of immune reactions irrelevant in the pathogenesis of AA.15 The target of these T cells remains entirely unknown, and it is unclear what induces such autoimmunity in AA patients.

Establishing T-cell lines or clones from an involved organ and studying their specificity is a common way to identify an unknown target antigen in organ-specific autoimmune diseases and neoplasms.16,17 Some patients with immune-mediated AA may have T cells capable of recognizing hematopoietic progenitor cells and inhibiting their growth in the BM.18,19 If these T cells were isolated and stably maintained in vitro, they could facilitate identification of target antigens mediating BM failure. To test these possibilities, we established T-cell clones from the BM of an untransfused AA patient whose hematopoietic function was dependent on administration of cyclosporine. One CD4+ clone lysed autologous hematopoietic cells, including cultured lymphocytes and BM mononuclear cells (BMMC) enriched for CD34+ cells, probably via recognition of a physiological peptide presented by HLA-DRB1*0405. The T-cell clone also inhibited progenitor cell growth derived from cultured CD34+ cells in an HLA-DRB1*0405-restricted manner.

    MATERIALS AND METHODS
Abstract
Introduction
Methods
Results
Discussion
References

Isolation of BM T cells and CD34+ cells from a patient with immune-mediated AA. After informed consent was obtained, BM was aspirated from a 66-year-old untransfused man with AA after he relapsed with pancytopenia following a dose reduction of cyclosporine. BM mononuclear cells (BMMC) were prepared using density-gradient centrifugation. T cells were isolated from BMMC using rosette formation with sheep red blood cells. The CD4/CD8 ratio of BM T cells was 0.74. Non-T cells were incubated for 60 minutes in plastic flasks coated with monoclonal antibodies (MoAbs) against CD34 (Applied Immune Science, Santa Clara, CA), and CD34+ cells were obtained according to the manufacturer's instructions. This CD34+ cell fraction was 77% CD34+ and 93% HLA-DR positive. Although the cell fraction comprised a considerable number of CD34- cells, the cells in this fraction are termed CD34+ cells. BMMCs were again obtained from the patient when BM was aspirated for karyotype analysis after pancytopenia improved after dose escalation of cyclosporine. CD34+ cells were isolated in the same way and cryopreserved after aliquoting. This study was approved by the institutional human research committee.

Growth of BM T cells. BM T cells were suspended in RPMI 1640 supplemented with 2 mmol/L L-glutamine, minimal essential amino acids, sodium pyruvate, and kanamycin (all from GIBCO, Grand Island, NY; complete medium) plus 10% pooled AB serum. A total of 2 × 105 cells were cultured in round-bottom plastic tubes (Falcon, Oxnard, CA) with 105 irradiated (45 Gy) autologous CD34+ cells. After 7 days, recombinant interleukin-2 (IL-2; 100 IU/mL; Shionogi, Osaka, Japan) and the same number of irradiated CD34+ cells that had been cryopreserved were added to the culture and further incubated for 7 days. After culture, the number of viable T cells was determined using trypan-blue dye exclusion. Viable T cells were diluted with complete medium supplemented with 10% pooled AB serum, 1 µg/mL phytohemagglutinin (PHA; Wellcome, Dartford, UK), and 45 Gy-irradiated allogeneic peripheral blood mononuclear cells (PBMC; 5 × 105 mL). Twenty microliters of the cell suspension was plated in microtiter wells of Terasaki plates (Nunc, Roskilde, Denmark) and cultured in 5% CO2 . Ten days later, growing cultures were transferred to flat-bottom plates and further cultured. Isolated T-cell clones were maintained by regular supplementation with complete medium containing IL-2 and occasional restimulation with 45-Gy irradiated allogeneic PBMC and PHA.


View larger version (22K):
[in this window]
[in a new window]
 
Fig 1. IFN-gamma production by T-cell clones after coculture with auto CD34+ cells or EBV-transformed B-cell line (LCL) cells. Each T-cell clone (5 × 104 cells) was cultured with auto CD34+ cells or LCL cells (2 × 104 cells) for 20 hours in RPMI 1640 medium supplemented with 10% human AB serum and 100 IU/mL of IL2. IFN-gamma concentrations in the culture supernatant (mean ± SE) were determined from duplicate cultures.

Establishment of Epstein-Barr virus (EBV)-transformed lymphoblastoid cell lines (LCLs). PBMC from patients with AA and normal individuals were depleted of T cells using the rosette formation method; 2 to 3 × 106 non-T cells were incubated in 10% fetal calf serum (FCS; GIBCO)-RPMI 1640 containing 10% culture medium of an EBV-producing cell line, B95-8, at 37°C for 2 hours. The EBV-infected cells were cultured for 3 weeks until transformed LCL cells grew. LCL cells were maintained by changing the medium every 4 to 5 days.

Typing for HLA-DRB1. High molecular weight DNA was extracted from leukocytes of patients or normal volunteers using a standard method. All patients gave informed consent for drawing of blood. The second exon of the DRB1 gene was amplified using the polymerase chain reaction (PCR) with specific primers, and each allele was typed using the restriction fragment length polymorphism method as described previously.20

Preparation of PHA-stimulated lymphocytes. PBMC from the patient were suspended in RPMI 1640 supplemented with 10% FCS and PHA (1 µg/mL) at a concentration of 2 × 105/mL. After 7 days, cultured lymphocytes (PHA-blasts) were washed twice with RPMI 1640 and used as target cells for a 51Cr-release assay.

Measurement of interferon-gamma (IFN-gamma ) production by T-cell clones. Each T-cell clone (5 × 104 cells) was cultured with autologous CD34+ cells or LCL cells (2 × 104 cells) for 20 hours in complete medium supplemented with IL-2 (100 IU/mL) and 10% pooled AB serum. IFN-gamma concentrations in the culture supernatant were determined from duplicate cultures using an enzyme-linked immunosorbent assay (Endogen, Cambridge, MA). The IFN-gamma concentration in the culture medium of cloned T cells alone was less than 50 pg/mL.

3H-thymidine incorporation assay. A total of 5 × 104 T cells were cultured in 96-well U-bottomed plates (Nunc) with the same number of 45 Gy-irradiated autologous LCL cells. After 3 days of incubation, 1 µCi of 3H-thymidine (6.7 Ci/mmol; Dupont NEN Products, Boston, MA) was added to each well. Cultured cells were harvested after 6 hours, and 3H-thymidine incorporation was measured. The stimulation index of each T-cell clone against LCL cells was calculated from triplicate cultures by dividing incorporation against LCL cells by incorporation against autologous T cells.


View larger version (12K):
[in this window]
[in a new window]
 
Fig 2. Cytotoxicity of T-cell clones against autologous LCL cells. A total of 5 × 104 cloned T cells were cultured with 5 × 103 51Cr-labeled auto LCL cells for 4 hours, and 51Cr release was measured using a gamma -counter. The percentage of specific lysis (mean ± SE) was determined from two separate experiments. T-cell clone numbers correspond to those in Fig 1.

51Cr release assay. LCL cells, PHA-blasts, or CD34+ cells were incubated with 100 µCi of 51Cr at 37°C for 1 hour after washing with phosphate-buffered saline (PBS). Labeled cells were washed three times with PBS and suspended in complete medium supplemented with IL-2 (100 IU/mL) and 10% pooled AB serum. Cells (5 × 103 to 104) were incubated with various numbers of cloned T cells for 4 hours. 51Cr release into the medium was measured using a gamma -counter. The percentage of specific lysis (mean ± standard error [SE]) obtained in the 51Cr release assay was determined from triplicate cultures as follows: 100 × (Experimental Release cpm - Spontaneous Release cpm)/(Maximum Release cpm - Spontaneous Release cpm).

Blocking of cytotoxicity by MoAbs. Mouse MoAbs were used as ascites or after being purified from ascites by protein A column (Pharmacia, Uppsala, Sweden) to block cytotoxicity by T cells against hematopoietic cells. Diluted 1/100 ascites or purified MoAbs (10 µg/mL) were added to target cells in 96-well plates and incubated for 30 minutes at 37°C before effector cells were added. MoAbs were HU-4 (anti-DR), HU-30 (anti-DR2), HU-11 (anti-DO; kindly provided by Dr Akemi Wakisaka, Hokkaido University, Japan), W6/32 (anti-HLA class I; American Type Culture Collection, Rockville, MD), B7-21 (anti-DP), and OKT3 (anti-CD3; Becton Dickinson, Mountain View, CA).

Determination of T-cell receptor Vbeta usage by a T-cell clone. Cloned T cells were incubated with fluorescent MoAbs against 17 different variable regions of the T-cell receptor (TCR) beta chain (Vbeta ; Vbeta 5.1, Vbeta 5.2, Vbeta 5.3, Vbeta 6.7, Vbeta 8, and Vbeta 12 from T Cell Sciences Inc, [Cambridge, MA]; Vbeta 3, Vbeta 6.1, Vbeta 9, Vbeta 11, Vbeta 13.1, Vbeta 13.6, Vbeta 14, Vbeta 16, Vbeta 17, Vbeta 20, Vbeta 21.3, and Vbeta 22, from Immunotech [Marseille, France]) and analyzed using a fluorescence-activated cell sorter scan (FACScan). For T-cell clones that did not react with any of these MoAbs, the Vbeta family of each T-cell clone was determined using reverse dot blot hybridization as described elsewhere.21 Briefly, RNA was extracted from each clone, and double-strand cDNA was synthesized using a cDNA synthesis kit (BRL, Bethesda, MD) and a specific primer adapter. After adapter ligation followed by restriction enzyme digestion, cDNA was amplified using a Cbeta primer and a primer adapter with PCR. Amplified cDNA products labeled with biotinylated deoxynucleotides were hybridized with 39 different oligonucleotides specific to each Vbeta that had been enzymatically tailed at the 3' terminus and attached to nylon membranes. The hybridization was visualized with a streptavidin-alkaline phosphatase conjugate (BRL) and a color development (NBT-BCIP; Promega, Madison, WI).

Single-strand conformation polymorphism analysis of amplified products derived from TCRVbeta 21 cDNA. Total RNA was extracted from BMMC of the patient, BMMC of six normal volunteers, including two with HLA-DRB1*0405 and two with HLA-DRB1*1501, and the three Vbeta 21+ T-cell clones. cDNA was synthesized from RNA using M-MLV reverse transcriptase (BRL) and oligo dT as a primer. TCRVbeta 21 cDNA was amplified with the PCR using a primer specific to Vbeta 21 (5' GAGTGTGGCTTTTTGGTGCAA 3') and a Cbeta primer (5' TCTACCCCAGGCCTCGGCGCTGACGAT 3').22 The amplified products were heat denatured in a formamide solution containing 80% formamide, 20 mmol/L EDTA, and 0.1% bromphenol blue and electrophoresed on an 8% polyacrylamide gel.23 DNA was visualized using a silver stain kit (Daiichi Kagaku, Tokyo, Japan).

Suspension culture of CD34+ cells. CD34+ cells (105) isolated from the patient and normal individuals were suspended in 1 mL of Iscove's modified Dulbecco's Medium (IMDM; GIBCO) supplemented with recombinant IL-3 (2 ng/mL), IL-6 (50 ng/mL), stem cell factor (10 ng/mL), granulocyte colony-stimulating factor (G-CSF, 100 ng/mL) (all were gifts from Kirin Brewery, Tokyo, Japan), and 10% FCS, and cultured in a 15-mL plastic tube (Falcon). After 7 days, cultured cells were harvested and used as target cells for the 51Cr release assay and hematopoietic progenitor cell assay.


View larger version (73K):
[in this window]
[in a new window]
 
Fig 3. Single-strand conformation polymorphism analysis of TCR Vbeta 21 cDNA amplified with the PCR. The cDNA from BMMC of a normal individual, BMMC of the patient, and the three Vbeta 21+ T-cell clones were amplified with the PCR, using a primer specific to Vbeta 21 and a Cbeta primer. The amplified products were heat-denatured in a formamide solution and electrophoresed on an 8% polyacrylamide gel. The DNA was visualized by silver staining.

Hematopoietic progenitor cell assay. A total of 3 × 103 freshly isolated or cultured CD34+ cells, suspended in 0.3 mL of IMDM supplemented with 10% FCS were mixed with methylcellulose medium supplemented with various colony-stimulating factors (CSFs; StemCell Technologies, Vancouver, British Columbia, Canada). One milliliter of the cell mixture was plated on a 35-mm culture dish. In some experiments, 3 × 103 CD34+ cells were suspended in 0.3 mL of 10% FCS-IMDM with 3 × 104 cloned T cells from the patient and incubated at 37°C in a 15-mL plastic tube (Falcon). After 4 hours, the cell suspension was added with 2.7 mL of the methylcellulose medium, and, after shaking the tube vigorously, 1 mL of the cell mixture was plated on a 35-mm culture dish. After 14 days, colony-forming unit-granulocyte macrophage (CFU-GM)-derived colonies and burst-forming unit-erythroid (BFU-E)-derived colonies were counted under an inverted microscope.

    RESULTS
Abstract
Introduction
Methods
Results
Discussion
References

TCRVbeta of T-cell clones and response to autologous hematopoietic cells. A total of 16 CD4+ T-cell clones were established from BM T cells and were stably maintained for greater than 1 year. All clones were tested and found to be Mycoplasma-free. Clones included three Vbeta 21+, two Vbeta 14+, two Vbeta 17+, two Vbeta 13.2+, two Vbeta 13.6+, two Vbeta 25+, one Vbeta 20+, one Vbeta 2+, and one Vbeta 8+ (Fig 1). When these clones were tested against autologous CD34+ cells, only three Vbeta 21+ clones and one Vbeta 13.6+ clone produced more than 200 pg/mL of IFN-gamma in culture medium after coculture with autologous CD34+ cells (Fig 1). We reasoned that, if these CD4+ T cells recognized a self-peptide presented by HLA class II antigen on CD34+ cells, they might respond to other autologous hematopoietic cells expressing HLA class II antigens. In agreement with this hypothesis, these four T-cell clones produced more IFN-gamma when cocultured with LCL cells (Fig 1). Because the T-cell clones appeared to show similar responses against autologous LCL and CD34+ cells, LCL cells were used as targets in the functional analysis of the T-cell clones.


View larger version (13K):
[in this window]
[in a new window]
 
Fig 4. Cytotoxicity of T-cell clones against auto LCL cells and PHA-stimulated peripheral blood mononuclear cells (PHA-blasts). Auto LCL cells and peripheral blood mononuclear cells that were cultured with 1% PHA in 10% FCS-RPMI 1640 medium for 7 days (PHA-blasts) were incubated with differing numbers of cloned T cells in a 4-hour cytotoxicity assay. (bullet ) NT4.2 (clone 12); (open circle ) NT27 (clone 10).

Cytotoxicity of T-cell clones against autologous LCL cells. When the T-cell clones were tested for their proliferative response to autologous LCL cells using 3H-thymidine incorporation, none of the clones exhibited an outstanding response; the stimulation index was comparable among all 16 T-cell clones, ranging from 2.5 to 3.3 (data not shown). However, cytotoxicity against LCL cells varied with each clone (Fig 2). Among the 9 T-cell clones examined, only the 3 Vbeta 21+ clones killed LCL cells with more than 35% specific lysis at an effector/target ratio of 10.

Single-strand conformation polymorphism analysis of TCRVbeta 21 cDNA amplified with PCR. The amplified products from the three Vbeta 21+ T-cell clones showed the same mobility shift, suggesting that these clones were of a common origin (Fig 3). This clone was named NT4.2, which was CD3+ CD4+ CD8- CD56+. The amplified products derived from BMMC cDNA from six normal individuals failed to exhibit any bands, indicating an absence of clonally expanded T cells among Vbeta 21+ T cells. In contrast, the amplified products derived from the BM of our patient exhibited several distinct bands, indicating an oligoclonal proliferation of Vbeta 21 T cells in the BM. Moreover, the mobility shift of the most distinct band was the same as that of NT4.2, indicating dominant proliferation of NT4.2 in vivo. When the patient's BM was examined after pancytopenia improved after dose escalation of cyclosporine, no distinct band was detectable in Vbeta 21 cDNA amplified with PCR (data not shown).

Cytotoxicity of T-cell clones against autologous LCL cells and PHA-stimulated PBMC (PHA-blasts). When autologous LCL cells were incubated with differing numbers of cloned T cells in a 4-hour cytotoxicity assay, NT4.2 cells lysed these cells in a dose-dependent fashion. Cytotoxicity reached 74% at an effector/target ratio of 30, whereas the percentage-specific lysis of LCL cells by clone 10 (NT27) cells was only 7% at this ratio (Fig 4). NT4.2 cells failed to lyse freshly isolated autologous PBMC and K562 cells (data not shown) but did lyse autologous PHA-blasts in a dose-dependent fashion. These findings suggested that killing of autologous LCL cells by NT4.2 cells was not mediated by EBV-related antigens.

Blocking of cytotoxicity mediated by NT4.2 cells against autologous (auto) and allogeneic (allo) lymphocytes. Cytotoxicity mediated by NT4.2 cells against the auto LCL cells and PHA-blasts was blocked to a similar degree by the addition of either anti-HLA-DR MoAb or anti-CD3 MoAb (Fig 5). Cytotoxicity was not affected by the addition of either anti-HLA-DR2 MoAb, anti-HLA-DQ MoAb, anti-HLA-DP MoAb, or anti-HLA class I MoAb. NT4.2 cells also lysed one of four allo LCLs that did not share an HLA-DRB1 allele with the patient. Because cytotoxicity against this LCL (DRB1*0901, 0901) was not blocked by anti-HLA MoAb or OKT3, this would appear to be a nonspecific event, irrelevant to the interaction between HLA and the TCR.


View larger version (72K):
[in this window]
[in a new window]
 
Fig 5. Blocking of cytotoxicity mediated by NT4.2 cells against auto LCL cells, allo LCL cells, and auto PHA-blasts. A total of 5 × 104 NT4.2 cells were incubated with 5 × 103 51Cr-labeled target cells in medium (Med) alone or with addition of the indicated MoAbs: anti-HLA-DR, DQ, DP, anti-HLA class I, and anti-CD3, ascites 1/100; anti-HLA DR2, purified MoAb 10 mg/mL. The mean percentage of specific lysis was determined from triplicate cultures after 4 hours of incubation.

Cytotoxicity of NT4.2 cells against allo LCLs that share HLA-DRB1*1501 or DRB1*0405. NT4.2 cells failed to lyse allo LCLs that shared DRB1*1501 with our patient, except for those whose remaining DRB1 allele was DRB1*0405 or DRB1*0410, which differs from DRB1*0405 at only two residues on the beta chain (Fig 6). By contrast, the CD4+ clone killed allo LCLs homologous with DRB1*0405 from normal individuals. These findings suggested that the target antigen of NT4.2 cells was presented by DR4 and that it is not unique to this patient but is also shared by normal individuals carrying HLA-DRB1*0405.


View larger version (19K):
[in this window]
[in a new window]
 
Fig 6. Cytotoxicity of NT4.2 cells against allo LCLs that share HLA-DRB1*1501 or HLA-DRBI*0405. A total of 5 × 104 NT4.2 cells were incubated with 5 × 103 51Cr-labeled auto LCL cells or allo LCL cells from aplastic anemia patients and normal individuals that share HLA-DRB1*1501 or HLA-DRB1*0405, and 51Cr release was determined. Data are expressed as a mean of triplicate cultures.

Cytotoxicity of NT4.2 cells against CD34+ cells. NT4.2 cells did not show cytotoxicity against freshly isolated CD34+ cells despite the fact that most of them expressed HLA-DR (Table 1A). Because auto PBMC needed to be cultured to be susceptible to killing by NT4.2, 105 CD34+ cells were cultured in the medium containing various CSFs for 7 days and then tested for cytotoxicity by NT4.2. Seven days later, 0.8 to 2.2 × 105 cells were recovered. The T-cell clone lysed cultured CD34+ cells by up to 15% (Table 1A). Another T-cell clone, NT27, did not lyse CD34+ cells. The proportion of CD34+ cells in the cultured cell fraction could not be determined because of the limited number of cells. When cultured allo CD34+ cells from three normal individuals were used as target cells, NT4.2 showed greater than 10% cytotoxicity only against CD34+ cells from the normal individual (A) carrying HLA-DRB1*0405 (Table 1B). The proportion of CD34+ cells in the cultured cell fraction from individual A in two experiments was 46.3% and 46.5%.

 
View this table:
[in this window] [in a new window]
 
Table 1. Cytotoxicity of T-Cell Clones Against CD34+ Cells

Effect of T-cell clones on colony formation by auto CD34+ cells. To examine the effects of cloned T cells on hematopoietic progenitor cell growth, cultured or uncultured auto CD34+ cells were preincubated with cloned T cells and then cultured in methylcellulose medium supplemented with CSFs. Although the addition of NT4.2 cells slightly reduced the number of CFU-GM colonies derived from freshly isolated CD34+ cells, the degree of reduction was marginal (Table 2). By contrast, the addition of NT4.2 cells to the cultured CD34+ cells markedly reduced the number of colonies derived from both BFU-E and CFU-GM. The number of colonies was partially recovered by the addition of anti-HLA-DR MoAb into the culture with NT4.2 cells. When the 4-hour incubation of CD34+ cells with NT4.2 cells in the suspension culture before adding methylcellulose medium was omitted, the decrease in the number of colonies was not seen.

 
View this table:
[in this window] [in a new window]
 
Table 2. Effect of T-Cell Clones on Autologous Hematopoietic Progenitor Cell Growth

Effect of T-cell clones on colony formation by allo cultured CD34+ cells. When allo CD34+ cells from a normal individual carrying HLA-DRB1*0405 (A) were tested for susceptibility to suppression by NT4.2, colony formation was suppressed by more than 70% (Table 3). This suppression was not observed when the 4-hour preincubation was omitted. Suppression of colony formation by CD34+ cells from normal individuals (B and C) not carrying HLA-DRB1*0405 was less than 25%.

 
View this table:
[in this window] [in a new window]
 
Table 3. Effect of T-Cell Clones on Colony Formation by Allogeneic CD34+ Cells

    DISCUSSION
Abstract
Introduction
Methods
Results
Discussion
References

Several T-cell clones capable of inhibiting in vitro hematopoiesis have been isolated from patients with AA.18,19 Moebius et al18 found that a CD4+CD8+ T-cell clone from peripheral blood of a patient with AA lysed auto and allo LCLs in an HLA-DP-restricted fashion and inhibited the growth of hematopoietic progenitor cells. In this study, cytotoxicity of the CD4+CD8+ T-cell clone was not restricted by a certain HLA-DP allele and inhibition of hematopoietic progenitor cells was nonspecific. A CD4+Vbeta 17+ T-cell clone that we isolated from a transfused AA patient in a previous study secreted IFN-gamma in response to auto CD34+ cells and inhibited the growth of hematopoietic progenitor cells from CD34+ cells.19 However, because only a limited number of auto CD34+ cells were used as target cells, restriction of the inhibition by an HLA allele could not be examined. In the present study, we identified a CD4+Vbeta 21+ T-cell clone (NT4.2) in the BM of a patient with cyclosporine-dependent AA that is capable of killing cultured lymphocytes and BMMC enriched for CD34+ cells in an HLA-DRB1*0405-restricted manner. Thus, NT4.2 is the first T-cell clone isolated from an AA patient that requires HLA-DRB1 identity with the hematopoietic cells to exert cytotoxicity for them.

NT4.2 showed moderate cytotoxicity against CD34+ cells cultured in the presence of CSFs for 1 week. The T-cell clone markedly inhibited growth of hematopoietic progenitor cells derived from the cultured CD34+ cells by direct cell-cell contact. Inhibition against hematopoietic progenitor cells was partially abrogated by addition of MoAb against HLA-DR. Thus, it is possible that NT4.2 can lyse cultured CD34+ progenitor cells by a mechanism similar to that responsible for lysis of LCLs and PHA-blasts.24 However, this T-cell clone failed to kill a freshly obtained CD34+ cell population that was 77% pure. It is known that some antigen-presenting cells, such as dendritic cells, can be generated from CD34+ cells during the culture.25 These antigen-presenting cells may stimulate NT4.2 during the preincubation time before methylcellulose culture to produce IFN-gamma that inhibits colony formation. Thus, CD34+ cells may not be the true target of NT4.2, and inhibition of hematopoietic progenitor cells by NT4.2 may be indirect. Because it is virtually impossible to obtain a sufficiently high number of pure CD34+ cells to be used as target cells in the cytotoxicity assay by using cell sorting, a leukemic cell line with HLA-DRB1*0405 sharing the characteristic of hematopoietic progenitor cells seems to be required to determine whether NT4.2 can directly kill hematopoietic progenitor cells.

Little is known about target antigens of myelosuppressive T cells in AA because T-cell clones specifically recognizing hematopoietic cells via an HLA such as NT4.2 had not been available. Studying this T-cell clone could facilitate identification of such target antigens. Given its cytotoxicity toward autohematopoietic cells in the absence of exogenous antigens, NT4.2 is thought to recognize a ubiquitous self peptide bound to HLA-DR4 as a result of failure in maintaining tolerance. It is possible that cytotoxicity was directed not against an endogenous antigen but rather against an exogenous serum component, because all hematopoietic cells susceptible to killing by NT4.2 had been cultured in medium containing human serum or FCS in this study. One possible candidate is a stress protein. Yoshino et al26 have recently shown that tumor-infiltrating CD4+ T cells react to LCL cells expressing heat shock protein 70 in an HLA-DR restricted manner. In autoimmune diseases such as rheumatoid arthritis27 and Behcet's disease,28 self cells that express heat shock proteins have been shown to be recognized and injured by autoreactive T cells directed to the heat shock protein-derived epitope in the context of major histocompatibility antigens. It is possible that CD4+ T cells recognizing stressed hematopoietic cells through heat shock proteins exist in the BM of immune-mediated AA. Whether the killing of LCL cells by NT4.2 is mediated by such stress proteins is currently under investigation.

Because NT4.2 was isolated after stimulation of BM T cells with irradiated auto CD34+ cells, it is possible that proliferation of this T-cell clone would only be an in vitro "artifact" irrelevant to the pathogenesis of AA. Acquisition of cytotoxicities by CD4+ T-cell clones has been implicated in in vitro long-term cultures.29 Similar T-cell clones cytotoxic against auto hematopoietic cells may be generated from BM T cells from a normal individual because T cells reactive against auto hematopoietic cells have been detected in the circulation of normal patients.30,31 It is also possible that NT4.2 has been induced by the administration of CyA because the patient had been treated with CyA at the time of marrow aspiration.32 However, in the BM of normal individuals, there was no sign of clonal proliferation of Vbeta 21+ T cells as shown by single-strand conformation polymorphism (SSCP) analysis. NT4.2 was identical to the most dominant T-cell clone among the Vbeta 21+ T cells of this patient's BM. The distinct band in the SSCP gel detected in this patient does not represent a physiological skewing of TCR Vbeta 21 usage associated with the patient's HLA-DRB1* allele because Vbeta 21 cDNA from four unaffected individuals possessing DRB1*0405 or DRB1*1501 did not produce such distinct bands in the SSCP gel. Evidence for oligoclonal proliferation of Vbeta 21+ T cells in the BM was no longer detected when the patient's blood counts recovered after dose escalation of cyclosporine. Moreover, cloning efficiency of this T-cell clone was as high as 3 of 16, indicating preferential expansion of the clone in response to stimulation with auto CD34+ cells in vitro. In addition, NT4.2 was a T-cell clone with a CD4+CD56+ phenotype, which could hardly be established from normal individuals.33 These findings suggest that NT4.2 is not a T cell provoked to proliferate primarily in vitro, but a T-cell clone that had been activated by certain antigens to proliferate in the BM of immune-mediated AA.

The patient with AA in the present study carried an HLA-class II haplotype (DRB1*1501-DQA1*0102-DQB1*0602), which is associated with susceptibility to cyclosporine-dependent AA.34 Because killing of the auto LCL by NT4.2 depended on HLA-DR, we suspected that, of his DRB1 alleles, DRB1*1501 would be responsible for the cytotoxicity. However, the failure of HLA-DR2 MoAb to block cytotoxicity and the selective killing of allo LCLs with DRB1*0405 clearly suggested that a target antigen may be presented by HLA-DR4. DRB1*0405 is the most common DR4-associated subtype among Japanese, and is strongly associated with rheumatoid arthritis in Japanese.35,36 This DRB1 allele and DRB1*0410, which differs from DRB1*0405 at only two residues on the beta chain, was found in 5 of 13 patients with cyclosporine-dependent AA.34 Thus, it is possible that DRB1*0405 may also be associated with immune mechanisms causing AA.

CD4+ cells with cytotoxic activity have been shown in certain disease states, such as autoimmune diseases,16 viral infections,37 and malignancies.38 CD4+ cytotoxic lymphocytes (CTL) are also known to kill auto antigen-presenting cells in the presence of exogenous antigen.24 This cytotoxicity has implicated CD4+ CTL as modulators of the immune response. However, recent studies using murine and human systems have documented the important role of CD4+ CTL in defense against foreign pathogens and transplanted allografts.37,39 NT4.2 did not require the presence of exogenous antigens for killing of auto LCL cells. To our knowledge, this is the first CD4+ CTL against auto antigen-presenting cells that was not pulsed with exogenous antigens. Moebius et al previously established a CD4+CD8+ T-cell clone with autocytotoxic activity similar to NT4.2 from a patient with AA.18 Although its phenotype differs from NT4.2, it is intriguing that CD4+ CTL with similar activities against auto LCL cells could be established in patients with AA.

Previous studies on T lymphocytes of AA patients have emphasized pathogenic roles of CD8+ T cells rather than CD4+ T cells.9-12 Peripheral blood T cells capable of suppressing in vitro growth of hematopoietic progenitor cells were mainly CD8+ T cells.40,41 In the BM of AA patients, the number of activated CD8+ T cells has been shown to be relatively high.12 In the present study, T-cell clones isolated from the patient's BM were all CD4+ despite the decreased CD4/CD8 ratio (0.74) in the BM. The absence of a CD8+ T-cell clone may be caused by culturing of BM T cells with irradiated auto CD34+ cells before T-cell cloning, because culturing of T cells with auto hematopoietic cells with HLA-DR favors proliferation of CD4+ T cells.42 However, recent studies on BM biopsy specimens from AA patients using immunohistochemical staining showed that the CD4/CD8 ratio was not necessarily decreased, even when the ratio in aspirated BM was decreased.43 In a rodent model, a small number of allo CD4+ cytotoxic T cells was shown to produce profound atrophy of BM by cell-cell contact.39 In addition, NT4.2 had a surface phenotype of CD4+CD56+ that has been associated with higher cytotoxicity and more abundant IFNgamma secretion than CD4+CD56- T cells.33 Thus, CD4+ T cells like NT4.2 may have an important role in the pathogenesis of immune-mediated AA. Further study of many untransfused patients with cyclosporine-dependent AA will help clarify the role of CD4+ T cells capable of killing auto hematopoietic cells in an HLA-DR-restricted manner.

    FOOTNOTES

   Submitted September 3, 1996; accepted December 29, 1996.
   Supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science and Culture (06671080), Japan; by a Grant-in-Aid for Intractable Haemopoietic Disease Research from the Ministry of Health and Welfare, Japan; and by the Mochida Memorial Foundation for Medical and Pharmaceutical Research.
   Address reprint requests to Shinji Nakao, MD, Third Department of Medicine, Kanazawa University School of Medicine, 13-1 Takaramachi, Kanazawa, Ishikawa 920, Japan.

   The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hearly marked ``advertisment'' in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

    REFERENCES
Abstract
Introduction
Methods
Results
Discussion
References

1. Mathe G, Amiel JL, Schwarzenberg L, Choay J, Trolard P, Schneider M, Hayat M, Schlumberger JR, Jasmin C: Bone marrow graft in man after conditioning by antilymphocytic serum. Br Med J 2:131, 1970

2. Young NS: Pathophysiology II: Immune suppression of hematopoiesis, in Young NS, Alter BP (Eds): Aplastic Anemia Acquired and Inherited. Philadelphia, PA, Saunders, 1994, p 68

3. Bacigalupo A, Broccia G, Corda G, Arcese W, Carotenuto M, Gallamini A, Locatelli F, Mori PG, Saracco P, Todeschini G, Cosar P, Lacopino P, van Lint MT, Gluckman E for the European Group for Blood and Marrow Transplantation (EBMT) Working Party on SAA: Antilymphocyte globulin, cyclosporin, and granulocyte colony-stimulating factor in patients with acquired severe aplastic anemia (SAA): A pilot study of the EBMT SAA Working Party. Blood 85:1348, 1995[Abstract/Free Full Text]

4. Rosenfeld SJ, Kimball J, Vining D, Young NS: Intensive immunosuppression with antithymocyte globulin and cyclosporine as treatment for severe acquired aplastic anemia. Blood 85:3058, 1995[Abstract/Free Full Text]

5. Kagan WA, Ascensao JA, Pahwa RN, Hansen JA, Goldstein G, Valera EB, Incefy GM, Moore MAS, and Good RA: Aplastic anemia: Presence in human bone marrow of cells that suppress myelopoiesis. Proc Natl Acad Sci USA 73:2890, 1976[Abstract/Free Full Text]

6. Hoffmann R, Zanjani E, Lutton JD, Zalusky R, Wasserman LR: Suppression of erythrocyte-colony formation by lymphocytes from patients with aplastic anemia. N Engl J Med 296:10, 1977[Abstract]

7. Zoumbos NC, Gascon P, Djeu JY, Young NS: Interferon is a mediator of hematopoietic suppression in aplastic anemia in vitro and possibly in vivo. Proc Natl Acad Sci USA 82:188, 1985[Abstract/Free Full Text]

8. Hinterberger W, Adolf G, Aichinger G, Dudczak R, Geissler K, Hocker P, Huber C, Kalhs P, Knapp W, Koller U, Lechner K, Volc-Platzer B: Further evidence for lymphokine overproduction in severe aplastic anemia. Blood 72:266, 1988[Abstract/Free Full Text]

9. Viale M, Merli A, Bacigalupo A: Analysis at the clonal level of T-cell phenotype and function in severe aplastic anemia patients. Blood 78:1268, 1991[Abstract/Free Full Text]

10. Zoumbos NC, Gascon P, Djeu JY, Trost SR, Young NS: Circulating activated suppressor T lymphocytes in aplastic anemia. N Engl J Med 312:257, 1985[Abstract]

11. Herrmann F, Griffin JD, Meuer SG, Meyer K-HzB: Establishment of an interleukin 2-dependent T cell line derived from a patient with severe aplastic anemia, which inhibits in vitro hematopoiesis. J Immunol 136:1629, 1986[Abstract]

12. Maciejewski JP, Hibbs JR, Anderson S, Katevas P, Young NS: Bone marrow and peripheral blood lymphocyte phenotype in patients with bone marrow failure. Exp Hematol 22:1102, 1994[Medline] [Order article via Infotrieve]

13. Nakao S, Yamaguchi M, Shiobara S, Yokoi T, Miyawaki T, Taniguchi T, Matsuda T: Interferon-gamma gene expression in unstimulated bone marrow mononuclear cells predicts a good response to cyclosporine therapy in aplastic anemia. Blood 79:2532, 1992[Abstract/Free Full Text]

14. Laver J, Castro MH, Kernan NA, Levick J, Evans RL, O'Reilly RJ, Moore MA: In vitro interferon-gamma production by cultured T-cells in severe aplastic anaemia: Correlation with granulomonopoietic inhibition in patients who respond to anti-thymocyte globulin. Br J Haematol 69:545, 1988[Medline] [Order article via Infotrieve]

15. Torok-Storb B, Johnson GG, Bowden R, Storb R: Gamma-interferon in aplastic anemia: Inability to detect significantly levels in sera or demonstrate hematopoietic suppressing activity. Blood 69:629, 1987[Abstract/Free Full Text]

16. De Berardinis P, Londei M, James RF, Lake SP, Wise PH, Feldmann M: CD4+ T-cell damage to islet beta cells. Lancet 1:823, 1989[Medline] [Order article via Infotrieve]

17. Kawakami Y, Eliyahu S, Delgado CH, Robbins PF, Rivoltini L, Topalian SL, Miki T, Rosenberg SA: Cloning of the gene coding for a shared human melanoma antigen recognized by autologous T cells infiltrating into tumor. Proc Natl Acad Sci USA 91:3515, 1994[Abstract/Free Full Text]

18. Moebius U, Herrmann F, Hercend T, Meuer SC: Clonal analysis of CD4+/CD8+ T cells in a patient with aplastic anemia. J Clin Invest 87:1567, 1991

19. Nakao S, Takamatsu H, Yachie A, Itoh T, Yamaguchi M, Ueda M, Shiobara S, Matsuda T: Establishment of a CD4+ T cell clone recognizing autologous hematopoietic progenitor cells from a patient with immune-mediated aplastic anemia. Exp Hematol 23:433, 1995[Medline] [Order article via Infotrieve]

20. Ota M, Seki T, Fukushima H, Tsuji K, Inoko H: HLA-DRB1 genotyping by modified PCR-RFLP method combined with group-specific primers. Tissue Antigens 39:187, 1992[Medline] [Order article via Infotrieve]

21. Tsuruta Y, Yoshioka T, Suzuki R, Sakata T: Analysis of the population of human T cell receptor gamma and delta chain variable region subfamilies by reverse dot blot hybridization. J Immunol Methods 169:17, 1994[Medline] [Order article via Infotrieve]

22. Lebrecque N, McGrath H, Subramanyam M, Huber BT, Sékaly R-P: Human T cells respond to mouse mammary tumor virus-encoded superantigens: Vbeta restriction and conserved evolutionary features. J Exp Med 177:1735, 1993[Abstract/Free Full Text]

23. Yamamoto K, Sakoda H, Nakajima T, Kato T, Okubo M, Dohi M, Mizushima Y, Ito K, Nishioka K: Accumulation of multiple T cell clonotypes in the synovial lesions of patients with rheumatoid arthritis revealed by a novel clonality analysis. Int Immunol 4:1219, 1992[Abstract/Free Full Text]

24. Erb P, Grogg D, Troxler M, Kennedy M, Fluri M: CD4+ T cell-mediated killing of MHC class II-positive antigen-presenting cells. I. Characterization of target cell recognition by in vivo or in vitro activated CD4+ killer T cells. J Immunol 144:790, 1990[Abstract]

25. Bernhard H, Disis ML, Heimfeld S, Hand S, Gralow JR, Cheever MA: Generation of immunostimulatory dendritic cells from human CD34+ hematopoietic progenitor cells of the bone marrow and peripheral blood. Cancer Res 55:1099, 1995[Abstract/Free Full Text]

26. Yoshino I, Goedegebuure PS, Peoples GE, Lee KY, Eberlein TJ: Human tumor-infiltrating CD4+ T cells react to B cell lines expressing heat shock protein 70. J Immunol 153:4149, 1994[Abstract]

27. Gaston JSH, Life PF, Bailey LC, Bacon PA: In vitro responses to a 65-kilodalton mycobacterial protein by synovial T cells from inflammatory arthritis patients. J Immunol 143:2494, 1989[Abstract]

28. Pervin K, Childerstone A, Shinnick T, Mizushima Y, van dZR, Hasan A, Vaughan R, Lehner T: T cell epitope expression of mycobacterial and homologous human 65-kilodalton heat shock protein peptides in short term cell lines from patients with Behcet's disease. J Immunol 151:2273, 1993[Abstract]

29. Fleischer B: Acquisition of specific cytotoxic activity by human T4+ T lymphocytes in culture. Nature 308:365, 1984[Medline] [Order article via Infotrieve]

30. Rosenkrantz K, Dupont B, William D, Flomenberg N: Autocytotoxic and autosuppressor T-cell lines generated from autologous lymphocyte cultures. Hum Immunol 19:189, 1987[Medline] [Order article via Infotrieve]

31. Emerson SG, Antin JH: Bone marrow progenitor cells induce a regulatory autologous proliferative T lymphocyte response. J Immunol 142:766, 1989[Abstract]

32. Hess AD, Horwitz L, Beschorner WE, Santos GW: Development of graft vs. host disease-like syndrome in cyclosporine-treated rats after syngeneic bone marrow transplantation. I. Development of cytotoxic T lymphocytes with apparent polyclonal anti-Ia specificity, including autoreactivity. J Exp Med 161:718, 1985[Abstract/Free Full Text]

33. Barnaba V, Franco A, Paroli M, Benvenuto R, De PG Burgio VL, Santilio I, Balsano C, Bonavita MS, Cappelli G, Colizzi V, Cutrona G, Ferrarini M: Selective expansion of cytotoxic T lymphocytes with a CD4+CD56+ surface phenotype and a T helper type 1 profile of cytokine secretion in the liver of patients chronically infected with Hepatitis B virus. J Immunol 152:3074, 1994[Abstract]

34. Nakao S, Takamatsu H, Chuhjo T, Ueda M, Shiobara S, Matsuda T, Kaneshige T, Mizoguchi H: Identification of a specific HLA class II haplotype strongly associated with susceptibility to cyclosporine-dependent aplastic anemia. Blood 84:4257, 1994[Abstract/Free Full Text]

35. Hashimoto M, Kinoshita T, Yamasaki M, Tanaka H, Imanishi T, Ihara H, Ichikawa Y, Fukunishi T: Gene frequencies and haplotypic associations within the HLA region in 916 unrelated Japanese individuals. Tissue Antigens 44:166, 1994[Medline] [Order article via Infotrieve]

36. Nishimura Y, Thorsby E, Rønningen KS, Nelson LJ, Hansen JA, Bias WB, Fauchet R, Dawkins RL, TIIlikainen A, Salvaneschi L, Martinetti M, Cuccia M, Vaughan RW, Hall M, Boehm BO, Juji T, Ohno S, Farid NR, Bodmer JG, Skamene E, Marsh DG, Svejgaard A, Thomsen AC, Sasazuki T: General organization and overview of the disease component. HLA 1991, Proceedings of the 11th International Histocompatibility Workshop. London, UK, Oxford, 1992, p 693

37. Yasukawa M, Inatsuki A, Kobayashi Y: Helper activity in antigen-specific antibody production mediated by CD4+ human cytotoxic T cell clones directed against herpes simplex virus. J Immunol 140:3419, 1988[Abstract]

38. Takahashi T, Chapman PB, Yang SY, Hara I, Vijayasaradhi S, Houghton AN: Reactivity of autologous CD4+ T lymphocytes against human melanoma. Evidence for a shared melanoma antigen presented by HLA-DR15. J Immunol 154:772, 1995[Abstract]

39. Sprent J, Surh CD, Agus D, Hurd M, Sutton S, Heath WR: Profound atrophy of the bone marrow reflecting major histocompatibility complex class II-restricted destruction of stem cells by CD4+ cells. J Exp Med 180:307, 1994[Abstract/Free Full Text]

40. Bacigalupo A, Podesta M, Mingari MC, Moretta L, van Lint MT, Marmont A: Immune suppression of hematopoiesis in aplastic anemia: Activity of T8 lymphocytes. J Immunol 125:1449, 1980[Abstract]

41. Nakao S, Harada M, Kondo K, Odaka K, Ueda M, Matsue K, Mori T, Hattori K: Effect of activated lymphocytes on the regulation of hematopoiesis: Suppression of in vitro granulopoiesis by OKT8+Ia+T cells induced by alloantigen stimulation. J Immunol 132:160, 1984[Abstract]

42. Harada M, Nakao S, Kondo K, Odaka K, Ueda M, Shiobara S, Mori T, Matsuda T: Role of activated lymphocytes in the regulation of hematopoiesis: Effect of autoreactive T cells on in vitro BFU-E growth. Blood 67:1143, 1986[Abstract/Free Full Text]

43. Melenhorst IJ, van Kreiken JHJM, Dreef E, Landegent JE, Willemze R, Fibbe WE: T-cell infiltration in bone marrow areas of residual hematopoiesis of patients with aplastic anemia. Blood 86:477a, 1995 (abstr, suppl 1)


© 1997 by The American Society of Hematology.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
H. Takamatsu, J. L. Espinoza, X. Lu, Z. Qi, K. Okawa, and S. Nakao
Anti-Moesin Antibodies in the Serum of Patients with Aplastic Anemia Stimulate Peripheral Blood Mononuclear Cells to Secrete TNF-{alpha} and IFN-{gamma}
J. Immunol., January 1, 2009; 182(1): 703 - 710.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. W. Wlodarski, L. P. Gondek, Z. P. Nearman, M. Plasilova, M. Kalaycio, E. D. Hsi, and J. P. Maciejewski
Molecular strategies for detection and quantitation of clonal cytotoxic T-cell responses in aplastic anemia and myelodysplastic syndrome
Blood, October 15, 2006; 108(8): 2632 - 2641.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
W. Fureder, M.-T. Krauth, W. R. Sperr, K. Sonneck, I. Simonitsch-Klupp, L. Mullauer, M. Willmann, H.-P. Horny, and P. Valent
Evaluation of Angiogenesis and Vascular Endothelial Growth Factor Expression in the Bone Marrow of Patients with Aplastic Anemia
Am. J. Pathol., January 1, 2006; 168(1): 123 - 130.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
W. Zeng, A. Miyazato, G. Chen, S. Kajigaya, N. S. Young, and J. P. Maciejewski
Interferon-{gamma}-induced gene expression in CD34 cells: identification of pathologic cytokine-specific signature profiles
Blood, January 1, 2006; 107(1): 167 - 175.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
X. Feng, T. Chuhjo, C. Sugimori, T. Kotani, X. Lu, A. Takami, H. Takamatsu, H. Yamazaki, and S. Nakao
Diazepam-binding inhibitor-related protein 1: a candidate autoantigen in acquired aplastic anemia patients harboring a minor population of paroxysmal nocturnal hemoglobinuria-type cells
Blood, October 15, 2004; 104(8): 2425 - 2431.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
W. Zeng, G. Chen, S. Kajigaya, O. Nunez, A. Charrow, E. M. Billings, and N. S. Young
Gene expression profiling in CD34 cells to identify differences between aplastic anemia patients and healthy volunteers
Blood, January 1, 2004; 103(1): 325 - 332.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. Hirano, M. O. Butler, M. S. von Bergwelt-Baildon, B. Maecker, J. L. Schultze, K. C. O'Connor, P. H. Schur, S. Kojima, E. C. Guinan, and L. M. Nadler
Autoantibodies frequently detected in patients with aplastic anemia
Blood, December 15, 2003; 102(13): 4567 - 4575.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Murakami, H. Kosaka, Y. Maeda, J.-i. Nishimura, N. Inoue, K. Ohishi, M. Okabe, J. Takeda, and T. Kinoshita
Inefficient response of T lymphocytes to glycosylphosphatidylinositol anchor-negative cells: implications for paroxysmal nocturnal hemoglobinuria
Blood, December 1, 2002; 100(12): 4116 - 4122.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. M. Risitano, H. Kook, W. Zeng, G. Chen, N. S. Young, and J. P. Maciejewski
Oligoclonal and polyclonal CD4 and CD8 lymphocytes in aplastic anemia and paroxysmal nocturnal hemoglobinuria measured by Vbeta CDR3 spectratyping and flow cytometry
Blood, June 17, 2002; 100(1): 178 - 183.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Kook, A. M. Risitano, W. Zeng, M. Wlodarski, C. Lottemann, R. Nakamura, J. Barrett, N. S. Young, and J. P. Maciejewski
Changes in T-cell receptor VB repertoire in aplastic anemia: effects of different immunosuppressive regimens
Blood, May 15, 2002; 99(10): 3668 - 3675.
[Abstract] [Full Text] [PDF]


Home page
ANN INTERN MEDHome page
R. A. Brodsky, L. L. Sensenbrenner, B. D. Smith, D. Dorr, P. J. Seaman, S. M. Lee, J. E. Karp, I. Brodsky, and R. J. Jones
Durable Treatment-Free Remission after High-Dose Cyclophosphamide Therapy for Previously Untreated Severe Aplastic Anemia
Ann Intern Med, October 2, 2001; 135(7): 477 - 483.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Miura, C. J. Thoburn, E. C. Bright, M. Sommer, S. Lefell, M. Ueda, S. Nakao, and A. D. Hess
Characterization of the T-cell repertoire in autologous graft-versus-host disease (GVHD): evidence for the involvement of antigen-driven T-cell response in the development of autologous GVHD
Blood, August 1, 2001; 98(3): 868 - 876.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
W. Zeng, S. Nakao, H. Takamatsu, A. Yachie, A. Takami, Y. Kondo, N. Sugimori, H. Yamazaki, Y. Miura, S. Shiobara, et al.
Characterization of T-Cell Repertoire of the Bone Marrow in Immune-Mediated Aplastic Anemia: Evidence for the Involvement of Antigen-Driven T-Cell Response in Cyclosporine-Dependent Aplastic Anemia
Blood, May 1, 1999; 93(9): 3008 - 3016.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. Hasegawa, S. Kojima, E. Tatsumi, A. Hayakawa, Y. Kosaka, H. Nakamura, M. Sako, Y. Osugi, S. Nagata, and K. Sano
Elevation of the Serum Fas Ligand in Patients With Hemophagocytic Syndrome and Diamond-Blackfan Anemia
Blood, April 15, 1998; 91(8): 2793 - 2799.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nakao, S.
Right arrow Articles by Matsuda, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nakao, S.
Right arrow Articles by Matsuda, T.
Related Collections
Right arrow Immunobiology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1997 by American Society of Hematology         Online ISSN: 1528-0020