|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
By
From the Department of Immunology, Netherlands Cancer Institute, Amsterdam; the Department of Pathology, Netherlands Cancer Institute, Amsterdam, The Netherlands; the Department of Biochemistry, Biomedical Research Center, Osaka University Medical School, Japan; the Department of Pathology, University Hospital, Utrecht; the Department of Hematology, University Hospital, Utrecht, The Netherlands; the Department of Medical Oncology, Netherlands Cancer Institute, Amsterdam, The Netherlands.
Hepatocyte growth factor (HGF )/scatter factor (SF ) is the ligand for a tyrosine kinase cell surface receptor encoded by the MET protooncogene (c-MET). HGF/SF can induce proliferation and motility in epithelial cells and promotes invasion of carcinoma cells and NIH3T3 fibroblasts transfected with both HGF/SF and c-MET genes. Our results show that HGF/SF and c-MET also play a role in adhesion and invasion of human lymphoma cells. c-MET mRNA is expressed in hemopoietic cells, such as hemopoietic progenitor cells (CD34+ cells) in bone marrow (BM) and mobilized peripheral blood, immature B cells in cord blood and BM, and germinal center B-centroblasts. In normal peripheral blood B cells, which are c-MET-, c-MET expression was induced by PMA, ConA, HGF/SF, and Epstein-Barr virus (EBV) infection. Using immunohistochemistry, we detected c-MET on the cell surface of large activated centroblasts in lymph nodes from patients with B-non-Hodgkin's lymphoma and Hodgkin's disease. In the latter group, c-MET expression correlated well with the presence of EBV. Because HGF/SF and c-MET promote metastasis of carcinoma cells, we studied the effects of c-MET stimulation by HGF/SF of B-lymphoma cells on properties relevant for metastasis, ie, adhesion, migration, and invasion. HGF/SF stimulated adhesion of the c-MET+ B-cell lines to the extracellular matrix molecules fibronectin (FN) and collagen (CN) in a dose dependent manner. However, adhesion to laminin was not affected by HGF/SF. Adhesion to FN was mediated by
THE MAIN barrier in dissemination of lymphoma cell is the peripheral blood (PB) vessel wall consisting of endothelial cells. The first step is adhesion to the endothelium followed by transendothelial migration. Normal lymphocytes can migrate from the lymph nodes to the PB and in response to inflammation into tissues and vice versa.1-3 For adhesion of lymphocytes to endothelium or extracellular matrix molecules, integrins play a major role. For optimal binding, the integrins on the lymphocytes have to be activated by chemoattractants that are secreted by and can be bound to endothelial cells.4,5 Chemoattractants can bind to G-protein coupled receptors present on lymphocytes, which results in activation of the integrins. Growth factors can act as chemoattractants. For instance, interleukin-8 (IL-8) is a chemoattractant that is produced by endothelial cells itself or by underlying inflammatory cells and subsequently transported to the vessel lumen.6,7 Other examples of chemoattractants are platelet-activating factor, complement product C5a, leukotriene B4, and the chemokines MIP-1 HGF/SF is produced by various cells of mesenchymal origin, but not by epithelial cells and has a pleiotropic function. HGF/SF was first identified as a major mediator of liver regeneration but later was shown to have mitogenic, but also morphogenic and motogenic effects on a variety of epithelial cells (eg, mammary, kidney, intestinal, and bronchial epithelial cells) as well as endothelial cells.9-15 The receptor for HGF/SF is encoded by the MET protooncogene (c-MET). The c-MET protein is a tyrosine kinase cell surface receptor and consists of an extracellular Based on transfection studies in NIH3T3 cells, a role has been suggested for HGF/SF in metastasis. Addition of human HGF/SF to NIH3T3 fibroblasts, which had been transfected with human c-MET induced changes in cell shape, migration in Boyden chambers, and invasion into collagen (CN) matrices in vitro.19 Rong et al20 showed that NIH3T3 cells produce murine HGF/SF. Transfection of these cells with the murine c-MET resulted in an autocrine activation loop and the cells became invasive in vitro and tumorigenic in vivo in a nude mouse model. Transfection of both the human c-MET and HGF/SF genes resulted in a similar invasive behavior.
Here, we describe that c-MET is expressed or can be induced on normal B cells present in bone marrow (BM), PB, and lymph nodes. In addition, the expression of c-MET in lymph node samples of non-Hodgkin's lymphoma (NHL) and Hodgkin's disease (HD) patients was documented. To determine whether c-MET and HGF/SF have a similar role in (malignant) B cells as in epithelial and in transfected NIH3T3 cells, we investigated whether HGF/SF affects adhesion of c-MET+ lymphoma cells to extracellular matrix molecules. HGF/SF promoted adhesion of malignant B cells to fibronectin (FN) and CN, but not to laminin. Adhesion of B cells to FN was mediated by Cells
Epstein-Barr Virus (EBV) Infection of Peripheral B Lymphocytes
Fluorescence-Activated Cell Sorting (FACS) and Analysis For purification of different cell types from BM, PB or umbilical cord blood, mononuclear cells were labeled with CD3 (T cells), CD19 (B cells), CD16 + 56 (NK cells), CD14 (monocytes), CD15 (granulocytes), or CD34 (hematopoietic progenitor cells), and sorted with a FACS (FACS-STAR; Becton Dickinson, Leiden, The Netherlands). All antibodies were directly labeled with either fluorescein isothiocyanate (FITC) or phycoerythrin (PE) and purchased from Dako (Glostrup, Denmark), apart from CD34, which was obtained from Becton Dickinson (San Jose, CA; anti-HPCA-2 clone: 8G12). To facilitate sorting of CD34+ cells (± 1% to 2% in mononuclear cells from BM), immature cells were enriched by immunomagnetic depletion of T cells and monocytes. Mononuclear cells were incubated with a mixture of CD2 and CD14 at 4°C for 30 minutes. The cells were washed twice and incubated with immunomagnetic beads coated with goat anti-mouse Ig (ratio beads: cells = 3: 1; Dynal, Hamburg, Germany). After depletion, the remaining cells were incubated with FITC labeled CD34. The sorted cells (10,000 to 100,000) were collected in IMDM + 5% FCS and mRNA was isolated within 16 hours. In some experiments, B cells were stimulated with 0.1 µg/mL phorbol 12-myristate 13-acetate (PMA), ConA, IL-1 (R&D, Abingdon, UK), IL-4 (a gift from Dr H. Spits, Netherlands Cancer Institute), IL-6 (1,000 U/mL; a gift from Dr L.A. Aarden, CLB, The Netherlands), or HGF/SF (15 ng/mL; a gift from Dr T. Nakamura, Osaka, Japan) overnight.
RNA Isolation and Synthesis of cDNA RNA was isolated as previously described by Ziegler et al21 and Rapplee et al.22 Briefly, 103 to 106 cells were transferred into 100 µL of lysis buffer (4 mol/L GuSCN, 25 mmol/L sodium citrate, pH 5.0, 0.5% sodium lauroryl sarcosinate, 0.1 mol/L -mercapto-ethanol) containing 20 µg glycogen (Boehringer Mannheim, Mannheim, Germany) as carrier. The mixture was thoroughly vortexed and layered on top of a 100 µL 5.7 mol/L cesium chloride cushion in 0.3 mL diethylpyrocarbonate (DEPC)-treated polycarbonate centrifuge tubes (Beckman, Palo Alto, CA). The tubes were centrifuged for 2.5 hours at 4°C at 55,000 rpm with a TLS-55 rotor in a Beckman TL-100 tabletop ultracentrifuge. The RNA pellet was resuspended in DEPC-treated H2O, precipitated with 0.1 volume of 3 mol/L potassium acetate and 2.5 volumes 100% ethanol for at least 2 hours at -20°C. After centrifugation, the pellet was washed in 70% ethanol, dried, and resuspended in 5 µL DEPC-treated H2O. First strand cDNA was synthesized by incubating RNA at 37°C for 1 hour in a final volume of 10 µL in reverse transcriptase (RT)-buffer (50 mmol/L Tris-HCl, pH 8.3, 75 mmol/L KCl, 3 mmol/L MgCl2 ) containing 100 U Moloney murine leukemia virus Reverse Transcriptase (M-MLV-RT, GIBCO-BRL), 0.5 mg oligo(dT) (Promega, Madison, WI), 15 U RNasin (Promega), 10 mmol/L dithiothreitol (DTT; GIBCO-BRL) and 1.0 mmol/L of each deoxyribonucleoside triphosphate (dNTP; Pharmacia Biotech, Uppsala, Sweden).
Polymerase Chain Reaction (PCR) One tenth (1 µL) of the total cDNA obtained from the 103 to 106 cells was mixed with 1.25 U of Taq DNA polymerase (GIBCO-BRL), 1 mmol/L of each appropriate primer, 200 mmol/L of each dNTP (Pharmacia Biotech) in a buffer containing 10 mmol/L Tris-HCl, pH 8.3, 50 mmol/L KCl, 5 mmol/L MgCl2 , 0.01% (wt/vol) bovine serum albumin (BSA) in an end volume of 50 µL. The samples were overlaid with mineral oil and were amplified for 35 cycles at cycling temperatures of 94°C, 1 minute; 55°C, 1 minute; 72°C, 3 minutes for both the-actin and the c-MET amplification.
Agarose Gel Electrophoresis and Hybridization of PCR Products Twenty microliters of the PCR products were analyzed on 1% agarose gels. Fragments were visualized by UV illumination after staining with ethidium bromide. For hybridization the gels were dried in a gel dryer (Biorad, Veenendaal, The Netherlands), the DNA in the gels was denaturated (in 0.5 mol/L NaOH, 0.15 mol/L NaCl) for 30 minutes and neutralized (in 0.5 mol/L Tris, pH 8.0, 0.15 mol/L NaCl) for another 30 minutes. The gels were prehybridized in hybridization buffer (5× SSPE, 5× Denhardt, 0.5% SDS) for 1 hour at 56°C before the 32P-labeled (32P obtained from Amersham, Houten, The Netherlands) probe was added. Probes were labeled with a polynucleotide kinase kit (Boehringer Mannheim). Sequences of probes used: c-MET: 5' GCAGTGCAGCATGTAGTGATTGG 3';-actine: 5' GATGACCCAGATCATGTTTGAGAC 3'.
Immuno-histochemical Staining of Slides Paraffin embedded tissue sections were deparaffinized and rehydrated. The sections were preincubated with 10% normal goat serum in PBS for 1 hour at room temperature (RT). Normal goat serum was removed and the sections were incubated overnight at 4°C with either C-28, the polyclonal antibody directed to the last 28C terminal aminoacids of c-MET (diluted 1:400 with PBS to a final concentration of 250 ng/mL; Santa Cruz), polyclonal control IgG (also used at 250 ng/mL; Southern Biotechnology Associates Inc, Birmingham, AL), or C-28 (250 ng/mL) previously mixed for 2 hours (RT) with a 10-fold higher concentration (2.5 µg/mL) of peptide to which C-28 was raised (Santa Cruz). Furthermore, sections were incubated with monoclonal antibodies (MoAb) directed to B cells (CD20, L26; Dako), T cells (CD3; Dako), CD30 (BerH2; Dako), EMA (115D8; The Netherlands Cancer Institute, Amsterdam). Sections were washed three times with PBS (5 minutes) after which the secondary antibody (biotinylated goat anti-rabbit [Dako, E432] for c-MET staining and biotinylated goat anti-mouse [Dako, E433] for B-cell staining) was added (1:1,000 diluted in 1% BSA in PBS) for 30 minutes at RT. Slides were washed with PBS (5 minutes) and incubated with streptavidine-biotin-peroxidase complex (StreptABComplex/HRP; Dako, K377) for 30 minutes at RT. Sections were washed with PBS (5 minutes) followed by 0.05 mol/L Tris/HCl solution (pH 7.4) and stained with DAB/H2O2 imidazol solution in the dark for 5 minutes at RT. The sections were rinsed with tap water for 5 minutes to stop the developing reaction, counterstained with hematoxylin and embedded in DPX (Klinipath; Zevenaar, The Netherlands).EBV-RNA In Situ Hybridization The presence of EBV in paraffin embedded tissue sections was determined as described by van Gorp et al,24 using a very sensitive RNA in situ hybridization against EBER 1 and 2, which are two EBV encoded RNAs that are expressed in a very high quantity in latently infected cells. After deparaffinization and rehydration, the slides were treated with proteinase K (3 g/mL) in PBS for 30 minutes at 37°C. Dehydration was followed by adding 1 to 2 drops (15 to 30 µL) of EBER oligonucleotides conjugated with FITC (undiluted; Dakopatts). The slides were hybridized for 2 hours at 37°C and immersed in PBS. After preincubation with 10% normal swine serum, a three-step peroxidase reaction was applied: the first step included mouse anti-FITC (Dakopatts); the second step, rabbit anti-mouse Ig; and the third step, swine anti-rabbit Ig. The latter two antibodies were conjugated to horseradish peroxidase (Dakopatts). Peroxidase was localized by 3,3 diaminobenzin (DAB; 60 mg/100 mL PBS; Sigma, Zw ndrecht, The Netherlands) in H2O2 (0.03%) for approximately 5 seconds. The developing reaction was stopped by washing the slides in tap water for 5 minutes. Counterstaining and embedding of the sections were performed as described above.
Proliferation Assays Proliferation of cell lines was tested using 3H-thymidine incorporation. A thousand cells were plated per well in a 96 wells plate (Greiner, Frickenhausen, Germany; round bottom) in 0.22 µ filtered culture medium (IMDM+ 5% FCS). After 1 day to 3 days at 37°C with increasing concentrations of HGF/SF (up to 100 ng/mL) the plates were pulsed with 3H-thymidine (0.5 µCi/well) for 4 hours and counted in a-plate counter (1205 betaplate, Finland). Cell lines were also serum starved overnight before incubation with HGF/SF for 1 day after which 3H-thymidine was incorporated as described above. From cord blood, 50,000 CD19+ FACS sorted cells per well were incubated with HGF/SF (1,5 and 15 ng/mL) or PMA (0.1 µg/mL) for 24 hours immediately after cell sorting, followed by 3H-thymidine incorporation overnight.
Adhesion Assay Adhesion assays were performed as described by Sonnenberg et al.25 96 wells plates (U-bottom plates were used, which allowed more smoothly washing of the wells than flat bottom plates, resulting in better triplicates; Greiner) were coated overnight at 4°C with 20 µg/mL of FN, CN IV, or laminin (all obtained from Sigma). Plates were washed three times with PBS and blocked with 1% BSA in PBS for at least 1 hour at room temperature. Exponentially growing cells (Raji, BJAB, Daudi, and Jiyoye) were labeled with Na512CrO4 (Amersham) for 30 minutes, washed three times, and resuspended in IMDM containing 0.35% BSA at a concentration of 1 × 106 cells/mL. The cells were preincubated with HGF/SF (5, 15, and 50 ng/mL) or PMA (0.1 µg/mL) for 10 minutes at 37°C. Thereafter, 100 µL of the cell suspension was plated in the coated wells. Cells were allowed to adhere to the extracellular matrix molecules for 45 minutes at 37°C after which the wells were gently washed in IMDM + 0.35% BSA at least 5 times until no more floating cells could be seen. Finally, the adhered cells were lysed with 0.2% SDS and counted in a gamma-counter (Packard, Downers Grove, IL). The percentage of adhered cells was calculated by dividing radioactivity in adhering cells by the radioactivity measured in 100 µL of the initial labeled cell suspension (set at 100%).
Invasion Assays Two different assays were used to measure invasiveness of cells:Statistical Analysis Results were reported as the mean ± standard deviation (SD) of triplicate samples from a representative of at least three experiments. Significance levels were determined by two-sided Student's t-test.
Expression of c-MET in Normal Hematopoietic Cells Mononuclear cells from peripheral blood (PBMC) and BM were tested for the presence of c-MET mRNA, using reverse transcriptase-polymerase chain reaction (RT-PCR). Both BM and PBMC express c-MET (Fig 1). The PCR signal faded rapidly when fewer cells were used. At least 10,000 mononuclear cells from BM or 1,000,000 cells from PB were required to obtain a PCR product, that was visible on an ethidium bromide stained gel after 35 PCR cycles. Specificity controls included hybridization of PCR products with a radioactive probe and/or performing a nested PCR. These extra steps increased the detection level approximately ten times. To identify the cell types that express the protooncogene, we separated peripheral blood mononuclear cells in T cells, B cells, NK cells, monocytes, and granulocytes with a fluorescence activated cell sorter. The c-MET product was not amplified from 10,000 cells of any of these cell populations, whereas the-actin signal (positive control) was clearly visible (data not shown). Even when ten times more cells were analyzed (100,000) and a nested RT-PCR was performed, c-MET mRNA could not be detected. These results indicated that a rare cell population in PBMC and BM accounts for the c-MET signal. Further analysis of BM and leukapheresis material showed that the MET proto-oncogene is expressed in CD34+ cells (Fig 1). Immature B cells (CD19+CD20-) isolated from BM also expressed c-MET mRNA, in contrast to mature BM B cells (CD19+CD20+), which were c-MET negative, as were the B cells from PB. Consistent with this finding, CD19+ cells from umbilical cord (more immature B cells than those obtained from PB) were c-MET+ (Fig 1). c-MET mRNA expression was induced in freshly isolated PB B cells that were stimulated overnight with PMA, ConA, or HGF (Fig 1). IL-1, IL-4, and IL-6 did not induce expression (results not shown). Infection with EBV also induced c-MET expression in B cells (Fig 1). In a B-cell line established by EBV infection of normal PB, c-MET was expressed for at least 3 months. After prolonged culture the EBV-B cells showed a heterogeneous expression of the c-MET gene.
c-MET Expression in B-Lymphoma Cells
Functional Role of c-MET and HGF/SF in B-Lymphoma Cells
Several studies with epithelial cells have shown that c-MET and HGF/SF are involved in dissemination; HGF/SF disrupts intercellular junctions and stimulates the motility and invasiveness of various carcinoma cell types in vitro.30-33 Furthermore, NIH3T3 fibroblasts transfected with both HGF/SF and c-MET genes are tumorigenic in nude mice.20 We detected c-MET mRNA in early hematopoietic (CD34+) cells, early B cells and activated B cells. This pattern of mRNA expression was confirmed by detecting c-MET at protein level on activated B cells in germinal centers in lymph nodes. Large centroblasts from NHL or HD, which have their normal counterparts in activated B cells, also express c-MET. Induction of c-MET by various stimuli, including HGF/SF, has been described for epithelial cells.34 The expression pattern of c-MET is reminiscent of that of two other tyrosine kinase receptors, c-KIT and FLK-2/FLT-3 (fetal liver kinase-2/FMS-like-tyrosine kinase-3). These receptors are also expressed in early hematopoietic progenitor cells, and FLK-2 is known to be expressed on early B-lymphoid progenitors.35-38 Furthermore, in some cases of HD and NHL c-KIT and FLK-2 expression has been observed.39,40 c-MET expression has been detected in immature hematopoietic cells, especially in erythroid precursors, by Galimi et al41 and Jücker et al42 reported c-MET (over)expression in some cases of Burkitt's lymphoma and HD.
Submitted February 2, 1996;
accepted September 24, 1996.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hearly marked
``advertisment'' in accordance with 18 U.S.C. section 1734 solely to
indicate this fact. We thank Dr E. Roos (Department of Cell Biology, Netherlands Cancer Institute, Amsterdam) and Drs A. Hekman (Department of Immunology, Netherlands Cancer Institute) for the very helpful discussions and the critical reading of this manuscript. Furthermore, we are grateful to E. Noteboom for FACS-sorting the cells and his help in preparing photographs.
1.
Adams DH,
Shaw S:
Leukocyte-endothelial interactions and regulation of leukocyte migration.
Lancet
343:831,
1994[Medline]
[Order article via Infotrieve]
2.
Mackay CR,
Imhof BA:
Cell adhesion in the immune system.
Immunol Today
14:99,
1993[Medline]
[Order article via Infotrieve]
3.
Springer TA:
Traffic signals for lymphocyte recirculation and leukocyte emigration: The multistep paradigm.
Cell
76:301,
1994[Medline]
[Order article via Infotrieve]
4.
Rosen SD:
Cell surface lectins in the immune system.
Semin Immunol
5:237,
1993[Medline]
[Order article via Infotrieve]
5.
Spiegel AM,
Shenker A,
Weinstein LS:
Receptor-effector coupling by G proteins: implications for normal and abnormal signal transduction.
Endocrine Rev
13:536,
1993
6.
Rot A:
Endothelial cell binding of NAP-1/IL-8: Role in neutrophil emigration.
Immunol Today
13:291,
1992[Medline]
[Order article via Infotrieve]
7.
Hubere AR,
Kunkel SL,
Todd RF III,
Weiss SJ:
Regulation of transendothelial neutrophil migration by endogenous interleukin-8.
Science
354:99,
1991
8.
Adams DH,
Harvath L,
Bottaro DP,
Interrante R,
Catalano G,
Tanaka Y,
Strain A,
Hubscher SG,
Shaw S:
Hepatocyte growth factor and macrophage inflammatory protein 1
9.
Nakamura T,
Nishizawa T,
Hagiya M,
Seki T,
Shimonishi M,
Sugimura A,
Tashiro K,
Shimizu S:
Molecular cloning and expression of human hepatocyte growth factor.
Nature
342:440,
1989[Medline]
[Order article via Infotrieve]
10.
Michalopoulos GK:
Liver regeneration: Molecular mechanisms of growth control.
FASEB J
4:176,
1990[Abstract]
11.
Rubin JS,
Bottaro DP,
Aaronson SA:
Hepatocyte growth factor/scatter factor and its receptor, the c-met proto-oncogene product.
Biochem Biophys Acta
1155:357,
1993[Medline]
[Order article via Infotrieve]
12.
Dignass AU,
Lynch-Devaney K,
Podolsky DK:
Hepatocyte growth factor/scatter factor modulates intestinal epithelial cell proliferation and migration.
Biochem Biophys Res Commun
202:701,
1994[Medline]
[Order article via Infotrieve]
13.
Stoker M,
Gherardi E,
Perryman M,
Gray J:
Scatter Factor is a fibroblast-derived modulator of epithelial cell mobility.
Nature
327:239,
1987[Medline]
[Order article via Infotrieve]
14.
Gerardi E,
Stoker M:
Hepatocytes and scatter factor.
Nature
346:228,
1990[Medline]
[Order article via Infotrieve]
15.
Bussolino F,
Di Renzo MF,
Ziche M,
Bocchietto E,
Olivero M,
Naldini L,
Gaudino G,
Tamagnone L,
Coffer A,
Marchisio PC,
Comoglio PM:
Hepatocyte Growth Factor is a potent angiogenic factor which stimulates endothelial cell motility and growth.
J Cell Biol
119:629,
1992
16.
Giordano S,
Di Renzo MF,
Narsimhan R,
Cooper CS,
Rosa C,
Comoglio PM:
Biosynthesis of the protein encoded by the c-met proto-oncogene.
Oncogene
4:1383,
1989[Medline]
[Order article via Infotrieve]
17.
Naldini L,
Vigna E,
Ferracini R,
Longati P,
Gandino L,
Prat M,
Comoglio PM:
The tyrosine kinase encoded by the MET proto-oncogene is activated by autophosphorylation.
Mol Cell Biol
11:1793,
1991
18.
Naldini L,
Vigna E,
Narshiman RP,
Gaudino G,
Zarnegar R,
Michalopoulos G,
Comoglio PM:
Hepatocyte growth factor (HGF ) stimulates the tyrosine kinase activity of the receptor encoded by the proto-oncogene c-MET.
Oncogene
6:501,
1991[Medline]
[Order article via Infotrieve]
19.
Giordano S,
Zhen Z,
Medico E,
Gaudino G,
Galimi F,
Comoglio PM:
Transfer of the motogenic and invasive response to scatter factor/hepatocyte growth factor by transfection of the human c-MET proto-oncogene.
Proc Natl Acad Sci USA
90:649,
1993
20.
Rong S,
Segal S,
Anver M,
Resau JH,
Vande Woude GF:
Invasiveness and metastasis of NIH3T3 cells induced by Met-hepatocyte growth factor/scatter factor autocrine stimulation.
Proc Natl Acad Sci USA
91:4731,
1994
21.
Ziegler BL,
Lamping C,
Thoma S:
Single-Cell cDNA-PCR: Removal of contaminating genomic DNA from total RNA using immobilized DNase I.
Biotechniques
13:726,
1992[Medline]
[Order article via Infotrieve]
22.
Rappolee DA,
Wang A,
Mark D,
Werb Z:
Novel method for studying mRNA phenotypes in single or small numbers of cells.
J Cell Biochem
39:1,
1989[Medline]
[Order article via Infotrieve]
23.
Ponzetto C,
Giordano S,
Peverali F,
Della Valle G,
Abate ML,
Vaula G,
Comoglio PM:
c-MET is amplified but not mutated in a cell line with an activated MET tyrosine kinase.
Oncogene
6:553,
1991[Medline]
[Order article via Infotrieve]
24.
Van Gorp J,
Jacobse KC,
Broekhuizen R,
Alers J,
Van den Tweel JG,
De Weger RA:
Encoded latent membrane protein 1 of Epstein-Barr virus on follicular dendritic cells in residual germinal centers in Hodgkin's disease.
J Clin Pathol
47:29,
1994
25.
Sonnenberg A,
Linders CJT,
Modderman PW,
Damsky CH,
Aumailley M,
Timpl R:
Integrin recognition of different cell binding fragments of laminin (P1, E3, E8) and evidence that a6
26.
La Rivière G,
Gebbink JWTM,
Schipper CA,
Roos E:
Tumour necrosis factor-alpha stimulates invasiveness of T-cell hybridomas and cytotoxic T-cell clones by a pertussis toxin-insensitive mechanism.
Immunology
75:269,
1992[Medline]
[Order article via Infotrieve]
27.
Albini A,
Iwamoto Y,
Kleinman HK,
Martin GR,
Aaronson SA,
Kozlowski JM,
McEwan RN:
A rapid in vitro assay for quantitating the invasive potential of tumor cells.
Cancer Res
47:3239,
1987
28.
Verschueren H,
Dekegel D,
De Baetselier P:
Development of a monolayer invasion assay for the discrimination and islolation of metastatic lymphoma cells.
Invasion Metastasis
7:1,
1987[Medline]
[Order article via Infotrieve]
29.
Collard JG,
Poll M,
Scheffer A,
Roos E,
Hopman AHM,
Geurts van Kessel AHM,
Dongen JJM:
Location of genes involved in invasion and metastasis on human chromosome 7.
Cancer Res
47:6666,
1987
30.
Weidner KM,
Behrens J,
Vandekerckhove J,
Birchmeier W:
Scatter factor: Molecular characteristics and effect on invasiveness of epithelial cells.
J Cell Biol
111:2097,
1990
31.
Rosen EM,
Meromsky L,
Setter E,
Vinter DW,
Goldberg ID:
Smooth muscle-derived factor stimulates mobility of human tumor cells.
Invasion Metastasis
10:49,
1990[Medline]
[Order article via Infotrieve]
32.
Rosen EM,
Goldberg ID,
Liu D,
Setter E,
Donovan MA,
Bhargava M,
Reiss M,
Kacinski BM:
Tumor necrosis factor stimulates epithelial tumor cell motility.
Cancer Res
51:5315,
1991
33.
Jiang WG,
Lloyds D,
Puntis MCA,
Nakamura T,
Hallett MB:
Regulation of spreading and growth of colon cancer cells by hepatocyte growth factor.
Clin Exp Metastasis
11:235,
1993[Medline]
[Order article via Infotrieve]
34.
Boccaccio C,
Gaudino G,
Gambarotta G,
Galimi F,
Comoglio PM:
Hepatocyte growth factor (HGF ) receptor expression is inducible and is part of the delayed-early response to HGF.
J Biol Chem
269:12846,
1994
35.
Li CL,
Johnson GR:
Stem cell factor enhances the survival but not the self-renewal of murine hematopoietic long-term repopulating cells.
Blood
84:408,
1994
36.
Iemura A,
Tsai M,
Wershil BK,
Galli SJ:
The c-kit ligand, stem cell factor, promotes mast cell survival by suppressing apoptosis.
Am J Pathol
144:321,
1994[Abstract]
37.
Rosnet O,
Schiff C,
Pébusque M-J,
Marchetto S,
Tonnelle C,
Toiron Y,
Birg F,
Birnbaum D:
Human FLT3/FLK2 gene: cDNA cloning and expression in hematopoietic cells.
Blood
82:1110,
1993
38.
Hirayama F,
Lyman SD,
Clark SC,
Ogawa M:
The flt3 ligand supports proliferation of lymphohematopoietic progenitors and early B-lymphoid progenitors.
Blood
85:1762,
1995
39.
Pinto A,
Gloghini A,
Gattei V,
Aldinucci D,
Zagonel V,
Carbone A:
Expression of the c-kit receptor in human lymphomas is restricted to Hodgkin's disease and CD30+ anaplastic large cell lymphomas.
Blood
83:785,
1994
40.
DaSilva N,
Hu Z-B,
Ma W,
Rosnet O,
Birnbaum D,
Drexler HG:
Expression of the FLT3 gene in human leukemia-lymphoma cell lines.
Leukemia
8:885,
1994[Medline]
[Order article via Infotrieve]
41.
Galimi F,
Bagnara GP,
Bonsi L,
Cottone E,
Follenzi A,
Simeone A:
Hepatocyte growth factor induces proliferation and differentiation of multipotent and erythroid hemopoietic progenitors.
J Cell Biol
127:1743,
1994
42.
Jücker M,
Günther A,
Gradl G,
Fonatsch C,
Krueger G,
Diehl V,
Tesch H:
The Met/hepatocyte growth factor receptor (HGFR) gene is overexpressed in some cases of human leukemia and lymphoma.
Leuk Res
18:7,
1994[Medline]
[Order article via Infotrieve]
43.
Shimizu Y,
Van Seventer GA,
Horgan KJ,
Shaw S:
Regulated expression and binding of three VLA (
44.
Hughes PE,
O'Toole TE,
Ylanne J,
Shattil SJ,
Ginsberg MH:
The conserved membrane-proximal region of an integrin cytoplasmic domain specifies ligand binding affinity.
J Biol Chem
270:12411,
1995
45.
Matsumoto A,
Hemler ME:
Multiple activation states of VLA-4. Mechanistic differences between adhesion to CS1/fibronectin and to vascular cell adhesion molecule-1.
J Biol Chem
268:228,
1993
46.
Kawaguchi S,
Hemler ME:
Role of the alpha subunit cytoplasmic domain in regulation of adhesive activity mediated by the integrin VLA-2.
J Biol Chem
268:16279,
1993
47.
Dastych J,
Metcalfe DD:
Stem cell factor induces mast cell adhesion to fibronectin.
J Immunol
152:213,
1994[Abstract]
48.
Kinashi T,
Springer TA:
Steel factor and c-kit regulate cell-matrix adhesion.
Blood
83:1033,
1994
49.
Kovach NL,
Lin N,
Yednock T,
Harlan JM,
Broudy VC:
Stem cell factor modulates avidity of
50.
Lévesque J-P,
Leavesley DI,
Niutta S,
Vadas M,
Simmons PJ:
Cytokines increase human hemopoietic cell adhesiveness by activation of Very Late Antigen (VLA)-4 and VLA-5 integrins.
J Exp Med
181:1805,
1995
51.
Kim S,
Ang SL,
Bloch KD,
Kawahara Y,
Tolman C,
Lee R,
Seidman JG,
Neer EJ:
Identification of cDNA encoding an additional alpha subunit of a human GTP-binding protein: Expression of three alphai subtypes in human tissues and cell lines.
Proc Natl Acad Sci USA
85:4153,
1988
52.
Pan MG,
Florio T,
Stork PJS:
G protein activation of a hormone-stimulated phosphatase in human tumor cells.
Science
256:1215,
1992
53.
Stryer L,
Bourne HR:
G proteins: A family of signal transducers.
Ann Rev Cell Biol
2:391,
1986
54. Delwel GO, Sonnenberg A: Laminin isoforms and their integrin receptors, in Horton MA (ed): Adhesion Receptors as Therapeutic Targets, chapter 2:9, Boca Raton, FL, CRC 1996
55.
Jiang WG,
Hiscox S,
Puntis MCA,
Nakamura T,
Mansel RE,
Hallet MB:
Induction of tyrosine phosphorylation and translocation of ezrin by hepatocyte growth factor/scatter factor.
Biochem Biophys Res Comm
217:1062,
1995[Medline]
[Order article via Infotrieve]
56.
Takeuchi K,
Sayo N,
Kasahara H,
Funayama N,
Nagafuchi A,
Yonemura S,
Tsukita S,
Tsukita S:
Perturbation of cell adhesion and microvilli formation by antisense oligonucleotides to ERM family members.
J Cell Biol
125:1371,
1994
57.
Martin M,
Andreoli C,
Sahuquet A,
Montcourrier P,
Algrain M,
Mangeat P:
Ezrin NH2-terminal domain inhibits the cell extension activity of the COOH-terminal domain.
J Cell Biol
128:1081,
1995
58.
Frixen U,
Behrens J,
Sachs M,
Eberle G,
Voss B,
Warda A,
Löchner D,
Birchmeier W:
E-cadherin-mediated cell-cell adhesion prevents invasiveness of human carcinoma cells.
J Cell Biol
113:173,
1991
59.
Vleminck K,
Vakat L Jr,
Mareel M,
Fries W,
van Roy F:
Genetic manipulation of E-Cadherin expression by epithelial tumor cells reveals an invasion suppressor role.
Cell
66:107,
1991[Medline]
[Order article via Infotrieve]
60.
Matsumoto K,
Ziober BL,
Yao C-C,
Kramer RH:
Growth factor regulation of integrin-mediated cell motility.
Cancer Metastasis Rev
14:205,
1995[Medline]
[Order article via Infotrieve]
61.
Ponzetto C,
Bardelli A,
Zhen Z,
Maina F,
dalla Zonca P,
Giordano S,
Graziani A,
Panayotou G,
Comoglio PM:
A multifunctional docking site mediates signaling and transformation by the hepatocyte growth factor/scatter factor receptor family.
Cell
77:261,
1994[Medline]
[Order article via Infotrieve]
62.
Pawson T:
Protein modules and signalling networks.
Nature
373:573,
1995[Medline]
[Order article via Infotrieve]
63.
Galimi F,
Brizzi MF,
Comoglio PM:
The hepatocyte growth factor and its receptor.
Stem Cells
11:22,
1993
64.
Zhu H,
Naujokas MA,
Fixman ED,
Torossian K,
Park M:
Tyrosine 1356 in the carboxyl-terminal tail of the HGF/SF receptor is essential for the transduction of signals for cells motility and morphogenesis.
J Biol Chem
269:29943,
1994
65.
Fixman ED,
Naujokas MA,
Rodrigues GA,
Moran MF,
Park M:
Efficient cell transformation by the Tpr-Met oncoprotein is dependent upon tyrosine 489 in the carboxy-terminus.
Oncogene
10:237,
1995[Medline]
[Order article via Infotrieve]
66.
Ridley AJ,
Comoglio PM,
Hall A:
Regulation of scatter Factor/Hepatocyte Growth Factor responses by Ras, Rac, and Rho in MDCK cells.
Mol Cell Biol
15:1110,
1995[Abstract]
67.
Clark P:
Modulation of scatter factor/hepatocyte growth factor activity by cell-substratum adhesion.
J Cell Sci
107:1265,
1994[Abstract]
68.
Bellusci S,
Moens G,
Gaudino G,
Comoglio P,
Nakamura T,
Thiery J-P,
Jouanneau J:
Creation of an hepatocyte growth factor/scatter factor autocrine loop in carcinoma cells induces invasive properties associated with increased tumorigenicity.
Oncogene
9:1091,
1994[Medline]
[Order article via Infotrieve]
69.
Wolf HK,
Zarnegar R,
Michalopoulos:
Localization of hepatocyte growth factor in human and rat tissues: An immunohistochemical study.
Hepatology
14:488,
1991[Medline]
[Order article via Infotrieve]
70.
Adams DH,
Harvath L,
Bottaro DP,
Interrante R,
Catalano G,
Tanaka Y,
Strain A,
Hubscher SG,
Shaw S:
Hepatocyte growth factor and macrophage inflammatory protein 1
71.
Kato Y,
Liu K-X,
Nakamura T,
Sugiyama Y:
Heparin-hepatocyte growth factor complex with low plasma clearance and retained hepatocyte proliferating activity.
Hepatology
20:417,
1994[Medline]
[Order article via Infotrieve]
72.
Ashikari S,
Habuchi H,
Kimata K:
Characterization of heparan sulphate oligosaccharides that bind to hepatocyte growth factor.
J Biol Chem
270:29586,
1995
73.
Cooper DL,
Dougherty GJ:
To metastasize or not? Selection of CD44 splice sites.
Nature Med
1:635,
1995[Medline]
[Order article via Infotrieve]
74.
Schlessinger J,
Lax I,
Lemmon M:
Regulation of growth factor activation by proteoglycans: What is the role of low affinity receptors?
Cell
83:357,
1995[Medline]
[Order article via Infotrieve]
75.
Lemmon MA,
Schlessinger J:
Regulation of signal transduction and signal diversity by receptor oligomerization.
Trends Biochem Sci
19:459,
1994[Medline]
[Order article via Infotrieve]
76.
Silvagno F,
Follenzi A,
Arese M,
Prat M,
Giraudo E,
Gaudino G,
Camussi G,
Comoglio PM,
Bussolino F:
In vivo activation of met tyrosine kinase by heterodimeric hepatocyte growth factor molecule promotes angiogenesis.
Arterioscler Thomb Vasc Biol
15:1857,
1995
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 1997 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
4
1 and 
Abstract
Introduction
Abstract
, RasGAP, Grb2-Sos complex, and Src-related tyrosine kinases.
