|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 89 No. 3 (February 1), 1997:
pp. 1027-1034
Characterization of a New Alloantigen (SH) on the Human Neutrophil Fc receptor IIIb
By
Juergen Bux,
Ernst-Ludwig Stein,
Philippe Bierling,
Patricia Fromont,
Mary Clay,
David Stroncek, and
Sentot Santoso
From the Institute for Clinical Immunology and Transfusion Medicine, Justus Liebig University, Giessen, Germany; the Department of Transfusion Medicine, Créteil, France; and the Department of Laboratory Medicine and Pathology, University of Minnesota Medical School, Minneapolis.
 |
ABSTRACT |
Polymorphic structures of the neutrophil Fc receptor IIIb (Fc RIIIb) result in alloantibody formation that causes alloimmune neonatal neutropenia and transfusion reactions. Alloantigens located on Fc RIIIb include the antigens NA1 and NA2. In four cases of alloimmune neonatal neutropenia, granulocyte-specific alloantibodies directed against a thus far unknown antigen were detected by granulocyte agglutination and immunofluorescence tests in the maternal sera. By the use of the monoclonal antibody-specific immobilization of granulocyte antigens (MAIGA) assay, the new antigen, termed SH, was located on the Fc RIIIb. Nucleotide sequence analysis of the Fc RIIIb coding region from a SH(+) individual showed a single-base C A mutation at position 266, which results in an Ala78Asp amino acid substitution. A family study confirmed that this nucleotide difference is inherited, and corresponds to the SH phenotype. Serologic typing of 309 randomly selected individuals showed an antigen frequency of 5% in the white population. The same frequency was found by genotyping, for which a technique based on polymerase chain reaction (PCR) using sequence-specific primers (PCR-SSP) was developed. Typing of all SH(+) individuals for NA1 and NA2, and PCR-restriction fragment length polymorphism analysis of the NA-specific PCR products from five SH(+) individuals using the SH-specific endonuclease SfaN I showed that SH antigen is very probably the result of an additional mutational event in the NA2 form of the Fc RIIIB gene. Immunochemical studies also demonstrated that the SH determinants reside on the 65- to 80-kD NA2 isoform of the Fc RIIIb. Our findings show the existence of an additional polymorphism of the Fc RIIIb, which can result in alloantibody formation causing alloimmune neonatal neutropenia.
 |
INTRODUCTION |
THE NEUTROPHIL Fc receptor IIIb (Fc RIIIb = CD16) is a low-affinity receptor for the Fc region of complexed, but not monomeric IgG antibodies. Fc RIIIb preferentially removes small immune complexes from the circulation.1 The Fc RIIIb is released from the neutrophil membrane during apoptosis, ie, programmed cell death,2 and soluble Fc RIIIb can inhibit proliferation and immunoglobulin production of stimulated B lymphocytes.3
Biochemical characterization has identified the Fc RIIIb as an extensively glycosylated glycosylphosphatidylinositol (GPI)-anchored glycoprotein with two extracellular regions composed of disulfide bonds.4,5 The gene for the Fc RIIIb is mapped to the long arm of chromosome 1 (band q22) and belongs to the immunoglobulin superfamily.6
In addition to the functional significance of the Fc RIIIb, immunologic studies have shown that Fc RIIIb is polymorphic, bearing the important neutrophil-specific NA1 and NA2 alloantigens.7 The NA antigens are involved in alloimmune neonatal neutropenia, autoimmune neutropenia, and transfusion-related acute lung injury.8-10 The NA isoforms of the Fc RIIIb differ in their relative molecular weight: 50 to 65 kD for Fc RIIIbNA1 versus 65 to 80 kD for Fc RIIIbNA2.11 The different molecular weights have been attributed to different glycosylation patterns12,13: two more N-linked glycosylation sites in the NA2 than in the NA1 isoform. The additional glycosylation sites result from two of the four amino acid differences between the NA isoforms. On the DNA level, the NA1 and NA2 alleles differ in five nucleotides, one of which is a silent mutation.12,13 Approximately 0.1% of the European population does not express the Fc RIIIb on their neutrophils, and as a consequence do not display the NA1 and NA2 antigens.14 This phenotype is called NA-null and is caused by a Fc RIIIB gene deficiency.15
In this study, we characterized the biochemical and molecular basis of a thus far unknown polymorphism of Fc RIIIb that has been identified by granulocyte-specific alloantibodies in the maternal sera from four cases of alloimmune neonatal neutropenia. This disease is caused by placental transfer of maternal granulocyte alloantibodies to the fetus during pregnancy.
 |
CASE REPORTS |
Case report no. 1.
This case has been reported elsewhere,16 but in brief, a 34-year-old woman gave birth to a full-term baby boy. The mother had two prior pregnancies and one other child. The pregnancy and delivery were uncomplicated, but on the fourth day of life, the baby developed erythema around the umbilicus and at the site of circumcision. His white blood cell count was 6.9 × 109/L with 2% bands and 1% polymorphonuclear cells. The child was treated with antibiotics and he was given a single dose of intravenous immunoglobulin. His absolute neutrophil count increased to 2.72 × 109/L and the infection resolved. However, 2 weeks later his neutrophil count decreased to 0.92 × 109/L, but returned to normal 2 weeks later.
Case report no. 2.
The healthy mother had eight previous pregnancies and three other children alive. At 31 weeks of gestation, she gave birth to a neonate with a body weight of 1,680 g. The neonate suffered from immediate severe respiratory distress. The neutrophil count at birth was 0.6 × 109/L (white blood cell count, 2.3 × 109/L); red blood cell and platelet counts were normal. Bone marrow examination showed no abnormalities. The neutrophil count decreased to less than 0.2 × 109/L and the neonate suffered from pulmonary infections. Severe neutropenia persisted until the child died as a result of a cerebral hemorrhage 19 days after birth.
Case report no. 3.
The healthy mother had two previous in utero fetal deaths due to abruptio placentae and one spontaneous abortion. The child was delivered by cesarean section at the 34th week of pregnancy. Moderate respiratory distress made mechanical ventilation necessary for 4 days. Blood counts performed on days 1 and 3 of life showed severe neutropenia (<0.1 × 109/L). After treatment with high-dose intravenous immunoglobulin on the third day of life, the neutrophil count increased to 6 × 109/L and neutropenia did not reappear again.
Case report no. 4.
The healthy mother had one other child who had no history of neonatal neutropenia or infection. Delivery of the baby was at term. On day 4 of life, the baby developed staphylodermia. The white blood cell count was 6 × 109/L, but no neutrophils were detectable. Red blood cell and platelet counts were normal. Bone marrow examination showed only a slight decrease of mature neutrophils. Despite prophylactic treatment with antibiotics, additional infections such as dermatitis, parotitis, lymphadenitis, and otitis media occurred, which resolved after 1 month, when the neutrophil count had increased.
 |
MATERIALS AND METHODS |
Sera.
The sera analyzed in this study were from the four mothers described in the reported cases. The sera were numbered 1 to 4 according to the case report numbers. Antigen characterization was performed using serum no. 1.
Human NA-specific typing sera and Fc RIIIb-specific isoantibodies were obtained from immunized mothers of other cases of alloimmune neonatal neutropenia and from an immunized individual with Fc RIIIb deficiency (NA-null), respectively.
Granulocyte antibody screening.
Granulocyte immunofluorescence (GIFT) and agglutination (GAT) tests were performed as follows. Granulocytes were isolated from heparin- (GIFT) or EDTA- (GAT) anticoagulated blood of healthy donors. After dextran sedimentation, granulocytes were isolated from the supernatant leukocyte-rich plasma by Ficoll-Hypaque gradient centrifugation and red blood cells were lysed with ammonium chloride solution. For GIFT, neutrophils were fixed with 1% paraformaldehyde and incubated for 30 minutes at 37°C with the sera to be tested in microtiter plates. After washing, the cells were incubated with fluorescein isothiocyanate (FITC)-labeled rabbit F(ab')2-antihuman IgG (light plus heavy chain) (Dako, Hamburg, Germany), rewashed, and evaluated with a fluorescence microscope. The GAT assay was performed in Terasaki trays. Two microliters of granulocytes was incubated under oil with 2 µL of serum for 120 minutes at 37°C and then read microscopically.
To exclude HLA- or other lymphocyte-reactive antibodies, serum no. 1 was also tested against lymphocytes obtained from the granulocyte donors in a lymphocytotoxicity test (LCT) and lymphocyte immunofluorescence test (LIFT). The lymphocytes were isolated by density gradient centrifugation and the LCT was performed according to National Institutes of Health standards. The LIFT was performed according to the GIFT, but lymphocytes were used instead of granulocytes.
Phenotyping of granulocytes and antigen location.
NA and SH phenoytpings were performed by GIFT and GAT and the antigen-specific monoclonal antibody (MoAb)-specific immobilization of granulocyte antigens (MAIGA) assay17 using human NA-specific typing sera and serum no. 1. The MAIGA assay was also used for antigen location. Briefly, 1 × 106 neutrophils from one individual fixed with 1% paraformaldehyde were incubated (30 minutes, 37°C) with human serum and MoAbs. In different reaction mixtures, we used the MoAbs 3G8 (Immunotech, Hamburg, Germany) and Bw 209/2 (Behringwerke, Marburg, Germany), which are specific for the Fc RIII (CD16), and the MoAbs 2E1, Bear 1, BL5, and J3D3 (Immunotech), which are specific for the Fc RII (CD32), the subunits of the leukocyte adhesion molecule CD11b/CD18 and the C3b complement receptor I (CR1, CD35). The cells were washed and solubilized by adding 100 µL of lysis buffer (1% Triton-X 100, 5 mmol/L EDTA, 2 mmol/L phenylmethylsulfonyl fluoride [PMSF], 0.5 µg/mL leupeptin, 500 kallikrein inactivating units (KIE)/mL aprotinin in 20 mmol/L Tris-buffered saline, pH 7.4) for 30 minutes at room temperature. After sonication (2 minutes) and centrifugation at 15,000g for 30 minutes, the supernatant of each reaction mixture was transferred to a separate tube coated with goat antimouse antibodies. Unattached antibodies were removed by washing, and goat antihuman IgG (heavy plus light chain) antibodies conjugated with peroxidase were added. After washing and subsequent addition of a substrate containing luminol, hydrogen peroxide, and 4-iodophenol, the emitted light (chemiluminescence) was measured over a period of 15 minutes in a luminometer (Lumat LB 9501, Berthold, Wildbad, Germany).
Immunochemical studies.
These studies were performed by (lumino-)immunopreciptation and immunblot. For luminoimmunoprecipitation, unfixed granulocytes (1 × 108/mL in phosphate-buffered saline [PBS]) were biotinylated with 5 mmol/L of a water-soluble biotin analog with an extended spacer arm (NHS-LC-Biotin; Pierce, Rockford, IL) for 30 minutes on ice. After washing, to each 100 µL of cell suspension (1 × 107/mL in PBS), 100 µL of serum or MoAb solution (0.01 mg/mL) was added and incubated for 30 minutes at 37°C. The cells were washed and solubilized by adding 250 µL of lysis buffer (see MAIGA assay) for 30 minutes at room temperature. After sonication (3 minutes) and centrifugation at 15,000g for 30 minutes, the supernatants were incubated with rabbit antihuman IgG or antimouse immunoglobulin (Dako) antibodies coupled to Protein A-Sepharose 4B (Pharmacia, Freiburg, Germany) for 2 hours at room temperature. To couple the antibodies to the beads, 50 µL of Protein A-Sepharose CL-4B was preincubated with 50 µL rabbit antimouse immunoglobulin or antihuman IgG in 200 µL Tris-buffered saline, pH 8.0, for 45 minutes at room temperature. The Protein A-Sepharose CL-4B beads were then washed and resuspended in sodium dodecyl sulfate polyacrylamide gel electropheresis (SDS-PAGE) sample buffer, boiled for 3 minutes, and then subjected to 10% SDS-PAGE. After electropheresis, proteins were transferred onto nitrocellulose (Hibond C; Amersham, Little Chalfont, UK; 50 V for 6 hours using Tris/glycine transfer buffer). For visualization, the nitrocellulose was first blocked with 1.5% bovine serum albumin (BSA) and 0.05% Tween-20 in Tris-buffered saline (TBS) and then incubated with streptavidin conjugated to peroxidase. Unbound streptavidin was washed out, and the nitrocellulose was incubated with a chemiluminescent substrate (ECL Western Blotting Detection System; Amersham) and then exposed to x-ray films for 0.5 to 4 minutes.
For luminoimmunoblotting, 5 × 107 unfixed granulocytes were solubilized with 500 µL lysis buffer (see MAIGA assay). The lysate was then centrifuged (30 minutes, 15,000g) and the supernatant analyzed by SDS-PAGE and transferred to a nitrocellulose membrane. Membrane strips were blocked with 1.5% BSA and then incubated with diluted serum samples (1:20 to 1:200). The strips were washed with Tris-buffered saline pH 7.4 containing 0.05% Tween 20 and then incubated with peroxidase-conjugated rabbit antihuman antibodies (dilution, 1:200,000). After another washing step, a chemiluminescent substrate (ECL) was added for 0.5 to 4 minutes and the recognized antigens visualized on x-ray film.
Isolation and amplification of granulocyte mRNA.
Granulocyte mRNA was isolated from EDTA-anticoagulated blood of NA- and SH-phenotyped donors as previously described.18 Ten-microliter aliquots of granulocyte mRNA were heated to 68°C for 10 minutes and quickly cooled on ice before reverse transcription. cDNA was then synthesized using 10 µmol/L oligo dT, 40 U RNAsin (Boehringer Mannheim, Mannheim, Germany), 2 mmol/L of each dNTP (Pharmacia), 500 U of cloned Moloney murine leukemia virus reverse transcriptase, and 5x enzyme buffer (GIBCO-BRL, Eggenstein, Germany) in a total volume of 30 µL. cDNA synthesis was performed at 40°C for 45 minutes and was stopped by chilling to 0°C.
The Fc RIIIB-specific primers used to amplify the entire coding region of the granulocyte Fc RIIIB based on the published sequence and numbering system of Ravetch and Perussia.13 Three microliters of cDNA was mixed with 5 µL of 10× polymerase chain reaction (PCR) buffer, 0.5 µmol/L of sense primer no. 1 (5'-1TCTTTGGTGACTTGTCCA18-3') and 0.5 µmol/L of antisense primer no. 2 (5'-831GCCACTGCTCTTATTACT814-3'), 200 µmol/L of each dNTP, 0.2 mg/mL BSA, 4 mmol/L MgSO4, and 1 U of Deep-Vent DNA polymerase (New England Biolabs, Schwalbach, Germany), and were amplified on a DNA thermal cycler (Biometra, Göttingen, Germany) for 35 cycles. Each cycle consisted of denaturation at 97°C for 20 seconds, annealing at 52°C for 40 seconds, and primer extension at 72°C for 90 seconds. Five microliters of the PCR products (dilution 1:10) was amplified again for 39 cycles using nested primer pair no. 3 and no. 4 (5'-41AGCTGCTCCTCCCAACTG58-3' and 5'-393CTCCTTGAACACCCACCG376-3') or primer pair no. 5 and no. 6 (5'-309CCTCTCCACCCTCAGTGA326-3' and 5'-655GGTACCCAGGTGGAGAGA638-3') under the following conditions: denaturation at 95°C for 30 seconds, annealing at 57°C for 50 seconds, and primer extension at 73°C for 50 seconds. In the final cycle, the samples were kept at a temperature of 72°C for 10 minutes and then chilled to 4°C.
Analysis of PCR products.
Five microliters of the PCR products was analyzed on 1.5% agarose gel containing ethidium bromide. The amplified DNA was isolated from the gel, purified by Geneclean (Dianova, Hamburg, Germany), flushed using Klenow DNA polymerase, and finally subcloned into the EcoRV site of the pGEM5 plasmid (GIBCO-BRL). Plasmid from positive clones was sequenced by the dideoxy chain termination reaction method using Sequenase 2.0 (United States Biochemical, Braunschweig, Germany).
In some cases, amplified cDNA was subjected to RFLP analysis using SfaN I endonuclease (New England Biolabs) and analyzed on Separide gel (GIBCO-BRL).
Genotyping by PCR with sequence-specific primers.
For genotyping of NA antigens, a slightly modified PCR with sequence-specific primers (PCR-SSP) technique was used as previously described.19 Briefly, genomic DNA isolated from EDTA-anticoagulated blood was amplified by PCR using a thermal cycler with 2 U Taq DNA polymerase. The PCR reaction consists of 30 cycles (denaturation: 98°C/30 seconds; annealing: 57°C/1 minute; extension: 71°C/30 seconds; final extension: 71°C/5 minutes). The NA-specific primers were designed as sense primers and were situated at position 208 to 227 for NA1 and at position 130 to 147 for NA2. To enhance the specificity of the NA1 primer, at position 4 from the 3' end the correct nucleotide A was substituted by a T. The nonspecific antisense primer is situated at position 331 to 348. As internal positive PCR control, two primers (HGH-I and HGH-II, see below) amplifying a 439-bp fragment of the human growth hormone gene (HGH) were used. After electropheresis in 1.6% agarose gel and staining with ethidium bromide, the PCR products were visualized by UV illumination and photographed.
Genotyping of the SH antigen.
2.5 microliters of genomic DNA was amplified in a total volume of 22.5 µL using 0.5 µmol/L SH(+) sequence-specific antisense primer no. 7 (5'-285ACTGTCGTTGACTGTGTCAT 266-3') or the antithetical SH(-) sequence-specific antisense primer no. 8 (5'-285ACTGTCGTTGACTGTGTCAG266-3'), 0.5 µmol/L sense primer no. 9 (5'-95AAGATCTCCCAAAGGCTGTG115-3'), 200 µmol/L of each dNTP, 2.25 µL 10× PCR buffer, and 0.8 U Taq polymerase on a DNA thermal cycler (Perkin Elmer, Weiterstadt, Germany) for 30 cycles. To enhance the specificity of the primers, the correct nucleotide G at position 269 was substituted by a T. Coamplification of the HGH gene using 0.125 µmol/L HGH I primer (5'-CAGTGCCTTCCCAACCATTCCCTTA-3') and 0.125 µmol/L HGH II primer (5'-ATCCACTCACGGATTTCTGTTGTGTTTC-3') was run as internal control. Each cycle consisted of denaturation at 95°C for 30 seconds, annealing at 60°C for 1 minute, and primer extension at 71°C for 30 seconds.
 |
RESULTS |
Antibody screening in serum no. 1.
Serum no. 1 has been reported to contain an alloantibody that is exclusively detectable by GIFT and is directed against the leukocyte antigen SL, which was found to be expressed on lymphocytes and neutrophils with a frequency of 66%.16 Since positive reactions in the GAT with few donor neutrophils have also been reported, we again screened serum no. 1 in GAT against a panel of eight granulocytes typed for the alloantigens NA1, NA2, NB1, MART, and 5b. The serum reacted with the neutrophils from one (donor no. 1 in Table 1) of the eight donors. The pattern of reaction did not correlate with any antigen for which the panel cells were typed. Negative results of serum no. 1 in LIFT and LCT using the cells of donor no. 1 excluded that the positive reaction in GAT was due to HLA or other lymphocyte-reactive antibodies such as anti-SL. Testing of the serum with neutrophils from 12 additional individuals in GAT was also negative. These results indicated that the serum no. 1 contained in addition to anti-SL a granulocyte-specific alloantibody directed against a new low-frequency antigen, which was termed SH.
Antigen identification.
To locate the antigen recognized by the SH antibody, we tested its binding to the isolated glycoproteins of the granulocytes from donor no. 1 in the MAIGA assay (Fig 1). The SH antibody only reacted with the Fc RIIIb (CD16), but not with the Fc RII (CD32), the subunits of the leukocyte adhesion molecule CD11b/CD18 and the C3b complement receptor CR1 (CD35). These results demonstrated that the SH alloantigen resides on the Fc RIIIb.

View larger version (24K):
[in this window]
[in a new window]
| Fig 1.
Detection of SH on the Fc RIIIb using the MAIGA assay. Neutrophils from a SH(+) donor were tested with the anti-SH-containing serum no. 1 for antibodies to Fc RIIIb, Fc RII, the subunits of the leukocyte adhesion molecule CD11b/CD18, and the C3b complement receptor CR1 (CD35).
|
|
Analysis of the Fc RIIIB mRNA from SH(+) and SH(-) individuals.
To elucidate the molecular basis of SH, we analyzed the nucleotide sequence of the entire coding region of the Fc RIIIB. Granulocyte mRNA was sequentially amplified by reverse-transcription PCR (RT-PCR) using three sets of primers. After Fc RIIIB cDNA amplification in the primary PCR with primers no. 1 and no. 2, secondary PCRs were performed (Fig 2) using either nested primers no. 3 and no. 4 or primers no. 5 and no. 6 to amplify overlapping regions encompassing nucleotides 41 to 393 (353 bp) and nucleotides 309 to 655 (347 bp), respectively. Both PCR products were subcloned and sequenced.

View larger version (9K):
[in this window]
[in a new window]

View larger version (64K):
[in this window]
[in a new window]
| Fig 2.
PCR amplification of nucleotides 41 to 393 (lanes 3 and 6) and 309 to 655 (lanes 2 and 5) of neutrophil Fc RIIIB mRNA. The locations of the 2 primer pairs (arrows) used for PCR amplification of the expected 353- and 347-bp products after nested PCR are illustrated above. cDNA derived from a SH(-) (lanes 2 and 3) and a SH(+) individual (lanes 5 and 6) were amplified with primer pair no. 3 and no. 4 (lanes 3 and 6) or primer pair no. 5 and no. 6 (lanes 2 and 5) and analyzed on 1.5% agarose gel stained with ethidium bromide. PCR without template was run as negative control (lane 4). DNA size standards (pBr 328 DNA.BglI + pBr 328 DNA.HinfI) are shown in lane 1. The resulting 353-bp and 347-bp products from the SH(+) individual (lanes 5 and 6) were isolated from preparative gels and subcloned for nucleotide sequence analysis.
|
|
Comparison of the 353-bp nucleotide sequence of the mRNA derived from a SH(+) individual and a SH(-) individual (donors no. 1 and no. 6 in Table 1) showed a single nucleotide difference at base 266. The mRNA from the SH(+) individual had an A at this position (Fig 3), whereas that from the SH(-) individual had a C (data not shown). This change resulted in the substitution of an aspartic acid for an alanine at amino acid residue 78.

View larger version (27K):
[in this window]
[in a new window]
| Fig 3.
Nucleotide sequence analysis of amplified cDNA from an SH(+) individual. The region of the autoradiograph shown here includes the sequence from base 257 to 275. The nucleotide change from a C to an A (arrow) at position 266 in the SH(+) individual results in an alanine (GCT) to an aspartic acid (GAT) amino acid substitution at residue 78 of the Fc RIIIb polypeptide.
|
|
Analysis of the 353-bp insert obtained from four different clones from SH(+) donor no. 1 showed that the clones had either an A (two clones) or a C (two clones) at position 266, indicating that the SH-associated mutation was present only in one of the Fc RIIIB genes. In addition, all of these clones showed the nucleotides C, T, G, A, and A at the positions 141, 147, 227, 277, and 349, respectively corresponding to the NA1(-),NA2(+) phenotype of donor no. 1 (Table 1). No other nucleotide differences between the SH(+) versus SH(-) individuals were found in the 347-bp insert.
To confirm the C266A polymorphism, we amplified mRNA derived from three different SH(-) individuals and the SH(+) phenotyped donor no. 1 and analyzed the 353-bp products by RFLP using SfaN I endonuclease (Fig 4). Since SfaN I enzyme cleaves the 5'-GATGC-3' but not 5'-GCTGC-3' nucleotide sequences, restriction fragments (215 bp and 138 bp) were only obtained from the SH(+) donor no. 1 (lane 5), but not from the SH(-) individuals (lanes 2 through 4). The presence of an undigested 353-bp band in lane 5 was consistent with the observation that only one Fc RIIIB gene of donor no. 1 showed the SH mutation.

View larger version (80K):
[in this window]
[in a new window]
| Fig 4.
RFLP analysis of 353-bp PCR products from 3 SH(-) (lanes 2, 3, and 4) and one SH(+) (lane 5) phenotyped individuals using SfaN I endonuclease and 2% Separide gel stained with ethidium bromide. DNA size standards (PhiX174 RF DNA.HaeIII) are shown in lane 1.
|
|
Inheritance of SH.
To investigate whether the SH polymorphism was inherited from the parents of donor no. 1, her family members were phenotyped for SH using the MAIGA assay and genotyped by RFLP analysis using the SfaN I endonuclease. The neutrophils from her father and sister were typed SH(-), but the maternal cells were SH(+) (data not shown). These results showed that the SH antigen had been passed down from the mother to her daughter and that the presence of the mutation at 266 was associated with the SH phenotype.
Genotyping by PCR-SSP.
Since phenotyping requires a large number of freshly isolated neutrophils, we developed a technique based on PCR-SSP for genotyping of genomic DNA. We constructed the SH(+)-specific primer no. 7 with a T at the 3' end and the SH(-)-specific primer no. 8 with a G at the 3' end. As shown in Fig 5A, PCR-SSP with SH-specific primer no. 7 and genomic DNA from an SH(+) individual resulted in an SH-specific 191-bp PCR product (lane 2), whereas this primer failed to amplify genomic DNA from three SH(-) individuals (lanes 3 through 5). The 439-bp fragment of the HGH gene represents the internal PCR control. As shown in Fig 5B, the SH(-)-specific primer no. 8 amplified genomic DNA from all individuals, the SH(+) but heterozygous donor no. 1 (lane 2), and the three SH(-) individuals (lanes 3 through 5).

View larger version (43K):
[in this window]
[in a new window]
| Fig 5.
PCR-SSP analysis of 1 SH(+) (lane 2) and 3 SH(-) phenotyped individuals (lanes 3 to 5) using SH(+)-specific primer no. 7 (A) and SH(-)-specific primer no. 8 (B). The 191-bp bands represent the allele-specific PCR products and the HGH bands the internal controls. PCR products were analyzed on 1.5% agarose gel stained with ethidium bromide. DNA size standards (pBr 328 DNA.BglI + pBr 328 DNA.HinfI) are shown in lane 1. Only in donor 1 was a SH(+)-specific PCR product (A, lane 2) formed.
|
|
Four additional SH(+) individuals were found by genotyping of 107 unrelated blood donors. Neutrophils from these four donors were found to have the SH(+) phenotype using serum no. 1 in the MAIGA assay, suggesting an antigen frequency of approximately 4%. These results confirmed that the C266A polymorphism of the Fc RIIIB gene is associated with the expression of the SH antigen.
Relation between SH and NA2.
Since the Fc RIIIb shows the NA polymorphism, we investigated whether the SH-specific mutation is associated with the NA1- or NA2-specific nucleotide substitutions. For this, we used the fact that the SH-associated mutation site is located within the DNA segment that is amplified by our NA-specific primers in the PCR-SSP technique, and subjected the NA-specific PCR products from five SH(+) donors to RFLP analysis using the SH-specific endonuclease SfaN I.

View larger version (6K):
[in this window]
[in a new window]

View larger version (33K):
[in this window]
[in a new window]
| Fig 6.
Association of SH with NA2. (A) NA1(-) (lanes 2 to 4) and NA2(-) (lanes 5 to 7) specific PCR products before and, (B), after digestion with SfaN I. The locations of the NA-specific sense primers (NA1 pr., NA2 pr.) and the reverse primer (Reverse pr.) used for PCR amplification of the NA-specific DNA fragments, as well as the cleavage site of the SfaN I enzyme, are illustrated. Restriction fragments were analyzed on 1.5% agarose gel using DNA size standards pBr 328 DNA.BglI + pBr 328 DNA.HinfI (lane 1). Three individuals were tested who were typed as follows: SH(+), NA1(+),NA2(+) (lanes 2 and 5); SH(+), NA1(-),NA2(+) (lanes 3 and 6); SH(-), NA1(+),NA2 (+) (lanes 4 and 7).
|
|
Figure 6 shows the NA1- and NA2-specific PCR products from three individuals before (Fig 6A) and after endonuclease digestion (Fig 6B). To simplify RFLP analysis, NA-specific PCR-SSP was performed in the absence of the HGH internal control. Two individuals were SH(+) with NA phenotypes NA1(+),NA2(+) and NA1(-),NA2(+), and one individual SH(-), NA1(+),NA2(+). As expected, the NA2-specific, 219-bp product was obtained from all three donors (Fig 6A, lanes 5 through 7) and the NA1-specific, 141-bp product only from the NA1(+) individuals (lanes 2 and 4), but not from the NA1(-) donor (lane 3).
After digestion with SfaN I, the NA2-specific PCR products of the two SH(+) individuals were cut into the restriction fragments of 126 and 93 bp (Fig 6B, lanes 5 and 6), whereas their NA1-specific PCR products were not cleaved (Fig 6B, lanes 2 and 4). In addition, no digestion products were obtained from the NA2(+), but SH(-) individual (lane 7). The additional undigested NA2-specific product detected in the SH(+), NA1(-),NA2(+), individual (lane 6) is the result of the presence of the SH-specific mutation only in one of both Fc RIIIB genes.
The same results were obtained with the PCR products from three additional SH(+), NA1(+), NA2(+) individuals (data not shown). Table 1 summarizes typing and RFLP analysis results, which demonstrated that the SH-specific nucleotide substitution is associated with NA2.
Immunochemical studies confirmed the results of the RFLP analysis. Anti-SH precipitated the Fc RIIIb with a molecular weight of 64 to 88 kD from SH(+), NA1(+),NA2(+) typed neutrophils, which corresponds to the NA2 isoform (Fig 7, lane 3), whereas a human polyclonal isoantibody against Fc RIIIb precipitated both the NA1 and the NA2 Fc RIIIb isoforms with a molecular weight of 44 to 88 kD (lane 1).

View larger version (52K):
[in this window]
[in a new window]
| Fig 7.
Immunoprecipitation analysis of Fc RIIIb from a SH(+), NA1(+),NA2(+) individual using biotin-labeled granulocytes. After granulocytes were biotin-labeled and lysed, the Fc RIIIb was precipitated with a serum containing an isoantibody to Fc RIIIb (lane 1), a negative control serum (lane 2), and the SH-specific serum (lane 3). Immunoprecipitates were analyzed by 10% SDS-PAGE under nonreducing conditions, transferred onto nitrocellulose, and visualized using streptavidin-horseradish peroxidase and chemiluminescence substrate.
|
|
Three additional cases associated with SH alloimmunization.
After characterization of the SH antigen by the use of serum no. 1, anti-SH was also detected in the maternal sera of three other cases of alloimmune neonatal neutropenia (case reports no. 2, 3, and 4). Two sera, no. 2 and no. 4, contained additional NA1-specific alloantibodies, which is why the three sera were tested against a panel of 61 NA1(-),NA2(+) typed neutrophils. Of these cells, 50 were typed SH(-) and 11 SH(+) using serum no. 1 in GIFT and GAT for phenotyping and PCR-SSP for genotyping. All three sera reacted in the GAT with the 11 SH(+), but not with the SH(-) neutrophils. Antibody binding to the Fc RIIIb in the MAIGA assay could be shown in two of the three sera, indicating that not all SH alloantibodies are detectable by MAIGA, a fact which is well known for the detection of NA-specific alloantibodies by this assay.17
SH phenotype frequency.
Before SH alloantibody identification, the neutrophils from 309 randomly selected individuals had been tested with serum no. 3 in GAT and 14 of them had shown agglutination. We confirmed the SH(+) phenotype of the 14 neutrophils by SH genotyping of the donor DNA. The observed phenotype frequency of 5% is similar to the antigen frequency of 4% concluded from the genotyping findings in 107 individuals.
To check our finding that SH goes along with the NA2 phenotype, the 14 SH(+) individuals were typed for NA1 and NA2 and all were found to be NA2(+), 6 were NA1(-),NA2(+), and 8 were NA1(+),NA2(+).
 |
DISCUSSION |
The development of the MAIGA assay has vastly improved granulocyte serology. The assay has not only simplified the differentiation of multiple granulocyte-reactive antibodies in a single serum sample,17 but also the identification of the glycoprotein recognized by an antibody, as demonstrated by our detection of the SH antigen on the Fc RIIIb. Using this assay, the antigens LAN and SAR have found to be located on the Fc RIIIb, and the MART antigen on the subunit CD11b of the leukocyte adhesion molecule CD11b/CD18.20-22 The application of the MAIGA assay has also shown that the NC1 antigen is identical to NA2.23
In addition to the polymorphic sites, which are recognized by alloantibodies, the Fc RIIIb is also the target of autoantibodies17 and up to 23% of the autoantibodies show preferential binding to NA1(+) neutrophils.24 The high expression of the Fc RIIIb of about 200,000 copies per cell25 likely contributes to its high immunogenicity.
The elucidation of the molecular basis of SH allowed the development of a DNA-based technique using sequence (SH)-specific primers (PCR-SSP) for SH typing, which avoids cumbersome and time consuming isolation of fresh granulocytes required for serologic typing. We have already developed such a PCR-SSP method for NA typing, which has been successfully used in the Second International Granulocyte Serology Workshop. Others have described similar typing techniques for determination of platelet or HLA class II antigen genotypes.26,27
In contrast to the NA antigens, the SH antigen is associated with a single base mutation in the Fc RIIIB gene. The mutation leading to the SH polymorphism seems likely to be relatively recent. Since the nucleotide sequence of the SH allele is identical with the NA2 sequence, except for the nucleotide difference at the position 266, this mutation in the NA2 allele most likely occurred after the emergence of the NA allelism (Table 2). This hypothesis is in accordance with the low frequency of SH in the human gene pool since, in contrast to the white population, the NA1 gene is more frequent than NA2 in Chinese and Japanese populations (Table 2).19,28,29 Although on the molecular level the SH polymorphism is caused by a new allele in addition to NA1 and NA2 at the Fc RIIIb gene locus, for serologic reasons the Second International Granulocyte Serology Workshop group agreed to term the new antigen not in accordance with the N-terminology.
The C A mutation results in an amino acid substitution of alanine by aspartic acid. It is likely that the replacement of a neutral by an acidic amino acid directly changes the tertiary structure of the Fc RIIIb forming the SH alloantigen. The SH-associated Ala78Asp substitution is situated in the membrane distal domain of the Fc RIIIb, which also contains three of the five nucleotide substitution sites associated with the NA polymorphism. Two of these nucleotide substitutions result in amino acid substitutions (codon 65 and 82), which lead to two additional N-linked glycosylation sites in the NA2 isoform.12,13 Since the inner membrane proximal domain carries the IgG binding site30 and individuals with Fc RIIIb deficiency do not suffer from major infections or immune diseases,15 it is possible that other, still unknown, mutations in the Fc RIIIB gene, especially in the outer membrane distal domain, are conserved, which could cause polymorphism and alloimmunization. We do not know whether SH polymorphism has an influence on the impaired phagocytic function reported for the NA2 phenotype.31
Alloantibodies to the SH antigen were detected in the maternal sera from four cases of alloimmune neonatal neutropenia, indicating that SH alloimmunization is not a rare event. Three sera contained additional granulocyte-reactive alloantibodies, anti-NA1 (2×) and anti-SL, but one case was only associated with SH alloimmunization, demonstrating that SH alloantibodies can cause alloimmune neonatal neutropenia. Although an infrequent disease, alloimmune neonatal neutropenia can cause severe infections such as meningitis or pneumonia, especially when neutropenia is not recognized adequately early after birth.32
 |
FOOTNOTES |
Submitted February 25, 1996;
accepted September 25, 1996.
Supported by a grant from the Deutsche Forschungsgemeinschaft DFG Bu 770/3-2.
Address reprint requests to Juergen Bux, MD, Institute for Clinical Immunology and Transfusion Medicine, Justus Liebig University, Langhansstrasse 7, D-35385 Giessen, Germany.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hearly marked
``advertisment'' in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
 |
ACKNOWLEDGMENT |
We gratefully acknowledge the excellent technical support of Christine Hofmann. This work is part of an academic thesis (PhD) from Ernst-Ludwig Stein. We thank also the participants of the Second International Granulocyte Serology Workshop for their helpful comments concerning the nomenclature of new granulocyte antigens.
 |
REFERENCES |
1.
Huizinga TWJ,
Dolman KM,
van der Linden NJM,
Kleijer M,
Nuijens JH,
von dem Borne AEGKr,
Roos D:
Phosphatidylinositol-linked FcRIII mediates exocytosis of neutrophil granule proteins but does not mediate initiation of the respiratory burst.
J Immunol
144:1432,
1990[Abstract]
2.
Homburg CHE,
Haas M de,
von dem Borne AEGKr,
Verhoeven AJ,
Reutelingsperger CPM,
Roos D:
Human neutrophils lose their surface Fc RIII and acquire Annexin V binding sites during apoptosis in vitro.
Blood
85:532,
1995[Abstract/Free Full Text]
3.
Teillaud C,
Galon J,
Zilber M-T,
Matières N,
Spagnoli R,
Kurrle R,
Fridman WH,
Sautès C:
Soluble CD16 binds peripheral blood mononuclear cells and inhibits pokeweed-mitogen-induced responses.
Blood
82:3081,
1993[Abstract/Free Full Text]
4.
Ory PA,
Goldstein IM,
Kwoh EE,
Clarkson SB:
Characterization of polymorphic forms of Fc receptor III on human neutrophils.
J Clin Invest
83:1676,
1989
5.
Huizinga TWJ,
van der Schoot CE,
Jost C,
Klaassen R,
Kleijer M,
von dem Borne AEGKr,
Roos D,
Tetteroo PAT:
PI-linked FcRIII is released on stimulation of neutrophils.
Nature
333:667,
1988[Medline]
[Order article via Infotrieve]
6.
Qiu WQ,
de Bruin D,
Brownstein BH,
Pearse R,
Ravetch JV:
Organization of the human and mouse low-affinity Fc R genes: Duplication and recombination.
Science
248:732,
1990[Abstract/Free Full Text]
7. Werner G, von dem Borne AEGKr, Bos MJE, Tromp JF, van der Plas-van Dalen CM, Visser FJ, Engelfriet CP, Tetteroo PAT: Localization of the human NA1 alloantigen on neutrophil Fc receptors, in Reinherz EL, Haynes BF, Nadler LM, Bernstein ID (eds): Leucocyte Typing II, White Cell Differentiation Antigens, vol 3. New York, NY, Springer, 1989, p 109
8. Lalezari P, Nussbaum M, Gelman S, Spaet T: Neonatal neutropenia due to maternal isoimmunization. Blood 15:236, 1960.
9.
Lalezari P,
Jiang AF,
Yegen L,
Santorineou M:
Chronic autoimmune neutropenia due to anti-NA2 antibody.
N Engl J Med
293:744,
1975[Abstract]
10.
Yomtovian R,
Press C,
Engman H,
Kline W,
Clay M,
McCullough J:
Severe pulmonary hypersensitivity associated with passive transfusion of a neutrophil-specific antibody.
Lancet
1:244,
1984[Medline]
[Order article via Infotrieve]
11.
Huizinga TWA,
Kleijer M,
Tetteroo PAT,
Roos D,
von dem Borne AEGKr:
Biallelic neutrophil NA antigen system is associated with a polymorphism on the phosphoinositol-linked Fc receptor III (CD16).
Blood
75:213,
1990[Abstract/Free Full Text]
12.
Ory PA,
Clark MR,
Kwoh EE,
Clarkson SB,
Goldstein IM:
Sequences of complementary DNAs that encode the NA1 and NA2 forms of Fc receptor III on human neutrophils.
J Clin Invest
84:1688,
1989
13.
Ravetch JV,
Perussia B:
Alternative membrane forms of Fc RIII (CD16) on human natural killer cells and neutrophils.
J Exp Med
170:481,
1989[Abstract/Free Full Text]
14.
Fromont P,
Bettaieb A,
Skouri H,
Floch C,
Poulet E,
Duedari N,
Bierling P:
Frequency of the polymorphonuclear Fc receptor III deficiency in the French population and its involvement in the development of neonatal alloimmune neutropenia.
Blood
79:2131,
1992[Abstract/Free Full Text]
15.
Haas de M,
Kleijer M,
van Zwieten R,
Roos D,
von dem Borne AEGKr:
Neutrophil Fc RIIIb deficiency, nature and clinical consequences: A study of 21 individuals from 14 families.
Blood
86:2403,
1995[Abstract/Free Full Text]
16.
Stroncek DF,
Ramsey G,
Herr GP,
Eiber G,
Clay ME,
Ketyer EC:
Identification of a new white cell antigen.
Transfusion
34:706,
1994[Medline]
[Order article via Infotrieve]
17.
Bux J,
Kober B,
Kiefel V,
Mueller-Eckhardt C:
Analysis of granulocyte-reactive antibodies using an immunoassay based upon monoclonal antibody-specific immobilization of granulocyte antigens.
Transfus Med
3:157,
1993[Medline]
[Order article via Infotrieve]
18.
Stein EL,
Santoso S,
Bux J,
Mueller-Eckhardt C:
Typing of the granulocyte-specific NA antigens by restriction fragment length polymorphism analysis.
Br J Haematol
87:428,
1994[Medline]
[Order article via Infotrieve]
19.
Bux J,
Stein EL,
Santoso S,
Mueller-Eckhardt C:
NA gene frequencies in the German population determined by polymerase chain reaction with sequence-specific primers (PCR-SSP).
Transfusion
35:54,
1995[Medline]
[Order article via Infotrieve]
20.
Metcalfe P,
Waters AH:
Location of the granulocyte-specific antigen LAN on the Fc receptor III.
Transfus Med
2:283,
1992[Medline]
[Order article via Infotrieve]
21.
Bux J,
Hartmann C,
Mueller-Eckhardt C:
Alloimmune neonatal neutropenia resulting from immunization to a high frequency antigen on the granulocyte Fc receptor III.
Transfusion
34:608,
1994[Medline]
[Order article via Infotrieve]
22.
Simsek S,
van der Schoot CE,
Daams M,
Huiskes E,
Clay M,
McCullough J,
van Dalen C,
Stroncek D,
von dem Borne AEGKr:
Molecular characterization of antigenic polymorphisms (ONDa and MARTa) of the 2 family recognized by human leukocyte alloantisera.
Blood
88:1350,
1996[Abstract/Free Full Text]
23.
Bux J,
Behrens G,
Leist M,
Mueller-Eckhardt C:
Evidence that the granulocyte-specific antigen NC1 is identical with NA2.
Vox Sang
68:46,
1995[Medline]
[Order article via Infotrieve]
24.
Bux J,
Kissel K,
Nowak K,
Spengel U,
Mueller-Eckhardt C:
Autoimmune neutropenia: Clinical and laboratory studies in 143 patients.
Ann Hematol
63:249,
1991[Medline]
[Order article via Infotrieve]
25.
Bux J,
Sohn M,
Hachmann R,
Mueller-Eckhardt C:
Quantitation of granulocyte antibodies in sera and determination of their binding sites.
Br J Haematol
82:20,
1992[Medline]
[Order article via Infotrieve]
26.
Skogen B,
Bellissimo DB,
Hessner MJ,
Santoso S,
Aster RH,
Newman PJ,
McFarland JG:
Rapid determination of platelet alloantigen genotypes by polymerase chain reaction using allele-specific primers.
Transfusion
34:955,
1994[Medline]
[Order article via Infotrieve]
27.
Olerup O,
Zetterquist H:
HLA-DR typing by PCR amplification with sequence-specific primers (PCR-SSP) in 2 hours: An alternative to serological DR-typing in clinical practice including donor-recipient matching in cadaveric transplantation.
Tissue Antigens
39:225,
1992[Medline]
[Order article via Infotrieve]
28.
Ohto H,
Matsuo Y:
Neutrophil-specific antigens and gene frequencies in Japanese.
Transfusion
29:654,
1989[Medline]
[Order article via Infotrieve]
29.
Lin M,
Chen CC,
Wang CL,
Lee HL:
Frequencies of neutrophil-specific antigens among Chinese in Taiwan.
Vox Sang
66:247,
1994[Medline]
[Order article via Infotrieve]
30. Hibbs ML, Tolvanen M, Carpén O: Membrane-proximal Ig-like domain of Fc RIII (CD16) contains residues critical for ligand binding. J Immunol 152:4466, 1994.
31.
Salmon JE,
Edberg JC,
Kimberley RP:
Fc -receptor III on human neutrophils. Allelic variants have functionally distinct capacities.
J Clin Invest
85:1287,
1990
32.
Bux J,
Jung KD,
Kauth T,
Mueller-Eckhardt C:
Serological and clinical aspects of granulocyte antibodies leading to alloimmune neonatal neutropenia.
Transfus Med
2:143,
1992[Medline]
[Order article via Infotrieve]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
Y. Lee, J. Ji, and G. Song
Fc{gamma} receptor IIB and IIIB polymorphisms and susceptibility to systemic lupus erythematosus and lupus nephritis: a meta-analysis
Lupus,
July 1, 2009;
18(8):
727 - 734.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Bruhns, B. Iannascoli, P. England, D. A. Mancardi, N. Fernandez, S. Jorieux, and M. Daeron
Specificity and affinity of human Fc{gamma} receptors and their polymorphic variants for human IgG subclasses
Blood,
April 16, 2009;
113(16):
3716 - 3725.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
U. J. H. Sachs, T. Chavakis, L. Fung, A. Lohrenz, J. Bux, A. Reil, A. Ruf, and S. Santoso
Human alloantibody anti-Mart interferes with Mac-1-dependent leukocyte adhesion
Blood,
August 1, 2004;
104(3):
727 - 734.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Wolff, C. Brendel, L. Fink, R. M. Bohle, K. Kissel, and J. Bux
Lack of NB1 GP (CD177/HNA-2a) gene transcription in NB1 GP- neutrophils from NB1 GP-expressing individuals and association of low expression with NB1 gene polymorphisms
Blood,
July 15, 2003;
102(2):
731 - 733.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kissel, S. Scheffler, M. Kerowgan, and J. Bux
Molecular basis of NB1 (HNA-2a, CD177) deficiency
Blood,
May 13, 2002;
99(11):
4231 - 4233.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Hattar, U. Grandel, A. Bickenbach, A. Schwarting, W.-J. Mayet, J. Bux, S. Jessen, C. Fischer, W. Seeger, F. Grimminger, et al.
Interaction of Antibodies to Proteinase 3 (Classic Anti-Neutrophil Cytoplasmic Antibody) with Human Renal Tubular Epithelial Cells: Impact on Signaling Events and Inflammatory Mediator Generation
J. Immunol.,
March 15, 2002;
168(6):
3057 - 3064.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. H. Price, R. A. Bowden, M. Boeckh, J. Bux, K. Nelson, W. C. Liles, and D. C. Dale
Phase I/II trial of neutrophil transfusions from donors stimulated with G-CSF and dexamethasone for treatment of patients with infections in hematopoietic stem cell transplantation
Blood,
June 1, 2000;
95(11):
3302 - 3309.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Lehrnbecher, C. B. Foster, S. Zhu, S. F. Leitman, L. R. Goldin, K. Huppi, and S. J. Chanock
Variant Genotypes of the Low-Affinity Fcgamma Receptors in Two Control Populations and a Review of Low-Affinity Fcgamma Receptor Polymorphisms in Control and Disease Populations
Blood,
December 15, 1999;
94(12):
4220 - 4232.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C.A. Bruin, A. E.G.K. von dem Borne, R. Y.J. Tamminga, M. Kleijer, L. Buddelmeijer, and M. de Haas
Neutrophil Antibody Specificity in Different Types of Childhood Autoimmune Neutropenia
Blood,
September 1, 1999;
94(5):
1797 - 1802.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Hessner, S. M. Shivaram, D. M. Dinauer, B. R. Curtis, D. J. Endean, and R. H. Aster
Neutrophil Antigen (Fcgamma RIIIB) SH Gene Frequencies in Six Racial Groups
Blood,
February 1, 1999;
93(3):
1115 - 1116.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Bux, K. Kissel, C. Hofmann, and S. Santoso
The Use of Allele-Specific Recombinant Fcgamma Receptor IIIb Antigens for the Detection of Granulocyte Antibodies
Blood,
January 1, 1999;
93(1):
357 - 362.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. R. Koene, M. Kleijer, D. Roos, M. de Haas, and A. E.G.Kr. Von dem Borne
Fcgamma RIIIB Gene Duplication: Evidence for Presence and Expression of Three Distinct Fcgamma RIIIB Genes in NA(1+,2+)SH(+) Individuals
Blood,
January 15, 1998;
91(2):
673 - 679.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Bux, G. Behrens, G. Jaeger, and K. Welte
Diagnosis and Clinical Course of Autoimmune Neutropenia in Infancy: Analysis of 240 Cases
Blood,
January 1, 1998;
91(1):
181 - 186.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|