|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 89 No. 4 (February 15), 1997:
pp. 1165-1172
Augmented Production of Interleukin-6 by Normal Human Osteoblasts in Response to CD34+ Hematopoietic Bone Marrow Cells In Vitro
By
Russell S. Taichman,
Marcelle J. Reilly,
Rama S. Verma, and
Stephen G. Emerson
From the Department of Periodontics, Prevention, Geriatrics, University of Michigan School of Dentistry, Ann Arbor, MI; and the Departments of Internal Medicine and Pediatrics, University of Pennsylvania, Philadelphia, PA.
 |
ABSTRACT |
Based on anatomic and developmental findings characterizing hematopoietic cells in close approximation with endosteal cells, we have begun an analysis of osteoblast/hematopoietic cell interactions. We explore here the functional interdependence between these two cell types from the standpoint of de novo cytokine secretion. We determined that, over a 96-hour period, CD34+ bone marrow cells had no significant effect on osteoblast secretion of granulocyte colony-stimulating factor, granulocyte-macrophage colony-stimulating factor, or transforming growth factor- 1 , but in some experiments minor increases in leukemia inhibitory factor levels were observed. However, when CD34+ bone marrow cells were cocultured in direct contact with osteoblasts, a 222% ± 55% (range, 153% to 288%) augmentation in interleukin-6 (IL-6) synthesis was observed. The accumulation of IL-6 protein was most rapid during the initial 24-hour period, accounting for nearly 55% of the total IL-6 produced by osteoblasts in the absence of blood cells and 77% of the total in the presence of the CD34+ cells. Cell-to-cell contact does not appear to be required for this activity, as determined by coculturing the two cell types separated by porous micromembranes. The identity of the soluble activity produced by the CD34+ cells remains unknown, but is not likely due to IL-1 or tumor necrosis factor- , as determined with neutralizing antibodies. To our knowledge, these data represent the first demonstration that early hematopoietic cells induce the production of molecules required for the function of normal bone marrow microenvironments, in this case through the induction of hematopoietic cytokine (IL-6) secretion by osteoblasts.
 |
INTRODUCTION |
THE BONE MARROW is responsible for two fundamental processes: the production of mature blood cells from hematopoietic stem cells and supporting bone formation via the generation of osteoblasts. Despite the intriguing anatomic and developmental findings characterizing hematopoietic cells in close approximation with endosteal osteoblasts, surprisingly little is known relating to the role of osteoblasts in blood development.1,2 Therefore, we have begun an analysis of osteoblast/hematopoietic cell interactions in the bone marrow microenvironment. Using osteoblasts derived from human bone explants3 and osteosarcoma cell lines, we and others have determined that human osteoblasts produce granulocyte colony-stimulating factor (G-CSF ),4 granulocyte-macrophage colony-stimulating factor (GM-CSF ),4 interleukin-1 (IL-1 ),5 IL-6,5 leukemia inhibitory factor (LIF ),6 macrophage colony-stimulating factor (M-CSF ),7-9 and tumor necrosis factor- (TNF- )10 protein. Furthermore, we have observed that osteoblasts maintain hematopoietic progenitors and long-term culture-initiating cells (LTC-IC) in vitro.11
Recently, intriguing data have emerged that hematopoietic cells might cooperate with the marrow stromal populations to assemble the various hematopoietic microenvironments. The induction of stromal cell-derived cytokines in response to either factors produced by the hematopoietic cells or after the adhesion of blood cells to stromal cells are mechanisms believed to be involved in orchestrating this process.12-14 Given our findings with enriched populations of human osteoblasts on early hematopoietic cells in vitro, and the possible importance of osteoblasts in hematopoiesis, we therefore asked whether hematopoietic cells contribute to the hematopoietic supportive activity of primary human osteoblasts by activating the production of cytokines by osteoblasts.
We report here that IL-6 and, to a lesser degree, LIF, but not G-CSF, GM-CSF, and transforming growth factor- 1 (TGF- 1 ) are specifically secreted by osteoblasts in response to hematopoietic progenitor cells. The maximal accumulation of secreted IL-6 occurs during the initial 24-hour period of coculture and is correlated with human CD34+ bone marrow cell number. Furthermore, cell-to-cell contact does not appear to be required for this activity. The identity of the soluble activity produced by the CD34+ cells remains unknown, but is not likely due to IL-1 or TNF- , as determined with neutralizing antibodies. To our knowledge, these data represent the first demonstration that normal hematopoietic progenitor cells induce the production molecules required for the production of a normal bone marrow microenvironment by cells of the osteoblast lineage.
 |
MATERIALS AND METHODS |
Human osteoblasts.
Enriched human osteoblast cultures were established using modifications of methods described by Robey and Termine.3 Normal human trabecular bone was obtained from patients undergoing orthopedic surgery in accordance with the University of Michigan's Investigational Review Board. Bone cleaned of loosely adherent tissue was ground to produce a uniform particle size (size, 1 mm2; BioComp Minimill, W. Lorenz, Jacksonville, FL) and incubated in 1 mg/mL bacterial collagenase (Type P; Boehringer Mannheim Biologicals, Indianapolis, IN). The explants were placed into culture until confluent monolayers were produced in a 1:1 (vol/vol) mixture of Ham's F12/Dulbecco's minimal essential medium (DMEM; Biofluids, Rockville, MD) with low Ca+2 and 10% fetal bovine serum. Thereafter, cultures were maintained in calcium replete Ham's F12/DMEM (1:1 vol/vol) medium containing 10% heat-inactivated fetal bovine serum (FBS; Life Technologies, Grand Island, NY), antibiotics, 10 mmol/L -glycerol phosphate, and 10 mg/mL L-ascorbate. To verify that the cells expressed an osteoblast phenotype, the cultures were screened for the expression of the osteoblast-specific protein osteocalcin (osteocalcin+) and the absence of c-kit ligand (c-kit ligand-) by reverse transcriptase polymerase chain reaction (RT-PCR), as previously detailed.4 Using morphologic and RNA criteria, we can detect contamination of our osteoblast preparations by marrow stromal elements to levels of 1% of the total population (data not presented).
Isolation of human CD34+ bone marrow cells.
Human bone marrow cells were obtained from healthy adult volunteers by iliac crest puncture and aspiration into preservative-free heparin under a protocol approved by the University of Michigan's Investigational Review Board. Mononuclear cells were isolated by density separation on Ficoll-Hypaque (specific gravity, 1.077). Plastic adherence at 37°C was performed in modified Dexter's medium (Iscove's modified Dulbecco's medium [IMDM], 10% FBS, 10% equine serum, 1 µmol/L hydrocortisone, penicillin/streptomycin [Life Technologies]). After overnight adherence, the nonadherent cells were recovered and CD34+ bone marrow cells were isolated by positive immunomagnetic selection using the QUIND/10 antibody (Miltenyi Biotec Inc, Sunnyvale, CA). In some experiments, mononuclear cells isolated by positive immunomagnetic selection were stained with a phycoerythrin conjugate of the anti-CD34 antibody, HPCA-2 (Becton Dickinson, San Jose, CA), to evaluate purity. Under these conditions, 92.5% ± 3.5% (n = 2) of the recovered cells expressed the CD34 antigen. Where indicated, these cells were further isolated by fluorescence-activated cell sorting (FACS; EPICS C; Coulter Corp, Hialeah, FL).
Liquid coculture of CD34+ bone marrow cells and primary human osteoblasts.
Primary human osteocalcin+, c-kit ligand- osteoblasts at confluence were harvested by trypsinization (20 minutes at 37°C, 0.05% trypsin/0.5 mmol/L EDTA [Life Technologies]) and seeded into 96-well or 24-well flat-bottomed tissue culture plates to a final density of 2 × 104/cm2 in Ca+2 replete Ham's F12/DMEM (1:1 vol/vol) containing 10% heat-inactivated FBS, antibiotics, 10 mmol/L -glycerol phosphate, and 10 mg/mL L-ascorbate. After 7 days, the osteoblast monolayers were washed twice and 1 × 104 CD34+ bone marrow cells were seeded onto the osteoblast monolayers. Thereafter, conditioned medium was collected over the first 96 hours of the osteoblast/blood cell coculture. Where indicated, serum concentrations were reduced from 10% to 1% (vol/vol).
To determine whether viable osteoblasts were required for the production of cytokines, osteoblasts grown to confluence were fixed in situ with 2% paraformaldehyde in phosphate-buffered saline for 10 minutes at 25°C. Subsequently, the osteoblast cell monolayers were washed four times with medium before the initiation of coculture experiments. For direct cell-cell contact investigations, CD34+ bone marrow cells (1.0 × 104) were seeded into the top chamber of TransWell (Corning Costar Corp, Cambridge, MA) dual-chambered 24-well plates (0.4-µm pore size), with confluent primary human osteoblasts in the bottom chamber. To determine whether IL-1 or TNF- was responsible for the soluble activity produced by the CD34+ cells that stimulates IL-6 production by human osteoblasts, IL-1 and TNF- neutralizing monoclonal antibodies (murine IgG1 monoclonal; Genzyme Corp, Cambridge, MA), isotype-matched control (MOPC-21; Sigma, St Louis, MO), or vehicle were added daily to a final concentration of 10 µg/mL.
Production of bone marrow CD34+ cell-conditioned medium.
CD34+ bone marrow cells (1 × 105) were seeded into the top chamber of TransWell (Corning Costar Corp) dual-chambered 24-well plates (0.4-µm pore size) with 0.7 mL total of a 1:1 mixture of DMEM/F12 medium supplemented with 10% fetal calf serum, Pen/Strep, 10 mmol/L L-ascorbate, and 10 mg/mL -glycerol phosphate in 24-multiwell culture plates. At 24, 48, and 72 hours, the conditioned medium was harvested, spun at 12,000 rpm at 4°C for 15 minutes, and frozen at -80°C.
RT-PCR.
Total cellular RNA was recovered by lysing cells directly in Stat-60 according to the directions of the manufacturer (Tel-Test Inc, Friendswood, TX). RNA integrity and purity was evaluated by electrophoresis with ethidium bromide and absorbance at A260/A280 . RNA (1.0 µg), 10× RT buffer (1× RT buffer: 50 mmol/L Tris HCl, pH 8.3, 50 mmol/L KCl, 8.0 mmol/L MgCl2 , and 10 mmol/L dithiothreitol), 25 mmol/L dXTP mix (25 mmol/L of each dXTP [adenosine, cytosine, thymidine, guanidine (ACGT)]), 3.0 µg oligo d(T), and 2.5 U reverse transcriptase (M-MLV Reverse Transcriptase; Life Technologies, Grand Island, NY) were incubated together at 38°C for 1 hour. One-fifth of the double-stranded product was mixed with 10× Taq buffer (1× Taq/RT buffer: 10 mmol/L Tris, pH 8.3, 50 mmol/L KCl, 1.5 mmol/L MgCl2 , 0.01% gelatin, and 2.0 mmol/L dithiothreitol), 1 mmol/L dXTP mix, 500 ng of each sense and antisense oligonucleotide, and 2.5 U Taq polymerase (Taq polymerase; GIBCO-BRL). Sense and antisense primers were prepared by the oligonucleotide synthesis core at the University of Michigan and were designed to cross intron/exon boundaries: c-kit ligand (sense, GAAGGGATCTGCAGGAATCGTGTG; antisense, GCCCTTGTAAGACCTGGCTGTCTC; expected size, 665 bp15 ), osteocalcin (sense, GGCAGCGAGGTAGTGAAGAG; antisense, GATGTGGTCAGCCAACTCGT; expected size, 137 bp16 ), IL-6 (sense, GGATCCTCCTTCTCCACAAGCGCCTTCGGTCCA; antisense, AAGCTTGTTCCTCACTACTCTCAAATGTGTTCTG; expected size, 398 bp17 ), actin (sense, GTGGGGCGCCCCCAGGCACCA; antisense, CTCCTTAATGTCACGCACGATTTC; expected size, 548 bp18 ), as previously detailed.4 The samples underwent thermal cycling at 94°C for 1 minute and at 72°C for 3 minutes for 35 cycles, followed by 10 minutes of extension at 72°C (Perkin Elmer Cetus DNA thermal cycler; Perkin Elmer Cetus, Norwalk, CT). The products were electrophoresed in 3% agarose and visualized using ethidum bromide. To control for false-positives due to overamplification or DNA contamination, reverse transcriptase was omitted from the reaction (data not presented) and primers were designed to cross intron\exon boundaries.
Cytokine enzyme-linked immunosorbent assays (ELISAs).
Conditioned medium was collected at the times indicated and stored at -80°C until assayed for cytokine levels by double-antibody sandwich method with commercially available ELISA kits according to the directions of the manufacturer: IL-1 (sensitivity, 0.1 pg/mL; range, 3.9 to 250 pg/mL; R&D Systems, Minneapolis, MN), IL-6 (sensitivity, 0.7 pg/mL; range, 3.33 to 300 pg/mL; R&D Systems), G-CSF (sensitivity, 7.2 pg/mL; range, 39 to 2,500 pg/mL), GM-CSF (sensitivity, 1.5 pg/mL; range, 7.8 to 5,000 pg/mL; R&D Systems), LIF (sensitivity, 2.0 pg/mL; range, 31 to 2,000 pg/mL; R&D Systems), TGF- 1 (sensitivity, 0.05 ng/mL; range, 0.1 to 4 ng/mL; Genzyme), and TNF- (sensitivity, 3 pg/mL; range, 6 to 1,024 pg/mL; Genzyme). Cytokine levels are presented as the mean ± standard error cytokine per milliliter for triplicate determinations.
Statistical analyses.
Each experiment was repeated a minimum of three times. Analysis of variance (ANOVA) was used to determine statistical significance.
 |
RESULTS |
The effect of human bone marrow CD34+ cells on cytokine synthesis by human osteoblasts.
In previous investigations, we have shown that normal human osteoblasts constitutively produce a variety of cytokine mRNAs under basal conditions.4 In the present investigations, we examined whether untransformed human osteoblast-like cells would respond to normal hematopoietic cells by augmenting their secretion of soluble G-CSF, GM-CSF, IL-6, LIF, and TGF- 1 . We chose these particular cytokines as representatives of proteins with largely stimulatory (IL-6, GM-CSF, and G-CSF ) and inhibitory (LIF and TGF- 1 ) activity on hematopoietic cells.19-23 Explant-derived osteoblast monolayers were seeded with CD34+ bone marrow cells for 4 days in Ca+2 replete Ham's F12/DMEM (1:1 vol/vol) containing 10% heat-inactivated FBS, antibiotics, 10 mmol/L -glycerol phosphate, and 10 mg/mL L-ascorbate. Under these conditions, we have previously determined that osteoblasts maintain hematopoietic progenitors and LTC-IC activity for at least 2 weeks in vitro.11
Over a 96-hour period, we observed that CD34+ cells had no significant effect on the production of osteoblast-derived, soluble G-CSF to the limits of the assay (7.2 pg/mL; Fig 1). During the same period, no significant alterations in the levels of GM-CSF produced were noted, and the production of TGF- 1 was also not significantly altered (Fig 1). In contrast, the presence of CD34+ cells induced osteoblasts in some experiments to secrete enhanced levels of LIF. However, more striking was the effect that CD34+ cells had on IL-6 levels. Under basal conditions (no CD34+ cells), osteoblasts produced levels of IL-6 that were easily detected by the ELISA, ranging from 67 to 137 pg/mL under the 10% serum conditions. When CD34+ cells were placed in direct contact with the osteoblasts, an average increase in IL-6 production of 222% ± 55% (range, 153% to 288%) was observed (Fig 1). To verify that CD34+ bone marrow cells and not a small number of contaminating cells were responsible for the IL-6 stimulation, CD34+ cells were isolated by positive immunomagnetic selection and further purified by FACS using a phycoerythrin conjugate of the anti-CD34 antibody, HPCA-2 (Becton Dickinson). Under these conditions, the FACS-sorted CD34+ cells exhibit the same IL-6 stimulatory activity on human osteoblasts as do the immunoselected cells (Table 1).

View larger version (20K):
[in this window]
[in a new window]
| Fig 1.
Effect of human bone marrow CD34+ cells on cytokine synthesis by human osteoblasts. Bone marrow CD34+ cells (1.0 × 104) were seeded directly onto confluent human osteoblast monolayers (HOB) as described in the Materials and Methods in 24-well tissue culture plates with 10% FBS. At 96 hours, conditioned medium was collected and assayed for G-CSF, GM-CSF, IL-6, LIF, or TGF- 1 by ELISA. Individual data from three independent experiments are presented as the mean ± standard deviation for triplicate determinations. *Significant difference from no CD34+ (HOB) control to a statistical significance of P < .05.
|
|
To determine the time frame in which IL-6 synthesis occurs in response to blood cells, osteoblast/CD34+ cell cocultures were established and conditioned medium was collected over the course of 4 days. To minimize the effects that unknown serum components may have on IL-6 synthesis, we reduced the serum concentrations of our cultures from 10% to 1%. Under these conditions, immunodetectable levels of IL-6 increased nearly 10-fold relative to those observed in the higher serum concentrations, suggesting the possibly of serum inhibitor (Figs 1 and 2). For osteoblasts cultured in the absence of the hematopoietic cells, the majority of IL-6 accumulated during the initial 24-hour period (55% of total IL-6 produced; Fig 2). Subsequently, the mean IL-6 levels continued to accumulate but were not significantly different from the initial 24-hour period. The inclusion of CD34+ bone marrow cells significantly increased the levels of IL-6 detected at all time points relative to the osteoblasts alone (Fig 2). Curiously, after the initial 24 hours, the IL-6 levels plateaued rather than continuing to accumulate, possibly representing consumption by the CD34+ cells. In addition, IL-6 levels in vitro correlated with increasing CD34+ cell numbers (Fig 3).

View larger version (13K):
[in this window]
[in a new window]
| Fig 2.
Rate of IL-6 synthesis in coculture of CD34+ bone marrow cells with osteoblasts. Bone marrow CD34+ cells (1.0 × 104) were seeded directly onto confluent human osteoblast monolayers (HOB) in 96-well tissue culture plates containing 1% FBS. At 24, 48, and 96 hours, conditioned medium was collected and assayed for IL-6 by ELISA. Data from a representative of three independent experiments are presented as the mean ± standard deviation for triplicate determinations. *Significant difference from no CD34+ (HOB). +Significant difference from previous time point to a statistical significance of P < .05.
|
|

View larger version (10K):
[in this window]
[in a new window]
| Fig 3.
Effect of CD34+ bone marrow cell number on IL-6 synthesis in coculture with osteoblasts. Bone marrow CD34+ cells (0 to 1.0 × 104) were seeded directly onto confluent human osteoblast monolayers (HOB) in 96-well tissue culture plates containing 1% FBS. At 96 hours, conditioned medium was collected and assayed for IL-6 by ELISA. Data from a representative of three experiments are presented as the mean ± standard deviation for triplicate determinations. *Significant difference from no CD34+ cell control (HOB) to a statistical significance of P < .05.
|
|
Cell-to-cell contact between CD34 cells is not required for increased IL-6 synthesis.
To evaluate whether direct contact between osteoblasts and hematopoietic cells is required for the augmented production of IL-6, CD34+ bone marrow cells were seeded either directly onto osteoblast monolayers or into the top chamber of dual-chambered culture plates that facilitate the free exchange of soluble molecules but physically separate the heterologous populations. As reported previously, significant increases in IL-6 production were observed when osteoblasts were cultured with CD34+ cells (Fig 4). Under conditions in which osteoblasts and hematopoietic cells were separated, a significant, albeit somewhat smaller increase in IL-6 production was observed relative to controls. These results suggest that either the osteoblasts or the hematopoietic cells produce soluble factor(s) that mediates the production of IL-6 by human osteoblasts (Fig 4).

View larger version (17K):
[in this window]
[in a new window]
| Fig 4.
Cell- to-cell contact is not required for elevated IL-6 synthesis. CD34+ bone marrow cells (CD34+; 1.0 × 104) were seeded either directly onto confluent osteoblast monolayers (HOB; contact cultures), the top chamber of dual-chambered 24-well plates with confluent primary human osteoblasts in the bottom chamber (noncontact), or alone (CD34+) in Ham's F12/DMEM (1:1 vol/vol) containing 1% FBS. In some cases, 2% paraformaldehyde was used to mildly fix the osteoblasts before the initiation of coculture experiments (fixed HOB). At 96 hours, conditioned medium was collected and assayed for IL-6 by ELISA. Data from a representative of three experiments are presented as the mean ± standard deviation for triplicate determinations. *Significant difference from HOB. +Significant difference from CD34+ or fixed HOB cultures to a statistical significance of P < .05.
|
|
Osteoblasts are primarily responsible for IL-6 synthesis in coculture with CD34+ bone marrow cells.
Alone, osteoblasts constitutively produce IL-6, but in coculture with CD34+ bone marrow cells, increased levels of IL-6 are observed. We next wanted to determine which of the cell populations were responsible for the enhanced IL-6 synthesis. We therefore determined whether viable osteoblasts were required for the augmented IL-6 levels. For these experiments, 2% paraformaldehyde was used to fix the osteoblasts before the initiation of the cocultures. As shown in Fig 4, alone or in the presence of fixed osteoblasts, CD34+ bone marrow cell-conditioned medium contained no immunodetectable IL-6.
To rule out the possibility that osteoblasts furnish signal(s) to the hematopoietic cells that indirectly stimulates the hematopoietic cells to produce IL-6, two types of experiments were performed. First, RT-PCR was performed to detect IL-6 mRNA on cells recovered from dual-chambered plates in which IL-6 protein levels are significantly elevated relative to osteoblasts cultured alone (Fig 4). As shown in Fig 5, IL-6 message was observed (1) in osteoblasts alone, (2) in osteoblasts and CD34+ cultured in direct contact, and (3) in osteoblasts isolated from the bottom of the dual-chambered culture wells. IL-6 mRNA was not observed in CD34+ bone marrow cells isolated from the top of the dual-chambered culture wells in which enhanced IL-6 protein synthesis was observed (Fig 4). In the second type of experiment, CD34+ cell-conditioned medium was collected and placed on osteoblasts. Under these conditions, CD34+ cell-conditioned medium alone stimulated augmented IL-6 production by the human osteoblasts (Fig 6).

View larger version (76K):
[in this window]
[in a new window]
| Fig 5.
RT-PCR detection of IL-6 mRNA. RT-PCR was performed (35 cycles) to detect mRNA for -actin and IL-6 from cells recovered from dual-chambered plates at 96 hours in which IL-6 protein levels were known. Primers were designed to cross intron/exon boundaries. Negative controls included omitting reverse transcriptase (not shown) from the reverse transcription reaction or using H2O. Results from two independent experiments are presented. mRNA from osteoblasts only (HOB), mRNA from osteoblasts and CD34+ cells in coculture (contact), mRNA from osteoblasts recovered from dual-chambered coculture (HOB noncontact), and mRNA from CD34+ cells recovered from dual-chambered coculture (CD34+ non-contact).
|
|

View larger version (12K):
[in this window]
[in a new window]
| Fig 6.
Human CD34+ bone marrow cell-conditioned medium stimulates elevated IL-6 synthesis. Bone marrow CD34+ bone cell-conditioned medium (CM) was prepared as detailed in the Materials and Methods over a 72-hour (0, 24, 48, and 72 hours) period. CM (80% vol/vol) was assayed for IL-6 stimulatory activity on confluent human osteoblast monolayers (HOB) grown in 96-well tissue culture plates at 72 hours by ELISA. Data from a representative of three experiments are presented as the mean ± standard deviation for triplicate determinations. IL-6 levels of CM before HOB exposure were 6 pg/mL (CD34 72 H CM). Basal production of IL-6 by HOB cells (HOB + 0 H CM). +Significant difference from CD34+ conditioned medium alone. *Significant difference from HOB basal levels.
|
|
IL-1 and TNF- production by CD34+ cells is not responsible for increased IL-6 synthesis by human osteoblasts.
We next hypothesized that IL-1 or TNF- was responsible for the soluble activity produced by the CD34+ cells that stimulates IL-6 production by human osteoblasts. To address this issue, conditioned CD34+ cell medium was assayed by ELISA to determine to what level IL-1 and TNF- were present in the culture supernatants. IL-1 levels were below the level of detection under the conditions of the assay (assay range, 3.9 to 250 pg/mL). Similarly, we found that TNF- levels were less than 6 pg/mL (assay range, 6 to 1,024 pg/mL). Next, we evaluated whether IL-1 and TNF- neutralizing antibodies would inhibit the increase in IL-6 levels. For these experiments, daily addition of neutralizing monoclonal antibodies at concentrations at or greater than 10 times the anticipated neutralizing dose reported by the manufacturer were used. We observed no significant reductions in IL-6 levels in the presence of the neutralizing antibodies (Fig 7). Therefore, based on the extremely low levels of IL-1 or TNF- produced by the hematopoietic cells and the neutralizing antibody investigations, it is unlikely that IL-1 or TNF- were responsible for increased IL-6 synthesis by human osteoblasts.

View larger version (20K):
[in this window]
[in a new window]
| Fig 7.
IL-1 and TNF- production by CD34+ cells is not primarily responsible for increased IL-6 synthesis by HOB cells. Bone marrow CD34+ cells (0 to 1.0 × 104) were seeded directly onto confluent human osteoblast monolayers (HOB) in 96-well tissue culture plates containing 1% FBS. For these experiments, daily addition of murine neutralizing monoclonal IgG1 antibodies to human IL-1 , TNF- , isotype-matched control, or vehicle were added at concentrations approaching 10 times the anticipated neutralizing dose (ND50 ) reported by the manufacturer (10 µg/mL). At 96 hours, conditioned medium was collected and assayed for IL-6 by ELISA. Data from a representative of two experiments are presented as the mean ± standard deviation for triplicate determinations.
|
|
 |
DISCUSSION |
Because events localized to endosteal surfaces are probably critical for the maintenance of early hematopoietic cells in vivo, we have begun to explore this unique tissue compartment at the cellular and molecular level with several models of endosteal hematopoiesis.24-29 Based on the knowledge that hematopoiesis is facilitated by close associations with cells of the stromal cell microenvironment3,9,19,22,30,31 and that osteoblasts are present on endosteal surfaces, we hypothesized that affiliations between osteoblasts and hematopoietic cells might stimulate production of factors required for normal hematopoiesis. In the present study, we examined the ability of normal human CD34+ bone marrow progenitor cells for their ability to stimulate the production of cytokines by primary human osteoblasts.
We determined that human CD34+ hematopoietic bone marrow progenitors stimulate human osteoblasts to produce IL-6 but not soluble levels of G-CSF, GM-CSF, or TGF- 1 to the limits of the assays. The augmented production of IL-6 over basal levels correlated well with the CD34+ cell number where the most rapid rate in protein accumulation occurred during the initial 24-hour period. Based on RT-PCR and in situ fixation, it seems unlikely that the blood cells themselves were directly responsible for the augmented IL-6 production. However, we determined that CD34+ cells are metabolically engaged in the production of IL-6, because CD34+ cells that are prevented from direct contact with osteoblasts stimulate the secretion of IL-6 to levels roughly comparable to those in which direct contact is permitted. The nature of the molecules/signals produced by CD34+ cells that stimulate osteoblast-derived IL-6 remains to be determined.
Previous studies have shown that osteoblasts produce IL-6,31-38 but its role in mineralized tissue metabolism remains uncertain. Under basal conditions, most human osteoblasts examined produce IL-6 levels that can be enhanced by steroids or proinflammatory mediators, including IL-1 or TNF with marked synergism.34,39-44 For these reasons, we evaluated whether CD34+ cells stimulate IL-6 production by IL-1 - or TNF- -dependent pathways. We found that the activity produced by CD34+ cells is not likely due to IL-1 or TNF- . Because IL-6 is believed to uncouple bone resorption from bone formation by activating osteoclastic activity45 while inhibiting osteoblastic activity,46 determining the identity of the CD34+ cell-derived activities may be of great clinical importance.
Like those effects observed on mineralized tissue, IL-6 has multiple activities on hematopoietic cells. Alone, IL-6 has some proliferative activity on early hematopoietic cells,47 but, in combination with IL-3, IL-1, and c-kit ligand, it exerts synergistic activity by recruiting cells out of Go and promoting the transition to G1 .48,49 On other populations, IL-6 facilitates the development of burst-forming unit-erythroid and multipotent colony-forming units (colony-forming unit granulocyte, erythroid, monocyte, megakaryocyte) from hematopoietic progenitors.50 IL-6 is also a critical regulator of B-cell differentiation into plasma cells.51 Furthermore, IL-6 is a potent growth factor for plasmacytoma and myeloma cells in which overproduction of IL-6 is associated with progressive disease.52,53 Although both autocrine and paracrine IL-6 production has been reported, in most cases it appears that cells of the tumor microenvironment are largely responsible for IL-6 synthesis rather than the tumor cells.52-56 For example, Barillé et al54 showed that coculture of XG1 and XG6 myeloma cell lines induces the production of IL-6 by several human osteosarcoma cell lines (MG-63 and SaOS-2), possibly through activation of an NF- B pathway.57 However, curiously, the production of an osteoblast-specific protein (osteocalcin) was reduced in an autocrine-like manner as anti-IL-6 antibodies reversed the decreases in osteocalcin synthesis.54 That stimulated osteoblast synthesis of IL-6 can be viewed as a generalized feature of osteoblast-hematopoietic metabolism and not restricted to B-cell neoplasms alone is suggested by the demonstration that some human osteosarcomas (HOS cells) secrete IL-6 in response to the adherence of human T cells and/or by crosslinking intercellular adhesion molecule-1 and vascular cell adhesion molecule-1.58 Thus, the observations that (1) osteoblasts stimulate myeloma cell proliferation by producing IL-6 in response to the tumor cells themselves, while at the same time (2) IL-6 inhibits bone formation in an autocrine fashion suggest that the relationships we have observed among normal cells can be co-opted by tumor cells.
Recent experimentation suggests that close associations between hematopoietic cells and stromal cells are important for maintaining hematopoiesis in vivo, although they are probably not an absolute requirement in vitro.59 When hematopoietic cells are in direct contact with stromal cells, cell-to-cell adhesive molecules, stromal cell-associated or extracellular matrix-associated factors, and/or soluble growth factors probably all cooperate in stimulating blood cell proliferation and/or maintenance. The importance of this relationship is illustrated by the observation that, if the two tissues are separated by more than a few millimeters in vitro, a decline in LTC-IC and progenitor cell populations may ensue.13,60 The basis for stromal cell support of hematopoietic cells that are not in intimate contact with the parenchymal cells of the marrow is not clear but may involve high molecular weight proteoglycans.59 Alternatively, these observations suggest that molecules critical for hematopoiesis are either short-lived and/or require high local concentrations for function.13 The nature of those molecules responsible for the enhanced IL-6 production remains to be determined.
In summary, we determined that CD34+ bone marrow cells had no significant effect on osteoblast-secretion of G-CSF, GM-CSF, and TGF- 1 . When CD34+ bone marrow cells were cocultured with osteoblasts, augmented IL-6 synthesis was observed. The accumulation of IL-6 was most rapid during the initial 24-hour period and cell-to-cell contact does not appear to be required for this activity. As important as de novo cytokine synthesis by stromal cells or osteoblasts may be after blood cell binding, it will be difficult to differentiate experimentally between these tissue interactions from activities generated from the engagement of receptor-counterreceptor molecules on the hematopoietic cells themselves. Nevertheless, local resident cells responding to the requirements of hematopoietic cells represent hematopoietic regulation of the bone marrow microenvironment. Our finding that CD34+ hematopoietic cells induce IL-6 production by osteoblasts, not necessarily requiring direct cell-cell contact, suggests that the interaction between these two cell types may be similarly coupled as are those between other members of the stromal cell family and blood cells. To our knowledge, these data represent the first demonstration that normal hematopoietic progenitor CD34+ cells induce the production of hematopoietic growth factors, in this case IL-6, by cells of the bone marrow microenvironment.
 |
FOOTNOTES |
Submitted March 13, 1996;
accepted September 26, 1996.
Supported in part by National Institutes of Health Grants. S.G.E. is supported by a Scholar Award from the Leukemia Society of America.
Address reprint requests to Russell S. Taichman, DMD, DMSc, Department of Periodontics, Prevention, Geriatrics, University of Michigan School of Dentistry, 1011 N University Ave, Ann Arbor, MI 48109-1078.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hearly marked
``advertisment'' in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
 |
ACKNOWLEDGMENT |
The authors are indebted to Dr T. Frank and the members of the Surgical Pathology Department for their help in obtaining bone tissues, to Dr M. Baird and M. Tuck for bone marrow, and to Drs J.A. D'Errico and G.H. Sam for helpful discussions.
 |
REFERENCES |
1.
Lord BI:
The architecture of bone marrow cell populations.
Int J Cell Cloning
8:317,
1990[Medline]
[Order article via Infotrieve]
2.
Hermans MN,
Hartsuiker H,
Opstelten D:
An in situ study of B-lymphocytopoiesis in rat bone marrow. Topographical arrangement of terminal deoxynucleotidyl transferase-positive cells and pre-B cells.
J Immunol
142:67,
1989[Abstract]
3.
Robey PG,
Termine JD:
Human bone cells in vitro.
Calcif Tiss Intl
37:453,
1985[Medline]
[Order article via Infotrieve]
4.
Taichman RS,
Emerson SG:
Human osteoblasts support hematopoiesis through the production of granulocyte colony-stimulating factor.
J Exp Med
179:1677,
1994[Abstract/Free Full Text]
5.
Marie PJ,
Hott M,
Launay JM,
Grraulet AM,
Gueris J:
In vitro production of cytokines by bone surface-derived osteoblastic cells in normal and osteoporotic postmenopausal women: Relationship with cell proliferation.
J Clin Endocrinol Metab
77:824,
1993[Abstract]
6.
Marusic A,
Kalinowski J,
Jastrzebski S,
Lorenzo J:
Production of leukemia inhibitory factor mRNA and protein by malignant and immortalized bone cells.
J Bone Min Res
8:617,
1993[Medline]
[Order article via Infotrieve]
7.
Ohtsuki T,
Suzu S,
Nagata N,
Motoyshi K:
A human osteoblastic cell line, MG-63, produces two molecular types of macrophage-colony-stimulating factor.
Biochem Biophys Acta
1136:297,
1992[Medline]
[Order article via Infotrieve]
8.
Ohtsuki T,
Suzu S,
Hatake K,
Nagata N,
Miuri Y,
Motoyoshi K:
A proteoglycan form of macrophage colony-stimulating factor that binds to bone-derived collagens and can be extracted from bone matrix.
Biochem Biophys Res Commun
190:215,
1993[Medline]
[Order article via Infotrieve]
9.
Lacey DL,
Erdmann JM,
Shima M,
Kling S,
Matayoshi A,
Ohara J,
Perkins SL:
Interleukin 4 enhances osteoblast macrophage colony-stimulating factor, but not interleukin 6, production.
Cal Tissue Int
55:21,
1994
10.
Gowen M,
Chapman K,
Littlewood A,
Hughes D,
Evans D,
Russell RGG:
Production of TNF by human osteoblasts is modulated by other cytokines but not by osteopetrotic hormones.
Endocrinology
126:1250,
1990[Abstract/Free Full Text]
11.
Taichman RS,
Reilly MJ,
Emerson SG:
Human osteoblasts support human progenitor cells in in vitro bone marrow cultures.
Blood
87:518,
1996[Abstract/Free Full Text]
12.
Yoshikubo T,
Ozawa K,
Takahashi K,
Nishikawa M,
Horiuchi N,
Tojo A,
Tani K,
Kodama H,
Asano S:
Adhesion of NFS-60 myeloid leukemia cells to MC3T3-G2/PA6 stromal cells induces granulocyte colony-stimulating factor production.
Blood
84:415,
1994[Abstract/Free Full Text]
13.
Verfaillie CM:
Direct contact between human primitive hematopoietic progenitors and bone marrow stroma is not required for long-term in vitro hematopoiesis.
Blood
79:2821,
1992[Abstract/Free Full Text]
14. Gordon MY, Bearpark AD, Clark D, Baum SJ, Kicke KA, Lotzova E: Extracellular matrix glycoproteins may regulate the local concentrations of different hemopoietic growth factors, in Baum SJ, Ledney GD, van Bekkum DW (eds): Experimental Hematology Today. New York, NY, Springer-Verlag, 1988, p 31
15.
Huang E,
Nocka K,
Beier DR,
Chu TY,
Buck J,
Lahm HM,
Wellner D,
Leder P,
Besmer P:
The hematopoietic growth factor KL is encoded by the Sl locus and is the ligand of the c-kit receptor, the gene product of the W locus.
Cell
63:225,
1990[Medline]
[Order article via Infotrieve]
16.
Celest AJ,
Rosen V,
Buecker JL,
Kris R,
Wang EA,
Wozney JM:
Isolation of the human gene for bone gla protein utilizing mouse and rat cDNA clones.
EMBO J
5:1885,
1986[Medline]
[Order article via Infotrieve]
17.
Hirano T,
Yasukawa K,
Harada H,
Taga T,
Watanabe Y,
Matsuda T,
Kashiwamura SI,
Nakajima K,
Koyama K,
Iwamatsu A,
Tsunasawa S,
Sakiyama F,
Matsui H,
Takahara Y,
Taniguchi T,
Kishimoto T:
Complementary DNA for a novel interleukin (BSF-2) that induces B lymphocytes to produce immunoglobin.
Nature
234:73,
1986
18.
Ponte P,
Ng SY,
Engel J,
Gunning P,
Kedes L:
Evolutionary conservation in the untranslated regions of actin mRNAs: DNA sequence of a human beta-actin cDNA.
Nucleic Acids Res
12:1687,
1984[Abstract/Free Full Text]
19. Metcalf D: The Molecular Control of Blood Cells. Cambridge, MA, Harvard, 1988
20.
Ruscetti RW,
Jacobsen SE,
Birchenall-Robers M,
Broxmeyer HE,
Engelmann GL,
Dubois C,
Keller JR:
Role of transforming growth factor-beta 1 in regulation of hematopoiesis.
Proc Natl Acad Sci USA
628:31,
1991
21.
Keller JR,
Bartelmez SH,
Sitnicka E,
Ruscetti FW,
Ortiz M,
Gooya JM,
Jacobsen SE:
Distinct and overlapping direct effects of macrophage inflammatory protein-1 alpha and transforming growth factor beta on hematopoietic progenitor/stem cell growth.
Blood
84:2175,
1994[Abstract/Free Full Text]
22.
Moses HL,
Yang EY,
Pietenpol JA:
TGF-beta stimulation and inhibition of cell proliferation: New mechanistic insights.
Cell
63:245,
1990[Medline]
[Order article via Infotrieve]
23.
Mayani H,
Little MT,
Dragowska W,
Thornbury G,
Lansdorp PM:
Differential effects for the hematopoietic inhibitors MIP-1 alpha, TGF-beta and TNF-alpha on cytokine-induced proliferation of subpopulations of CD34+ cells purified from cord blood and fetal liver.
Exp Hematol
23:422,
1995[Medline]
[Order article via Infotrieve]
24. Dexter TM, Coutinhot LH, Spooncer E: Stromal cells in haemopoiesis, in Bock G, Marsh J (eds): Molecular Control of Haemopoiesis. Ciba Foundation Symposium. New York, NY, Wiley, 1990, p 76
25.
Toksoz D,
Zsebo KM,
Smith KA,
Hu S,
Brankow D,
Suggs SV,
Martin FH,
Williams DA:
Support of human hematopoiesis in long-term bone marrow cultures by murine stromal cells selectively expressing the membrane-bound and secreted forms of the human homolog of the steel gene product, stem cell factor.
Proc Natl Acad Sci USA
89:7350,
1992[Abstract/Free Full Text]
26.
Kincade PW,
Witte PL,
Landreth KS:
Stromal cell and factor-dependent B lymphopoiesis in culture.
Curr Top Microbiol Immunol
135:1,
1987[Medline]
[Order article via Infotrieve]
27.
Johnson A,
Dorshkind K:
Stromal cells in myeloid and lymphoid long-term bone marrow cultures can support multiple hemopoietic lineages and modulate their production of hemopoietic growth factors.
Blood
68:1348,
1986[Abstract/Free Full Text]
28.
Guba SC,
Sartor CI,
Gottschalk LR,
Ye-Hu J,
Mulligan T,
Emerson SC:
Bone marrow stromal fibroblasts secrete interleukin-6 and granulocyte-macrophage colony-stimulating factor in the absence of inflammatory stimulation: Demonstration by serum-free bioassay, enzyme-linked immunoabsorbant assay and reverse transcriptase polymerase chain reaction.
Blood
80:1190,
1992[Abstract/Free Full Text]
29. Kittler E, Quesenberry PJ: Stromal cells and clinical implications, in Long MW, Wicha MS (eds): The Hematopoietic Microenvironment: Functional Basis of Blood Cell Development. Baltimore, MD, John Hopkins, 1993, p 49
30.
Deldar A,
Lewis H,
Weiss L:
Bone lining cells and hematopoiesis: An electron microscopic study of canine bone marrow.
Anat Rec
213:187,
1985[Medline]
[Order article via Infotrieve]
31.
Littlewood AJ,
Russell J,
Harvey GR,
Hughes DE,
Russell RG,
Gowen M:
The modulation of the expression of IL-6 and its receptor in human osteoblasts in vitro.
Endocrinology
129:1513,
1991[Abstract/Free Full Text]
32.
Ishimi Y,
Miyaura C,
Jin CH,
Akatsu T,
Abe E,
Nakamura Y,
Yamaguchi A,
Yoskik S,
Matsuda T,
Hirano T,
Kishimoto T,
Suda T:
IL-6 is produced by osteoblasts and induces bone resorption.
J Immunol
145:3297,
1990[Abstract]
33.
Feyen JHM,
Elford P,
DiPadova FE,
Trechsel U:
Interleukin-6 is produced by bone and modulated by parathyroid hormone.
J Bone Miner Res
4:633,
1989[Medline]
[Order article via Infotrieve]
34.
Linkhart TA,
Linkhart SG,
MacCharles DC,
Long DL,
Strong DD:
Interleukin-6 messenger RNA expression and interleukin-6 protein secretion in cells isolated from normal human bone: Regulation by interleukin-1.
J Bone Miner Res
6:1285,
1991[Medline]
[Order article via Infotrieve]
35.
Zheng MH,
Wood DJ,
Wysocki S,
Papadimitriou JM,
Wang EA:
Recombinant human bone morphogenic protein-2 enhances expression of interleukin-6 and transforming growth factor-beta 1 genes in normal human osteoblast-like cells.
J Cell Physiol
159:76,
1994[Medline]
[Order article via Infotrieve]
36.
Lowik CWGM,
van der Pluijm G,
Bloys H,
Hoekman K,
Bijvoet OLM,
Aarden LA,
Papapoulos SE:
Parathyroid hormone (PTH) and PTH-like protein (PLP) stimulate interleukin-6 production by osteogenic cells: Possible role of interleukin-6 in osteoclastogenesis.
Biochem Biophys Res Communh
162:1546,
1989[Medline]
[Order article via Infotrieve]
37.
Littlewood AJ,
Hughes DE,
Aardent LA,
Russell RGG,
Gowen M:
Cytokines but not osteotropic hormones induce IL-6 release from human osteoblast-like cells in vitro.
Bone
11:215,
1990
38.
Rifas L,
Kenney JS,
Marcelli M,
Pacifici R,
Cheng SL,
Dawson LL,
Avioli LV:
Production of interleukin-6 in human osteoblasts and human bone marrow stromal cells: Evidence that induction by interleukin-1 and tumor necrosis factor-alpha is not regulated by ovarian steroids.
Endocrinology
136:4056,
1995[Abstract]
39.
Chaudhary LR,
Spelsberg TC,
Riggs BL:
Production of various cytokines by normal human osteoblast-like cells in response to interleukin-1 beta and tumor necrosis factor-alpha: Lack of regulation by 17 beta-estradiol.
Endocrinology
130:2528,
1992[Abstract/Free Full Text]
40.
Passeri G,
Girasole G,
Jilka RL,
Manolagas SC:
Increased interleukin-6 production by murine bone marrow and bone cells after estrogen withdrawal.
Endocrinology
133:822,
1993[Abstract/Free Full Text]
41.
Stein B,
Yang MX:
Repression of the interleukin-6 promotor by estrogen receptor is mediated by NF-kappa B and C/EBP beta.
Mol Cell Biol
15:4971,
1995[Abstract]
42.
Littlewood AJ,
Aarden LA,
Evan DB,
Russell RG,
Gowen M:
Human osteoblast-like cells do not respond to interleukin-6.
J Bone Miner Res
6:141,
1991[Medline]
[Order article via Infotrieve]
43.
Hughes FJ,
Howells GL:
Interleukin-6 inhibits bone formation in vitro.
Bone Miner
21:21,
1993[Medline]
[Order article via Infotrieve]
44.
Guerne PA,
Zuraw BL,
Vaughan JH,
Carson DA,
Lotz M:
Synovium as a source of interleukin 6 in vitro. Contribution to local and systemic manifestations of arthritis.
J Clin Invest
83:585,
1989
45.
Lowik CW,
van der Pluijm G,
Bloys H,
Hoekman K,
Bijvoet OL,
Aarden LA,
Papapoulos SE:
Parathyroid hormone (PTH) and PTH-like protein (PLP) stimulate interleukin-6 production by osteogenic cells: A possible role of interleukin-6 in osteoclastogenesis.
Biochem Biophys Res Commun
162:1546,
1989
46.
Greenfield EM,
Shaw SM,
Gornik SA,
Banks MA:
Adenylate cyclase and interleukin 6 are downstream effectors of parathyroid hormone resulting in stimulation of bone resorption.
J Clin Invest
96:1238,
1995
47.
Biesecker LG,
Emerson SG:
Interleukin-6 is a component of human umbilical cord serum and stimulates hematopoiesis in embryonic stem cells in vitro.
Exp Hematol
21:774,
1993[Medline]
[Order article via Infotrieve]
48.
Michaelevicz R,
Lifshitz D,
Revel M:
Interferon beta 2/interleukin-6 and interleukin-3 synergize in stimulating proliferation of human early progenitor cells.
Scanning Microscope
3:1143,
1989
49.
Ogawa M:
IL-6 and haematopoietic stem cells.
Res Immunol
143:749,
1992[Medline]
[Order article via Infotrieve]
50.
Tsujino Y,
Wada H,
Misawa M,
Kai S,
Hara H:
Effect of mast cell growth factor, interleukin-3, and interleukin-6 on human primitive hematopoietic progenitors from bone marrow and cord blood.
Exp Hematol
21:1379,
1993[Medline]
[Order article via Infotrieve]
51. Hirano T, Mertelsmann R, Herrmann F: Interleukin-6 in immune response and hematopoiesis, in Mertelsmann R, Herrmann F (eds): Hematopoietic Growth Factors in Clinical Applications. New York, NY, Marcel Dekker, 1990, p 471
52.
Klein B,
Zhang XG,
Lu ZY,
Bataille R:
Interleukin-6 in human multiple myeloma.
Blood
85:863,
1995[Free Full Text]
53.
Uchiyama H,
Barut BA,
Mohrbacjer AF,
Chauhan D,
Anderson KC:
Adhesion of human myeloma-derived cell lines to bone marrow stromal cells stimulates interleukin-6 secretion.
Blood
82:3712,
1993[Abstract/Free Full Text]
54.
Barillé S,
Collette M,
Bataille R,
Amiot M:
Myeloma cells upregulate interleukin-6 secretion in osteoblastic cells through cell-to-cell contact but downregulate osteocalcin.
Blood
86:3151,
1995[Abstract/Free Full Text]
55.
Kubota A,
Okamura S,
Shimoda K,
Niho Y:
Augmented production of interleukin 6 by co-culture of human bone marrow adherent cells and human leukemic cells.
Biomed Pharmacother
47:379,
1993[Medline]
[Order article via Infotrieve]
56.
Jarvis LJ,
LeBien TW:
Stimulation of human bone marrow stromal cell tyrosine kinases and IL-6 production by contact with B lymphocytes.
J Immunol
155:2359,
1995[Abstract]
57.
Chauhan D,
Uchiama H,
Akbarali Y,
Urashima M,
Yamamoto K,
Libermann TA,
Anderson KC:
Multiple myeloma cell adhesion-induced interleukin-6 expression in bone marrow stromal cells involves activation of NF-kB.
Blood
87:1104,
1996[Abstract/Free Full Text]
58.
Tanaka Y,
Morimoto I,
Nakano Y,
Okada Y,
Hirota S,
Nomura S,
Nakamura T,
Eto S:
Osteoblasts are regulated by the cellular adhesion through ICAM-1 and VCAM-1.
J Bone Miner Res
10:1462,
1995[Medline]
[Order article via Infotrieve]
59. Gupta P, McCarthy JB, Verfaillie CM: Stromal derived, anionic macromolecule(s) in combination with subliminal amounts of cytokines support the in vitro maintenance and differentiation of primitive human LTC-IC. Blood 82:21a, 1993 (abstr, suppl 1)
60.
Dexter TM,
Spooncer E:
Growth and differentiation in the hemopoietic system.
Annu Rev Cell Biol
3:432,
1987

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
J. Lorenzo, M. Horowitz, and Y. Choi
Osteoimmunology: Interactions of the Bone and Immune System
Endocr. Rev.,
June 1, 2008;
29(4):
403 - 440.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. J. Dibner, J. D. Richards, M. L. Kitchell, and M. A. Quiroz
Metabolic Challenges and Early Bone Development
J. Appl. Poult. Res.,
January 1, 2007;
16(1):
126 - 137.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. S. Taichman
Blood and bone: two tissues whose fates are intertwined to create the hematopoietic stem-cell niche
Blood,
April 1, 2005;
105(7):
2631 - 2639.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Visnjic, Z. Kalajzic, D. W. Rowe, V. Katavic, J. Lorenzo, and H. L. Aguila
Hematopoiesis is severely altered in mice with an induced osteoblast deficiency
Blood,
May 1, 2004;
103(9):
3258 - 3264.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Majka, A. Janowska-Wieczorek, J. Ratajczak, K. Ehrenman, Z. Pietrzkowski, M. A. Kowalska, A. M. Gewirtz, S. G. Emerson, and M. Z. Ratajczak
Numerous growth factors, cytokines, and chemokines are secreted by human CD34+ cells, myeloblasts, erythroblasts, and megakaryoblasts and regulate normal hematopoiesis in an autocrine/paracrine manner
Blood,
May 15, 2001;
97(10):
3075 - 3085.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Mbalaviele, N. Jaiswal, A. Meng, L. Cheng, C. Van Den Bos, and M. Thiede
Human Mesenchymal Stem Cells Promote Human Osteoclast Differentiation from CD34+ Bone Marrow Hematopoietic Progenitors
Endocrinology,
August 1, 1999;
140(8):
3736 - 3743.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
P. Gupta, B. R. Blazar, K. Gupta, and C. M. Verfaillie
Human CD34+ Bone Marrow Cells Regulate Stromal Production of Interleukin-6 and Granulocyte Colony-Stimulating Factor and Increase the Colony-Stimulating Activity of Stroma
Blood,
May 15, 1998;
91(10):
3724 - 3733.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|