Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stetler-Stevenson, M.
Right arrow Articles by Stetler-Stevenson, W. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stetler-Stevenson, M.
Right arrow Articles by Stetler-Stevenson, W. G.
Related Collections
Right arrow Neoplasia
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 89 No. 5 (March 1), 1997: pp. 1708-1715

Expression of Matrix Metalloproteinases and Tissue Inhibitors of Metalloproteinases in Reactive and Neoplastic Lymphoid Cells

By Maryalice Stetler-Stevenson, Adnan Mansoor, Megan Lim, Paula Fukushima, John Kehrl, Gerald Marti, Konrad Ptaszynski, Jiun Wang, and William G. Stetler-Stevenson

From the Flow Cytometry Unit, Hematopathology Section and Extracellular Matrix Pathology Section, Laboratory of Pathology, the Division of Clinical Sciences, National Cancer Institute, Bethesda; the Laboratory of Immunoregulation, National Institute of Allergy and Infectious Disease, National Institutes of Health, Bethesda; and the Flow and Image Cytometry Section, Laboratory of Medical and Molecular Genetics, the Division of Cell and Gene Therapies, CBER-FDA, Bethesda, MD.


    ABSTRACT
Abstract
Introduction
Methods
Results
Discussion
References

We have studied the expression of gelatinase A, gelatinase B, interstitial collagenase, tissue inhibitor of metalloproteinase (TIMP)-1 and TIMP-2 in reactive lymphoid cells, as well as in a series of cell lines derived from neoplasms of B- and T-cell lineage. Using both Northern blot analysis and zymography, gelatinase B activity was detected by zymography in two Burkitt cell lines and in a tonsillar cell suspension, while gelatinase A and interstitial collagenase activities were not detected by either method. TIMP-1 expression was demonstrated by Northern blot analysis in the multipotential neoplastic K-562 cell line, the high grade Burkitt's B-cell lymphoma lines, isolated tonsillar B cells and at low levels in peripheral blood T cells, but was not expressed in any of the neoplastic T-cell lines or isolated peripheral blood B cells. In contrast, TIMP-2 expression was restricted to tissues containing cells of T-cell lineage with high levels being observed in the neoplastic T-cell lines and lower levels in normal peripheral blood T cells and hyperplastic tonsil. Expression of TIMP-1 and TIMP-2 was confirmed at the protein level by reverse zymography and immunofluorescence assays using antihuman TIMP polyclonal antibodies. Expression of gelatinase B by the high grade B-cell Burkitt's lymphoma cell lines is consistent with previous findings in large cell immunoblastic lymphomas and indicates that this enzyme may play an important role in high grade non-Hodgkin's lymphomas. TIMP expression correlated with cell lineage in that TIMP-1 was primarily observed in B cells and TIMP-2 was restricted to T cells.

    INTRODUCTION
Abstract
Introduction
Methods
Results
Discussion
References

THE MATRIX metalloproteinase (MMP) family of enzymes are a group of structurally related zinc metallo-enzymes, which characteristically degrade components of the extracellular matrix.1-6 The elevated activity of these MMP enzymes has been associated with a variety of physiologic and pathologic conditions, including ovulation, blastocyst implantation, as well as invasion and metastasis in solid tumors.7-10 The activity of these enzymes appears dependent on a balance between the production of latent enzyme, activation of latent enzyme, and production of the naturally occurring inhibitors, most notably the tissue inhibitors of metalloproteinases (TIMPs).11-13 It is now apparent that this balance of MMP activity and TIMP's expression is a critical determinant of the invasive potential of many solid tumors.

In addition to their role in blocking MMP activity, TIMPs may have additional growth factor-like properties. Both TIMP-1 and TIMP-2 have been demonstrated to have erythroid-potentiating activity, as measured in the in vitro erythroid burst formation assay.14,15 In the pluripotential hematopoietic cell line K562, induction of differentiation by phorbol esters results in TIMP-1 expression.16 In addition, TIMP-1 has a demonstrated growth-promoting action in this cell line,17 and thus may function as an autocrine growth factor for these cells. TIMP-1 and TIMP-2 are reported to have a growth promoting activity in a wide range of cell lines.17-19 In cell lines, growth ceased in serum-free media, but was stimulated after supplementation of the media with 100 ng/mL of TIMP-118 or as little as 10 ng/mL TIMP-2.19 Recently, we have shown that TIMP-2 stimulates fibroblast growth via a cAMP-dependent mechanism.20 Conversely, TIMP-2, but not TIMP-1, specifically inhibits the basic fibroblast growth factor (FGF )-stimulated proliferation of human microvascular endothelial cells by a mechanism independent of TIMP-2 protease inhibition.21 Therefore, in addition to their matrix metalloproteinase inhibiting activity, TIMPs may regulate growth of a variety of cells, including hematopoietic lineage cells.

Lymphoid neoplasms differ fundamentally from solid tumor neoplasms. Due to their role in immunosurveillance, lymphocytes are normally found throughout the organs and connective tissues of the body,22 and as such, have a normally invasive phenotype. Recent evidence suggests that matrix metalloproteinase activity may be involved in the transmigration of lymphocytes from the vascular compartment.23,24 Aggressive lymphoid neoplasms can be observed "invading" through the lymph node capsule and, in some cases, extensively involving the surrounding soft tissue.25 In addition, invasive behavior has been documented in neoplastic lymphoid cell lines using the membrane invasive culture system. This invasive behavior directly correlated with the expression of gelatinase A and associated metastatic behavior in severe combined immunodeficiency (SCID) mice was observed in cell lines expressing high levels of gelatinase A.26 Studies by Kossakowska et al27 demonstrate TIMP-1, but not TIMP-2 expression, in non-Hodgkin's lymphomas. TIMP-1 expression was localized to the stromal and endothelial cells by in situ hybridization. However, low level expression of TIMP-1 by the tumor cells could not be excluded. The expression of TIMP-1 did not correlate with gelatinase A or interstitial collagenase expression (gelatinase B expression was not studied in this report). Paradoxically, increased TIMP-1 expression was observed in high-grade non-Hodgkin's lymphomas and in advanced stage disease, leading the investigators to postulate that TIMP-1 may have lymphoid growth factor activity.27 Further studies by this group demonstrated an association between survival and gelatinase B, but not TIMP-1 expression in high-grade, large cell immunoblastic lymphomas.28 Uchijima et al29 recently observed that human T-cell leukemia virus type 1 (HTLV-1) and HTLV-2-infected cell lines express elevated levels of TIMP-1. They have proposed that TIMP-1 may be an autocrine growth factor produced by the infected cells and may actually modulate the clinical course in patients with adult T-cell leukemia. These studies suggest that gelatinases and TIMPs may be of importance in lymphomas. We have studied the expression of gelatinase A, gelatinase B, and interstitial collagenase, as well as TIMP-1 and TIMP-2 in reactive lymphoid cells and a series of cell lines derived from neoplasms of B-cell and T-cell lineage. These studies using cell lines and isolated lymphoid cells were performed to elucidate the possible involvement of matrix metalloproteinases and TIMPs in lymphoid neoplasms without the confounding influence of stromal and endothelial cells present in lymphoma tissue specimens.

    MATERIALS AND METHODS
Abstract
Introduction
Methods
Results
Discussion
References

Cell samples. Cell lines used in this study include those developed from Burkitt's lymphoma, follicular center cell neoplasms, and T-cell malignancies. The Burkitt cell lines, Jijoye, AG876, DW6, and PA682 were kindly provided by Dr Ian Magrath (Chief, Lymphoma Biology Section, Pediatric Branch, National Cancer Institute, National Institutes of Health, Bethesda, MD). The follicular center cell lymphoma-derived lines, SUDHL 6 and SUDHL 4, contain the t(14; 18) translocation characteristic of these neoplasms. The cell lines derived from T-cell neoplasms include Jurkat, Molt-4, and Peer-1. K562, a cell line derived from a patient with chronic myelogenous leukemia (CML) in blast crisis, is a poorly differentiated multipotential line that can differentiate into progenitors of erythrocytic, granulocytic, and monocytic series (obtained from American Tissue Culture Collection, Rockville, MD).

Cell suspensions were prepared from hyperplastic tonsilar tissue obtained from patients less than 15 years of age. Unprocessed tonsilar tissue contained 62% B cells and 19% T cells with the remainder of the population being comprised primarily of monocytic lineage cells. Tonsillar B cells30 were isolated as described. Tonsillar B cells were stimulated with Staphylococcus aureus Cowan strain I and phorbol 12-myristate 13-acetate with cell samples collected at 0, 4, and 24 hours of stimulation. Peripheral blood B cells were isolated as described,31 with the addition of magnetic beads conjugated to anti-CD19 (MACS, Miltenyi Biotec Inc, Auburn, CA).32

T cells were separated from peripheral blood mononuclear cells as previously described.33 Briefly, monocytes were allowed to adhere to plastic tissue culture plates followed by B-cell removal using a nylon wool column. Immunophenotypic analysis by flow cytometry showed greater than 90% T cells, less than 1% B cells, and natural killer cells comprising the remaining cell population. No monocytes were detected. T cells were stimulated with interleukin-2 (IL-2) plus phytohemaglutinin (PHA) for up to 9 days.

Conditioned media. The cell lines Jijoye, AG876, DW6, PA682, SUDHL-6, SUDHL-4, Jurkat, Molt-4, and Peer-1 were grown to 1.2 × 106 cells/mL at 37°C and 10% CO2 in AIM V media (GIBCO, Gaithersburg, MD) and conditioned media was collected after 48 hours. Tonsillar cell suspension and isolated peripheral blood T cells were cultured at 1.2 × 106 cells/mL at 37°C and 10% CO2 and conditioned media collected after 12 hours. AIM V media supports lymphoid cell line growth, but does not contain gelatinolytic activity (personal observation, M. Stetler-Stevenson, August 1992). Conditioned media was centrifuged at less than 1,000g for 8 minutes (Sorval centrifuge model RT6000; Dupont, Wilmington, DE) at 4°C to remove cells and then stored at -20°C.

Northern blot analysis. A total of 7.5 µg of total RNA, extracted from cell suspensions using RNAzol (Cinna/Biotecx Laboratories International, Inc, Friendswood, TX), was electrophoresed on 1% wt/vol agarose-formaldehyde gels before transfer onto nylon filters (Gene Screen Plus, Dupont, NEN Products, Boston, MA). The RNA was UV cross-linked to the filter and hybridized using standard conditions. Blots were hybridized with TIMP-1,34 TIMP-2,34 the 72-kD gelatinase A,7 interstitial collagenase,35 and GAPDH36 probes prepared as previously described. The cDNA probe for the 92-kD gelatinase B was prepared by polymerase chain reaction (PCR) using HT1080 cell cDNA and the following primers: 5' primer- GGGGGTACCAGACACCTCTGCCGTCACCAT; 3' primer-CCCGGTACCGCACAGCTCCCCCGCCGAGTT. These DNA probes were labeled with alpha [32P] dCTP using a random primer labeling kit (Bethesda Research Laboratories, Gaithersburg, MD). Filters were autoradiographed at -80°C.

Reverse transcriptase (RT)-PCR. c-DNA was prepared from isolated peripheral blood B cells and PA682 using 2 µg of RNA and the Superscriptase Preamplification system for first-strand cDNA synthesis (GIBCO-BRL, Gaithersburg, MD). cDNA was prepared from PA682 and the isolated tonsillar B cells using 2 µg of RNA as previously discribed.30 One tenth of the cDNA was used for each PCR reaction. A total of 2.5 U of Taq polymerase (GIBCO-BRL) and 0.8 µmol/L of each primer was used. The following TIMP-1 primers were used: ATAGTCGACATGGCCCCCTTTGAGCCCCTG (5'); GGAATTCCTCAGGCTATCTGGGACCGCAGGGA (3'). beta 2 -Microglobulin was amplified using previously discribed primers.37 The cDNA was denatured for 5 minutes at 94°C and then 20 cycles of PCR were performed as follows: 1 minute denaturation at 94°C, 1 minute annealing at 55°C, and 1 minute extension at 72°C with the exception of the last cycle in which extension was for 5 minutes. Peripheral blood B-cell cDNA was also amplified for 30 cycles. Products were analyzed by electrophoresis in 1.5% agarose gels and Southern blotting onto nylon membranes (Dupont, NEN Research, Boston, MA) before probing with 32P-labeled TIMP-1 cDNA probe.

Zymogram analysis. Gelatinolytic activity was assayed by electrophoresis in polyacrylamide gels containing sodium dodecyl sulfate (SDS) and gelatin as described by Heussen and Dowdle.38 Gelatin zymography is an exquisitely sensitive technique that is capable of detecting 10 pg of gelatinase enzyme.39 Briefly, 16-µL aliquots of conditioned media were suspended in sample buffer (50 mmol/L Tris-HCL, 2% SDS, 0.1% bromophenol blue, 10% glycerol, pH 6.8) and applied to 10% (wt/vol) acrylamide gels containing 1 mg/mL of gelatin (Novex, San Diego, CA) followed by electrophoresis at 20 mA/gel. Gels were then incubated in 2.5% (vol/vol) Triton X-100 for 60 minutes to remove SDS followed by overnight incubation in developing buffer (50 mmol/L Tris-HCl, 0.2 mol/L NaCl, 5 mmol/L CaCl2 , 0.02% (wt/vol) Brij-35, adjusted to pH 7.6). Gels were stained for 3 hours in 30% methanol, 10% glacial acetic acid, 0.5% Coomassie Blue G-250 (Bio-Rad, Richmond, CA), destained for 1.5 to 2 hours in 30% methanol, 10% glacial acetic acid, and dried overnight.

Reverse zymogram analysis. Metalloproteinase inhibitory activity was assayed by electrophoresis in polyacrylamide gels containing gelatin as matrix metalloproteinase substrate and HT1080 fibroblast culture-conditioned media as a source of matrix metalloproteinase as previously described.40 Briefly, 12% or 15% polyacrylamide gels (PAGE) were prepared with Tris-HCl containing 0.1% SDS, 2.5 mg/mL gelatin, and 10% (vol) HT1080 fibroblast culture-conditioned media. Aliquots of conditioned media (15 µL) were suspended in sample buffer (50 mol/L Tris-HCL, 2% SDS, 0.1% bromophenol blue, 10% glycerol, pH 6.8) and applied to gels followed by electrophoresis at 20 mA/gel. Gels were then incubated in 2.5% (vol/vol) Triton X-100 for 60 minutes to remove SDS followed by overnight incubation in developing buffer (50 mol/L Tris-HCl, 0.2 mol/L NaCl, 5 mmol/L CaCl2 , 0.02% (wt/vol) Brij-35, adjusted to pH 7.6). This restores the matrix metalloproteinase activity resulting in gelatin degradation. Gels were stained for 3 hours in 30% methanol, 10% glacial acetic acid, 0.5% Coomassie Blue G-250 (Bio-Rad, Richmond, CA), destained for 1.5 to 2 hours in 30% methanol, 10% glacial acetic acid, and dried overnight. TIMPs were visualized as bands of nondegraded gelatin staining positive with Coomassie Blue.

Immunofluorescence staining. Expression of TIMP-1 and TIMP-2 at the protein level was assessed by immunofluorescence analysis. For detection of TIMP-1 protein expression, fresh cytocentrifuge preparations fixed in 10% formalin and permeabilized in 0.01% Triton-X (Research Products Int, Elkgrove Village, IL), were subjected to affinity-purified rabbit polyclonal anti-TIMP-1 antibodies or preimmune rabbit serum for 30 minutes at 37°C followed by a fluorescein isothiocyanate (FITC)-conjugated goat antirabbit Ig antiserum. The immunofluorescence assay slides were analyzed on a Optihot-2 fluorescence microscope (Nikon Inc, Garden City, NJ) equipped with phase-contrast facilities. In addition, cells in suspension were stained for TIMP-1 and TIMP-2. Briefly, cells were fixed in 3.7% formalin, permeabilized in 0.1% saponin (Sigma, St Louis, MO) and stained with affinity-purified rabbit polyclonal anti-TIMP-1 or anti-TIMP2 antibodies followed by an FITC-conjugated goat antirabbit Ig antiserum. Preimmune rabbit serum followed by FITC-conjugated secondary, as well as secondary antibody alone, was used as negative controls. Analyses were performed on a FACScan flow cytometer (Becton Dickinson, San Jose, CA) as previously described.41 The TIMP-1 antibodies were kindly provided by Dr Benta Birkedahl-Hansen (Extracellular Matrix Pathology Section, Laboratory of Pathology, Division of Clinical Sciences, National Cancer Institute, National Institutes of Health, Bethesda, MD). The TIMP-2 antibodies have been previously characterized.34

    RESULTS
Abstract
Introduction
Methods
Results
Discussion
References

Neoplastic lymphoid cell lines. TIMP-1 transcripts (0.9 kb MW) were detected in all four Burkitt cell lines (Jijoye, AG876, DW6, and PA682) and in the multipotential neoplastic K562 line, but were not detected in the low-grade follicular center cell lymphoma cell lines (SUDHL-4 and SUDHL-6) or neoplastic T-cell lines (Fig 1). TIMP-1 protein expression was demonstrated by reverse zymography (Fig 2) and immunofluorescence assays (Fig 3). Although the expression of TIMP-1 was not definitively quantitated by these methods, a semiquantitative assessment of the levels of expression correlated well with the Northern blot data. Cytopreparations showed a globular cytoplasmic localization of the TIMP-1 (Fig 3A and B), consistent with cellular packaging for secretion. This is further supported by the demonstration that secreted and functional TIMP-1 is found in the conditioned media from these cell lines (Fig 2).


View larger version (53K):
[in this window]
[in a new window]
 
Fig 1. Northern blot analysis of TIMP-1 expression. A total of 7.5 µg of total RNA was electrophoresed on 1% wt/vol agarose-formaldehyde, transfered onto nylon filters, and hybridized with TIMP-1 and GAPDH. Filters were autoradiographed at -80°C. Radiographs were scanned by an AGFA Arcus flatbed scanner.


View larger version (58K):
[in this window]
[in a new window]
 
Fig 2. Reverse zymography for TIMP-1. A total of 15 µL of conditioned media was electrophoresed on 15% SDS polyacrylamide gels containing gelatin and HT1080 fibroblast culture-conditioned media. SDS was removed following electrophoresis and gels incubated to restore gelatinase activity. Gels were scanned by an AGFA Arcus flatbed scanner. Lane A, HT1080-conditioned media (positive control containing both TIMP-1 and TIMP-2); lane B, AG876; lane C, Jijoye; lane D, PA682; lane E, DW6.


View larger version (6K):
[in this window]
[in a new window]
 


View larger version (130K):
[in this window]
[in a new window]
 
Fig 3. TIMP-1 and TIMP-2 protein expression. (A) Molt-4 cytocentrifuge preparations stained with rabbit polyclonal anti-TIMP-1 followed by FITC-conjugated goat antirabbit antibodies. Excitation wavelength 490 nm. Original magnification × 630. Small intensely fluorescent structures are debris (too small for cells and no nuclear content on light microscopy). (B) K562 cytocentrifuge preparations stained with rabbit polyclonal anti-TIMP-1 followed by FITC-conjugated goat antirabbit antibodies. Excitation wavelenght 490 nm. Original magnification × 630. (C) Flow cytometric analysis of TIMP-2 expression in K562 cells. Cell number represented on Y-axis and fluorescence intensity on X-axis. Filled in histogram staining with nonimmunized rabbit serum (negative control), clear histogram staining with TIMP-2. Histograms overlap. (D) Flow cytometric analysis of TIMP-2 expression in Jurkat cells. Cell number represented on Y-axis and fluorescence intensity on X-axis. Filled in histogram staining with nonimmunized rabbit serum (negative control), clear histogram staining with TIMP-2.

TIMP-2 transcripts (1.0 and 3.5 kb) were detected at high levels in the neoplastic T-cell lines (Fig 4). Cellular TIMP-2 protein expression was detected in the neoplastic T-cell lines and isolated peripheral blood T cells by flow cytometric analysis (Fig 3C and D). Although the number of molecules of TIMP-1 and TIMP-2 expressed on the cell surface was not definitively quantitated by flow cytometric analysis, relative levels of expression were determined (fluorescent intensity) and again correlated well with the Northern blot data.


View larger version (69K):
[in this window]
[in a new window]
 
Fig 4. Northern blot analysis of TIMP-2. A total of 7.5 µg of total RNA was electrophoresed on 1% wt/vol agarose-formaldehyde, transfered onto nylon filters, and hybridized with TIMP-2 and GAPDH. Filters were autoradiographed at -80°C. Radiographs were scanned by an AGFA Arcus flatbed scanner.

Transcripts for gelatinase A, gelatinase B, and interstitial collagenase were not detected for any of the neoplastic cell lines or tissues studied, although they were readily detectable in control RNA preparations. Zymography, a more sensitive method to detect gelatinase activity, failed to demonstrate gelatinase A or interstitial collagenase in any cell lines studied. A 92-kD gelatinase activity consistent with gelatinase B was observed (Fig 5) in the Burkitt cell lines Jijoye and PA682, but was absent from the follicular center cell lines (SUDHL-4 and SUDHL-6) and the T-cell lines (Molt-4, Jurkat, and Peer 1).


View larger version (23K):
[in this window]
[in a new window]
 
Fig 5. Gelatin zymography for Gelatinase B. A total of 16 µL of conditioned media was electrophoresed on 10% SDS polyacrylamide gels containing gelatin. SDS was removed following electrophoresis and gels incubated to restore gelatinase activity. Gels were scanned by an AGFA Arcus flatbed scanner. Lane A, Gelatinase A; lane B, SUDHL-6; lane C, Molt-4; lane D, Jijoye; lane E, PA682; lane F, tonsil; lane G, HT1080-conditioned media (positive control for Gelatinase A and Gelatinase B.

Normal B and T cells. Having detected a differential pattern of TIMP-1 and TIMP-2 expression in neoplastic B- and T-cell lines, respectively, we undertook the examination of these protease inhibitors and associated MMPs in nonneoplastic B- and T-cell populations. Hyperplastic tonsils, isolated tonsillar B cells, and isolated peripheral blood B cells were studied. Unprocessed tonsillar tissue contained 62% B cells and 19% T cells with the remainder of the population being comprised primarily of monocytic lineage cells. TIMP-1 expression was detected in hyperplastic tonsils (Fig 1) and isolated tonsillar B cells, although it decreased under in vitro conditions, even with stimulation by Staphylococcus aureus Cowan strain I and phorbol 12-myristate 13-acetate for 24 hours (Fig 6). Unexpectedly, TIMP-1 transcripts could not be detected in isolated peripheral blood B cells using RT-PCR with high numbers of cycles (Fig 6). TIMP-2 transcripts (1.0 and 3.5 kb) were detected at low levels in tonsillar tissue (Fig 4). A 92-kD gelatinase activity consistent with gelatinase B was observed in the tonsillar cell suspension by gelatin zymography (Fig 5), although no signal for this protease was detected by Northern blot analysis. Gelatinase A and interstitial collagenase were not detected.


View larger version (46K):
[in this window]
[in a new window]
 
Fig 6. RT-PCR for TIMP-1. PCR amplification of TIMP-1 cDNA was performed for 20 cycles (except isolated peripheral blood B cells, 30 cycles shown). Lane 1, PA682 (positive control); lane 2, water (negative control); lanes 3 to 5, isolated tonsillar B cells at 0 hours (lane 3), 4 hours (lane 4), and 24 hours (lane 5) stimulation with Staphylococcus aureus Cowan strain I and phorbal 12-myristate 13-acetate; lane 6, isolated peripheral blood B cells.

Peripheral blood T cells expressed TIMP-1 and TIMP-2 (Figs 1 and 4). In vitro, peripheral blood T cells cultured without mitogens did not secrete TIMP-2 activity, as assessed by reverse zymography (Fig 7A). However, on stimulation with IL-2 plus PHA, active TIMP-2 could be detected in the media within 24 hours (Fig 7A). Peripheral blood T cells secreted active TIMP-1 at a basal rate that did not increase with activation (Fig 7A). Gelatinase B activity was observed in peripheral blood T cells and increased poststimulation with activated forms being detected (Fig 7B). Gelatinase A and interstitial collagenase were not detected.


View larger version (61K):
[in this window]
[in a new window]
 
Fig 7. (A) Reverse zymography of peripheral blood T cells. A total of 15 µL of conditioned media was electrophoresed on 15% SDS polyacrylamide gels containing gelatin and HT1080 fibroblast culture-conditioned media. SDS was removed following electrophoresis and gels incubated to restore gelatinase activity. Gels were scanned by an AGFA Arcus flatbed scanner. Lane A, HT1080 cell-conditioned media (positive control for both TIMP-1 and TIMP-2); lane B, unstimulated peripheral blood T-cell-conditioned media; lane C, IL-2/PHA-stimulated peripheral blood T-cell-conditioned media. (B) Gelatin zymography of peripheral blood T cells. A total of 16 µL of conditioned media was electrophoresed on 10% SDS polyacrylamide gels containing gelatin. SDS was removed following electrophoresis and gels incubated to restore gelatinase activity. Gels were scanned by an AGFA Arcus flatbed scanner. Lane A, HT1080 cell-conditioned media (positive control for both TIMP-1 and TIMP-2); lane B, unstimulated peripheral blood T-cell-conditioned media; lane C, IL-2/PHA-stimulated peripheral blood T-cell-conditioned media.

    DISCUSSION
Abstract
Introduction
Methods
Results
Discussion
References

The involvement of the MMPS in development of the metastatic phenotype in solid tumors and the ability of the TIMPS to inhibit tumor cell invasion and metastasis both in vitro and in vivo is now well established.1-13 Previous studies indicate these gene products may also be involved in the progression of hematopoietic neoplasms.14-18,26-28 Our study of eight hematopoietic cell lines, peripheral blood T cells, and tonsillar cell suspensions did not demonstrate the expression of gelatinase A, gelatinase B, or interstitial collagenase at the RNA level. Using the sensitive zymogram technique, a 92-kD gelatinase activity consistent with gelatinase B was only detected in the two Burkitt cell lines, Jijoye, and PA 682, peripheral blood T cells and in the tonsillar cell suspension. Gelatinase A or interstitial collagenase activity was not detected by either method. Elevated gelatinase B expression, as assayed by in situ hybridization, has previously been observed in high-grade, large cell immunoblastic lymphomas and was associated with decreased survival.28 Zymogram detection of gelatinase B expression by the high-grade B-cell Burkitt's lymphoma cell lines is consistent with these findings and indicates that this enzyme may play an important role in high-grade non-Hodgkin's lymphomas.

Gelatinase B was expressed by the highly reactive hyperplastic tonsils and peripheral blood T cells. The actual tonsillar cell population producing gelatinase B may be B or T cells, although granulocytes and monocytes cannot be excluded. Although granulocytes and monocytes are known to express this enzyme,5,42 the 135- and 220-kD forms of gelatinase, which are typically expressed by these cells were not present, indicating they are unlikely sources for gelatinase B. Upon activation of peripheral blood T cells with IL-2 and PHA, we observed an increase in Gelatinase B expression as well as the presence of activated forms of the 92-kD gelatinase, a finding consistent with findings in several other laboratories.24,43 Gelatinase B is reported to be expressed basally in cultures containing normal peripheral blood B cells and T cells (monocyte-depleted) and increases upon activation with PHA or IL-2.24 Tumor specific T cells have been shown in vitro to secrete Gelatinase B at low levels basally with increased expression upon stimulation with IL-2 or tumor cells. The ability of conditioned media from the tumor specific T cells to degrade basement membrane correlated with Gelatinase B levels.23 Our studies support the concept that Gelatinase B may play an important role in lymphoid degradation of basement membrane components. These findings support the role of this protease in normal lymphocyte migration from the vascular compartment to sites of inflammation, as well as invasion of structures by lymphoma cells.

The lack of gelatinase A expression is interesting in that expression of human Gelatinase A by stimulated T cells has been previously reported.24 However, in this previous study of normal donor T cells, the B cells were not removed. The B cells could stimulate T cells to produce Gelatinase A or they could be the actual source of this matrix metalloproteinase. In another study where T cells were isolated by fluorescence activated sorting and the purity of the T-cell population determined at 98%, the results were identical to ours in that Gelatinase A was not detected, although Gelatinase B was present basally and increased with stimulation (interstitial collagenase was not studied).23 We, therefore, are of the opinion that Gelatinase A is not produced in isolated T-cell cultures, although the observed lack of expression may be due to other undefined differences in culture conditions. Gelatinase A expression has been observed in some lymphoblastoid cell lines,26 but we did not detect expression in our series of neoplastic lymphoid cell lines. This may reflect differences in the cell lines studied. Other enzymes not detected by zymography under conditions used in these studies, such as plasminogen activators, may play an important role in basement membrane degradation during lymphoid cell invasion. Alternatively, lymphoid cells may produce MMPs upon interaction with basement membrane components, such as laminin, type IV collagen, or heparan sulfate proteoglycan, or in response to other tissue-specific interactions (eg, interaction with endothelial cells) that are not present under in vitro tissue culture conditions. In fact, specific induction of T-cell Gelatinase A has been observed in murine T cells that was mediated by vascular cell adhesion molecule (VCAM-1)-dependent adhesion to endothelial cells.44 Human T-cell synthesis and secretion of Gelatinase A and Gelatinase B have been shown to be influenced by integrin-mediated adherence to basement membrane matrix.43,45 These findings suggest that these proteases may contribute significantly to events associated with T-cell transmigration across the subendothelial basement membrane. The lack of Gelatinase A expression by T cells in the present study is at least, in part, due to the suspension culture technique used. The influence of VCAM-1 and other integrin-mediated adhesion events on TIMP-1 expression in lymphoid cells awaits further investigations. Thus, although Gelatinase A and interstitial collagenase are not observed in the peripheral blood T cells and all of the cell lines studied under the culture conditions used, they may be produced by lymphomas and normal lymphocytes in vivo. This aspect will be examined in ongoing studies.

In this study, TIMP-1 RNA transcripts and protein were expressed by the multipotential K-562 cell line, the high-grade Burkitt's B-cell lymphoma lines, tonsillar cells, and peripheral blood T cells. TIMP-1 was not expressed in any of the neoplastic T-cell lines. Expression of TIMP-1 by K562 has been previously reported and has been shown to possibly promote growth in these cells.16,17 Although TIMP-1 expression by Burkitt cell lines has not been previously studied, it was observed in high-grade, large cell immunoblastic lymphomas and was associated with advanced stage disease.27 The expression of TIMP-1 in the large cell immunoblastic lymphomas was localized to the stromal and endothelial cells by in situ hybridization, although the method was not sufficiently sensitive to exclude lower levels of expression in the tumor cell.27 We have demonstrated that TIMP-1 is expressed not only by stromal cells, but also by high-grade neoplastic lymphoid cells of B lineage. This suggests that TIMP-1 may be of importance in high-grade B-cell lymphomas. Expression of TIMP-1 by tonsillar cells and peripheral blood T cells may indicate an association with the "activated" lymphoid phenotype or another role in normal lymphoid function. High levels of TIMP-2 RNA transcript and protein expression were observed in the neoplastic T-cell lines with lower levels of expression in normal peripheral blood T cells and hyperplastic tonsils. TIMP-2 expression occurred in response to activation with IL-2 and PHA in the peripheral blood T cells.

We find the presence of TIMP-1 and TIMP-2 in the absence of Gelatinase expression an interesting observation. Although the gelatinases studied may be expressed under different culture conditions, one would expect the regulation of expression of TIMP-1 and TIMP-2 might mirror that of the Gelatinases A and B if the action of the TIMPs is merely inhibition of gelatinase activity. Therefore, the constitutive expression of the TIMPs without gelatinase suggests that they may have a growth factor activity, similar to that observed for TIMP-1 and TIMP-2 in the erythroid burst formation assay14 and for TIMP-1 in K562 cells.15-17 This is further supported by the work of Hayakawa et al,18,19 who observed that both TIMP-1 and TIMP-2 promoted growth in serum-free media for a number of human cell lines, including the following: the Burkitt cell lines Raji, Daudi, and Ramos; the human myelogenous leukemia line HL60; human lymphoblast line WIL2-NS; human breast adenocarcinoma line MCF7; human gingival fibroblasts; human skin epithelial cells; and human aortic smooth muscle cells. The increased levels of TIMP-2 expression in neoplastic T-cell lines compared with normal T cells is also consistent with an autocrine growth factor activity, such as is observed in K562 cells and is currently being investigated. Alternatively, TIMP-1 and TIMP-2 may be coexpressed with and modulate the activity of other metalloproteinases that were not studied or may be coupled with gelatinase expression in vivo.

In conclusion, we have studied the expression of TIMP-1, TIMP-2, Gelatinase A, Gelatinase B, and interstitial collagenase in a variety of low-grade and high-grade hematopoietic cell lines, as well as normal T and B cells. Gelatinase B production was demonstrated in the two Burkitt cell lines, tonsillar cell suspension, and normal peripheral blood T cells and may play an important role in lymphoid cell migration. We do not detect gelatinase production in the other lymphoid cell lines. This may be due to a requirement by lymphoid cells for interaction with components of the extracellular matrix or endothelial cells to induce or initiate gelatinase transcriptional activity. However, our results do demonstrate differential expression of the tissue inhibitors of matrix metalloproteinases, TIMP-1, and TIMP-2. TIMP-1 is expressed in the high-grade B-cell Burkitt lymphoma lines, the multipotential K562 cells, tonsillar tissue, and activated T cells, while TIMP-2 expression is apparently restricted to T-cell lymphoma lines and tissues containing T cells.

    FOOTNOTES

   Submitted May 21, 1996; accepted October 16, 1996.
   Address reprint requests to Maryalice Stetler-Stevenson, MD, PhD, Laboratory of Pathology, NIH, Bldg 10, Room 2A-33, Bethesda, MD 20892.

   The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hearly marked ``advertisment'' in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

    REFERENCES
Abstract
Introduction
Methods
Results
Discussion
References

1. Goldberg GI, Wilhelm SM, Kronberger A, Bauer EA, Grant GA, Eisen AZ: Human fibroblast collegenase: Complete primary structure and homology to an oncogene transformation-induced rat protein. J Biol Chem 261:6600, 1986[Abstract/Free Full Text]

2. Whitham SE, Murphy G, Angel P, Rahmsdorf H-J, Smith BJ, Lyons A, Harris TJR, Reynolds JJ, Herrlich P, Docherty AJP: Comparison of human stromelysin and collagenase by cloning and sequence analysis. Biochem J 240:913, 1986[Medline] [Order article via Infotrieve]

3. Quantin B, Murphy G, Breathnach R: Pump-1 cDNA codes for a protein with characteristics similar to those of classical collagenase family members. Biochemistry 28:5327, 1989[Medline] [Order article via Infotrieve]

4. Liotta LA, Tryggvason K, Garbisa S, Gehron-Robey P, Abe S: Partial purification and characterization of a neutral protease which cleaves type IV collagen. Biochemistry 20:100, 1981[Medline] [Order article via Infotrieve]

5. Whilhelm SM, Collier IE, Marmer BL, Eisen AZ, Grant GA, Goldberg GI: SV40-transformed human lung fibroblasts secrete a 92-kDa type-IV collagenase which is identical to that secreted by normal human macrophages. J Biol Chem 264:17213, 1989[Abstract/Free Full Text]

6. Stetler-Stevenson WG, Aznavoorian S, Liotta LA: Tumor cell interactions with the extracellular matrix during invasion and metastasis. Ann Rev Cell Biol 9:541, 1993

7. Levy A, Cioce V, Sobel ME, Garbisa S, Griogioni WF, Liotta LA, Stetler-Stevenson WG: Increased expression of the 72 kDa type IV collagenase in human colonic adenocarcinoma. Cancer Res 51:439, 1991[Abstract/Free Full Text]

8. Monteagudo C, Merino M, San-Juan J, Liotta L, Stetler-Stevenson WG: Immunohistologic distribution of type IV collagen in normal, benign, and malignant breast tissue. Am J Pathol 136:585, 1990[Abstract]

9. Butler TA, Zhu C, Mueller RA, Fuller GC, Lemaine WJ, Woessner F: Inhibition of ovulation in the rat ovary by a synthetic collagenase inhibitor. Matrix 1:400, 1992[Medline] [Order article via Infotrieve]

10. Behrendtsen O, Alexander CM, Werb Z: Metalloproteinases mediate extracellular matrix degradation by cells from mouse blastocyst outgrowths. Development 114:447, 1992[Abstract]

11. Stetler-Stevenson WG, Krutzsch HC, Liotta LA: Tissue inhibitor of metalloproteinase (TIMP-2), a new member of the metalloproteinase inhibitor family. J Biol Chem 262:17374, 1989[Abstract/Free Full Text]

12. Goldberg GI, Marner BL, Grant GA, Eisen AZ, Wilhelm S, He C: Human 72-kilodalton type IV collagenase forms a complex with a tissue inhibitor of metalloproteinases designated TIMP-2. Proc Natl Acad Sci USA 86:8207, 1989[Abstract/Free Full Text]

13. Murphy G, Cawston T, Reynolds J: An inhibitor of collagenase from human amniotic fluid. Purification, characterization and action on metalloproteinases. Biochem J 195:167, 1981[Medline] [Order article via Infotrieve]

14. Docherty AJP, Lyons A, Smith BJ, Wright EM, Stephens PE, Harris TJR, Murphy G, Reynolds JJ: Sequence of human tissue inhibitor of metalloproteinases and its identity to erythroid potentiating activity. Nature 18:66, 1986

15. Stetler-Stevenson WG, Bersch N, Golde DW: Tissue inhibitor of metalloproteinase-2 (TIMP-2) has erythroid-potentiating activity. FEBS Lett 296:231, 1992[Medline] [Order article via Infotrieve]

16. Alitalo R, Partanen J, Pertovaara L, Holtta E, Sistonen L, Anderson L, Alitalo K: Increased erythroid potentiating activity/ tissue inhibitor of metalloproteinases and jun/fos transcription factor complex characterize tumor promoter-induced megakaryoblastic differentiation of K562 leukemia cells. Blood 75:1974, 1990[Abstract/Free Full Text]

17. Avalos BR, Kaufman SE, Tomonaga M, Williams RE, Golde DW, Gasson JC: K562 cells produce and respond to human erythroid-potentiating activity. Blood 71:1720, 1988[Abstract/Free Full Text]

18. Hayakawa T, Yamashita K, Tanzawa K, Uchijima E, Iwata K: Growth-promoting activity of tissue inhibitor of metalloproteinases-1 (TIMP-1) for a wide range of cells, a possible new growth factor in serum. FEBS Lett 298:29, 1992[Medline] [Order article via Infotrieve]

19. Hayakawa T, Yamashita K, Ohuchi E, Shinagawa A: Cell growth promoting activity of Tissue inhibitor of metalloproteinases-2 (TIMP-2). J Cell Sci 107:2373, 1994[Abstract]

20. Corcoran ML, Stetler-Stevenson W: Tissue inhibitor of metalloproteinase-2 stimulates fibroblast proliferation via a cAMP-dependent mechanism. J Biol Chem 270:13453, 1995[Abstract/Free Full Text]

21. Murphy AN, Unsworth EJ, Stetler-Stevenson WG: Tissue inhibitor of Metalloproteinase-2 (TIMP-2) inhibits beta FGF induced human microvascular endothelial cell proliferation. J Cell Physiol 157:351, 1993[Medline] [Order article via Infotrieve]

22. Burke JS: The diagnosis of extranodal lymphomas and lymphoid hyperplasias ("pseudolymphomas") other than those involving the lung, in Jaffe ES (ed): Surgical Pathology of the Lymph Nodes and Related Organs. Philadelphia, PA, Saunders, 1985, p 298

23. Montgomery AMP, Sabzevari H, Reisfeld RA: Production and regulation of gelatinase B by human T-cells. Biochim Biophys Acta 1176:265, 1993[Medline] [Order article via Infotrieve]

24. Leppert D, Waubant E, Galardy R, Bunnett N, Hauser SL: T cell gelatinases mediate basement membrane transmigration in vivo. J Immunol 154:4379, 1995[Abstract]

25. Nathwani BN: Diagnostic significance of morphologic patterns in lymph node proliferations, in Knowles DM (ed): Neoplastic Hematopathology. Baltimore, MD, Williams & Wilkins, 1992, p 407

26. Hendrix MJC, Seftor EA, Grogan TM, Seftor REB, Hersh EM, Boyse EA, Liotta LA, Stetler-Stevenson WG, Ray CG: Expression of type IV collagenase correlates with the invasion of human lymphoblastoid cell lines and pathogenesis in SCID mice. Mol Cell Probes 6:59, 1992[Medline] [Order article via Infotrieve]

27. Kossakowska AE, Urbanski SJ, Edwards DE: Tissue inhibitor of metalloproteinases-1 (TIMP-1) RNA is expressed at elevated levels in malignant non-Hodgkin's lymphomas. Blood 77:2474, 1991

28. Kossakowska AE, Urbanski SJ, Huchcroft SA, Edwards DR: Relationship between the clinical aggresiveness of large cell immunoblastic lymphomas and expression of 92 kDa Gelatinase (type IV collagenase) and tissue inhibitors of metalloproteinases-I (TIMP-1) RNAs. Oncol Res 4:233, 1992[Medline] [Order article via Infotrieve]

29. Uchijima M, Sato H, Fujii M, Motoharu S: Tax proteins of human T-cell leukemia virus type-1 and -2 induce expression of the gene encoding erythroid-potentiating activity (tissue inhibitor of metalloproteinases-1, TIMP-1). J Biol Chem 269:14946, 1994[Abstract/Free Full Text]

30. Harrison KA, Druey KM, Deguchi Y, Tuscano JM, Kehrl JH: A novel human homeobox gene distantly related to proboscipedia is expressed in lymphoid and pancreatic tissues. J Biol Chem 269:19968, 1994[Abstract/Free Full Text]

31. Marti GE, Faguet G, Bertin P, Agee J, Washington G, Ruiz S, Carter P, Zenger V, Vogt R, Noguchi P: CD20 and CD5 expression in B-chronic lymphocytic leukemia (B-CLL). Proc Natl Acad Sci USA 651:480, 1992

32. Abbasi F, Marti GE, Bertin P, Metcalf R: Evaluation of optimal parameters for sorting of human B-cells and their PCR-bases clonal analysis. J Int Soc Anal Cytometry 6:263D, 1993 (suppl 6)

33. Irving SG, June CH, Zipfel PF, Siebenlist U, Kelly K: Mitogen-induced genes are subject to multiple pathways of regulation in the initial stages of T-cell activation. Mol Cell Biol 9:1034, 1989[Abstract/Free Full Text]

34. Stetler-Stevenson WG, Brown PD, Onisto M, Levy AT, Liotta LA: Tissue inhibitor of metalloproteinases-2 (TIMP-2) mRNA expression in tumor cell lines and human tumor tissues. J Biol Chem 265:113933, 1990

35. Templeton NS, Brown PD, Levy AT, Margulies IMK, Liotta LA, Stetler-Stevenson WG: Cloning and characterization of human tumor cell interstitial collagenase. Cancer Res 50:5431, 1990[Abstract/Free Full Text]

36. Fort P, Marty L, Piechaczyk M, Sabrouty SE, Dani C, Jeanteur P, Blanchard JM: Various rat adult tissues express only one major mRNA species from the glyceraldehyde-3-phosphate-dehydrogenase multigenic family. Nucleic Acids Res 13:1431, 1985[Abstract/Free Full Text]

37. Wang J, Raffeld M, Medeiros LJ, Longo DL, Jaffe ES, Duffey P, Stetler-Stevenson M: Follicular center cell lymphoma with the t(14; 18) translocation in which the rearranged BCL-2 gene is silent. Leukemia 7:1834, 1993[Medline] [Order article via Infotrieve]

38. Heussen C, Dowdle EB: Electrophoretic analysis of plasminogen activators in polyacrylamide gels containing sodium dodecyl sulfate and copolymerized substrates. Anal Biochem 102:196, 1980[Medline] [Order article via Infotrieve]

39. Kleiner DC, Stetler-Stevenson WG: Quantitative zymography, detection of picogram quantities of gelatinases. Anal Biochem 218:325, 1994[Medline] [Order article via Infotrieve]

40. Staskus PW, Masiarz FR, Pallanck LJ, Hawkes SP: The 21-kDa protein is a transformation-sensitive metalloproteinase inhibitor of chicken fibroblasts. J Biol Chem 266:449, 1991[Abstract/Free Full Text]

41. Kuchnio MK, Sausville EA, Jaffe ES, Greiner T, Foss FM, McClanahan J, Fukushima P, Stetler-Stevenson M: Flow cytometric detection of neoplastic T-cells in patients with mycosis fungoides based upon levels of T-cell receptor expression. Am J Clin Pathol 102:856, 1994[Medline] [Order article via Infotrieve]

42. Weiss SJ, Peppin GJ: Collagenolytic metalloenzymes of the human neutrophil. Biochem Pharmacol 35:3189, 1986[Medline] [Order article via Infotrieve]

43. Goetzl EJ, Banda MJ, Leppert D: Matrix metalloproteinases in immunity. J Immunol 156:1, 1996[Abstract]

44. Romanic AM, Madri JA: The induction of 72-kD gelatinase in T cells upon adhesion to endothelial cells is VCAM-1 dependent. J Cell Biol 125:1165, 1994[Abstract/Free Full Text]

45. Xia M, Leppert D, Hauser SL, Sreedharan SP, Nelson PJ, Krensky AM, Goetzl EJ: Stimulus specificity of matrix metalloproteinase dependence of human T cell migration through a model basement membrane. J Immunol 156:160, 1996[Abstract]


© 1997 by The American Society of Hematology.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J. Wang, Y. Taba, J. Pang, G. Yin, C. Yan, and B. C. Berk
GIT1 Mediates VEGF-Induced Podosome Formation in Endothelial Cells: Critical Role for PLC{gamma}
Arterioscler Thromb Vasc Biol, February 1, 2009; 29(2): 202 - 208.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Nakamichi, N. Udagawa, Y. Kobayashi, M. Nakamura, Y. Yamamoto, T. Yamashita, T. Mizoguchi, M. Sato, M. Mogi, J. M. Penninger, et al.
Osteoprotegerin Reduces the Serum Level of Receptor Activator of NF-{kappa}B Ligand Derived from Osteoblasts
J. Immunol., January 1, 2007; 178(1): 192 - 200.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
I. V. Sorensen, C. Fenger, H. Winther, N. T. Foged, U. Lademann, N. Brunner, and P. A. Usher
Characterization of Anti-TIMP-1 Monoclonal Antibodies for Immunohistochemical Localization in Formalin-fixed, Paraffin-embedded Tissue
J. Histochem. Cytochem., October 1, 2006; 54(10): 1075 - 1086.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Hickey, J. Crewe, L. A. Mahoney, D. A. Doherty, I. S. Fraser, and L. A. Salamonsen
Mechanisms of Irregular Bleeding with Hormone Therapy: The Role of Matrix Metalloproteinases and Their Tissue Inhibitors
J. Clin. Endocrinol. Metab., August 1, 2006; 91(8): 3189 - 3198.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
J. Dien, H. M. Amin, N. Chiu, W. Wong, C. Frantz, B. Chiu, J. R. Mackey, and R. Lai
Signal Transducers and Activators of Transcription-3 Up-Regulates Tissue Inhibitor of Metalloproteinase-1 Expression and Decreases Invasiveness of Breast Cancer
Am. J. Pathol., August 1, 2006; 169(2): 633 - 642.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. Varon, F. Tatin, V. Moreau, E. Van Obberghen-Schilling, S. Fernandez-Sauze, E. Reuzeau, I. Kramer, and E. Genot
Transforming Growth Factor {beta} Induces Rosettes of Podosomes in Primary Aortic Endothelial Cells.
Mol. Cell. Biol., May 1, 2006; 26(9): 3582 - 3594.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
F. Tatin, C. Varon, E. Genot, and V. Moreau
A signalling cascade involving PKC, Src and Cdc42 regulates podosome assembly in cultured endothelial cells in response to phorbol ester
J. Cell Sci., February 15, 2006; 119(4): 769 - 781.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Demers, T. Magnaldo, and Y. St-Pierre
A Novel Function for Galectin-7: Promoting Tumorigenesis by Up-regulating MMP-9 Gene Expression
Cancer Res., June 15, 2005; 65(12): 5205 - 5210.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. L. Deem and J. M. Cook-Mills
Vascular cell adhesion molecule 1 (VCAM-1) activation of endothelial cell matrix metalloproteinases: role of reactive oxygen species
Blood, October 15, 2004; 104(8): 2385 - 2393.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Van Themsche, T. Alain, A. E. Kossakowska, S. Urbanski, E. F. Potworowski, and Y. St-Pierre
Stromelysin-2 (Matrix Metalloproteinase 10) Is Inducible in Lymphoma Cells and Accelerates the Growth of Lymphoid Tumors In Vivo
J. Immunol., September 15, 2004; 173(6): 3605 - 3611.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
R. Lai, G. Z. Rassidakis, L. J. Medeiros, L. Ramdas, A. H. Goy, C. Cutler, Y. Fujio, K. Kunisada, H. M. Amin, and F. Gilles
Signal Transducer and Activator of Transcription-3 Activation Contributes to High Tissue Inhibitor of Metalloproteinase-1 Expression in Anaplastic Lymphoma Kinase-Positive Anaplastic Large Cell Lymphoma
Am. J. Pathol., June 1, 2004; 164(6): 2251 - 2258.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. L. Owen, V. Iragavarapu-Charyulu, Z. Gunja-Smith, L. M. Herbert, J. F. Grosso, and D. M. Lopez
Up-Regulation of Matrix Metalloproteinase-9 in T Lymphocytes of Mammary Tumor Bearers: Role of Vascular Endothelial Growth Factor
J. Immunol., October 15, 2003; 171(8): 4340 - 4351.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. Mori, H. Sato, T. Hayashibara, M. Senba, T. Hayashi, Y. Yamada, S. Kamihira, S. Ikeda, Y. Yamasaki, S. Morikawa, et al.
Human T-cell leukemia virus type I Tax transactivates the matrix metalloproteinase-9 gene: potential role in mediating adult T-cell leukemia invasiveness
Blood, February 15, 2002; 99(4): 1341 - 1349.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. H. Baker, D. R. Edwards, and G. Murphy
Metalloproteinase inhibitors: biological actions and therapeutic opportunities
J. Cell Sci., January 10, 2002; 115(19): 3719 - 3727.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. N. Holten-Andersen, I. J. Christensen, H. J. Nielsen, R. W. Stephens, V. Jensen, O. H. Nielsen, S. Sorensen, J. Overgaard, H. Lilja, A. Harris, et al.
Total Levels of Tissue Inhibitor of Metalloproteinases 1 in Plasma Yield High Diagnostic Sensitivity and Specificity in Patients with Colon Cancer
Clin. Cancer Res., January 1, 2002; 8(1): 156 - 164.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. Oelmann, H. Herbst, M. Zuhlsdorf, O. Albrecht, A. Nolte, C. Schmitmann, O. Manzke, V. Diehl, H. Stein, and W. E. Berdel
Tissue inhibitor of metalloproteinases 1 is an autocrine and paracrine survival factor, with additional immune-regulatory functions, expressed by Hodgkin/Reed-Sternberg cells
Blood, January 1, 2002; 99(1): 258 - 267.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
B. Bauvois
Transmembrane proteases in focus: diversity and redundancy?
J. Leukoc. Biol., July 1, 2001; 70(1): 11 - 17.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
I. I. Kuzin, J. E. Snyder, G. D. Ugine, D. Wu, S. Lee, T. Bushnell Jr, R. A. Insel, F. M. Young, and A. Bottaro
Tetracyclines inhibit activated B cell function
Int. Immunol., July 1, 2001; 13(7): 921 - 931.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. K. Narla, Y. Dong, D. Klis, and F. M. Uckun
Bis(4,7-dimethyl-1,10-phenanthroline) Sulfatooxovanadium(IV) as a Novel Antileukemic Agent with Matrix Metalloproteinase Inhibitory Activity
Clin. Cancer Res., April 1, 2001; 7(4): 1094 - 1101.
[Abstract] [Full Text]


Home page
BloodHome page
L. Guedez, A. Mansoor, B. Birkedal-Hansen, M. S. Lim, P. Fukushima, D. Venzon, W. G. Stetler-Stevenson, and M. Stetler-Stevenson
Tissue inhibitor of metalloproteinases 1 regulation of interleukin-10 in B-cell differentiation and lymphomagenesis
Blood, March 15, 2001; 97(6): 1796 - 1802.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. S. Bergmann-Leitner and S. I. Abrams
Differential Role of Fas/Fas Ligand Interactions in Cytolysis of Primary and Metastatic Colon Carcinoma Cell Lines by Human Antigen-Specific CD8+ CTL
J. Immunol., May 1, 2000; 164(9): 4941 - 4954.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. E. Trim, S. K. Samra, M. J. P. Arthur, M. C. Wright, M. McAulay, R. Beri, and D. A. Mann
Upstream Tissue Inhibitor of Metalloproteinases-1 (TIMP-1) Element-1, a Novel and Essential Regulatory DNA Motif in the Human TIMP-1 Gene Promoter, Directly Interacts with a 30-kDa Nuclear Protein
J. Biol. Chem., February 25, 2000; 275(9): 6657 - 6663.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Esparza, C. Vilardell, J. Calvo, M. Juan, J. Vives, A. Urbano-Marquez, J. Yague, and M. C. Cid
Fibronectin Upregulates Gelatinase B (MMP-9) and Induces Coordinated Expression of Gelatinase A (MMP-2) and Its Activator MT1-MMP (MMP-14) by Human T Lymphocyte Cell Lines. A Process Repressed Through RAS/MAP Kinase Signaling Pathways
Blood, October 15, 1999; 94(8): 2754 - 2766.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. E. Kossakowska, D. R. Edwards, C. Prusinkiewicz, M. C. Zhang, D. Guo, S. J. Urbanski, T. Grogan, L. A. Marquez, and A. Janowska-Wieczorek
Interleukin-6 Regulation of Matrix Metalloproteinase (MMP-2 and MMP-9) and Tissue Inhibitor of Metalloproteinase (TIMP-1) Expression in Malignant Non-Hodgkin's Lymphomas
Blood, September 15, 1999; 94(6): 2080 - 2089.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. Ries, F. Loher, C. Zang, M. G. Ismair, and P. E. Petrides
Matrix Metalloproteinase Production by Bone Marrow Mononuclear Cells from Normal Individuals and Patients with Acute and Chronic Myeloid Leukemia or Myelodysplastic Syndromes
Clin. Cancer Res., May 1, 1999; 5(5): 1115 - 1124.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Aoudjit, E. F. Potworowski, T. A. Springer, and Y. St-Pierre
Protection from Lymphoma Cell Metastasis in ICAM-1 Mutant Mice: A Posthoming Event
J. Immunol., September 1, 1998; 161(5): 2333 - 2338.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Guedez, L. Courtemanch, and M. Stetler-Stevenson
Tissue Inhibitor of Metalloproteinase (TIMP)-1 Induces Differentiation and an Antiapoptotic Phenotype in Germinal Center B Cells
Blood, August 15, 1998; 92(4): 1342 - 1349.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Aoudjit, E. F. Potworowski, and Y. St-Pierre
Bi-Directional Induction of Matrix Metalloproteinase-9 and Tissue Inhibitor of Matrix Metalloproteinase-1 During T Lymphoma/Endothelial Cell Contact: Implication of ICAM-1
J. Immunol., March 15, 1998; 160(6): 2967 - 2973.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Candotti, S. A. Oakes, J. A. Johnston, S. Giliani, R. F. Schumacher, P. Mella, M. Fiorini, A. G. Ugazio, R. Badolato, L. D. Notarangelo, et al.
Structural and Functional Basis for JAK3-Deficient Severe Combined Immunodeficiency
Blood, November 15, 1997; 90(10): 3996 - 4003.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stetler-Stevenson, M.
Right arrow Articles by Stetler-Stevenson, W. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stetler-Stevenson, M.
Right arrow Articles by Stetler-Stevenson, W. G.
Related Collections
Right arrow Neoplasia
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1997 by American Society of Hematology         Online ISSN: 1528-0020