Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kunicki, T. J.
Right arrow Articles by Nugent, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kunicki, T. J.
Right arrow Articles by Nugent, D. J.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 89 No. 6 (March 15), 1997: pp. 1939-1943

Hereditary Variation in Platelet Integrin alpha 2beta 1 Density Is Associated With Two Silent Polymorphisms in the alpha 2 Gene Coding Sequence

By Thomas J. Kunicki, Marcie Kritzik, Douglas S. Annis, and Diane J. Nugent

From the Roon Research Center for Arteriosclerosis and Thrombosis, Division of Experimental Thrombosis and Hemostasis, Department of Molecular and Experimental Medicine, and the Department of Vascular Biology, The Scripps Research Institute, La Jolla, CA; and the Children's Hospital of Orange County, Orange, CA.


    ABSTRACT
Abstract
Introduction
Methods
Results
Discussion
References

The integrin alpha 2beta 1 is a receptor for collagen that plays a fundamental role in the adhesion of blood platelets to the extracellular matrix. We previously reported that platelet alpha 2beta 1 levels among randomly selected individuals can vary up to 10-fold and that this correlates with differences in adhesiveness to type-I or type-III collagens. We have now found two linked, allelic polymorphisms within the coding sequence of the alpha 2 gene that correlate with receptor density, TTT/TTC at codon Phe224 and ACA/ACG at codon Thr246. By Southern blot hybridization of specific antisense DNA probes to segments of genomic DNA that encompass each coding region, we have determined the gene frequencies of each allele in a random donor population (n = 65) to be 0.585 (TTC ... ACG) and 0.415 (TTT ... ACA). There is a statistically significant correlation between the alleles TTT ... ACA (codons 224...246) and high receptor density (n = 30; P < .002), whereas the complimentary alleles TTC ... ACG are associated with low receptor density. Heterozygous individuals express intermediate levels of this receptor, and familial studies confirm that these allelic polymorphisms are inherited characteristics. These findings prove that the level of platelet alpha 2beta 1 is an inherited trait. The molecular basis for receptor density remains to be determined, but our findings establish that these silent alleles within the coding sequence of the alpha 2 gene are linked to the genetic basis for variation in receptor density.

    INTRODUCTION
Abstract
Introduction
Methods
Results
Discussion
References

THE INTEGRIN alpha 2beta 1 MEDIATES platelet adhesion to both fibrillar (types I-III and V) or nonfibrillar (types IV, VI, VII, and VIII) collagens.1-6 The extent to which this receptor contributes to adhesion to any one type of collagen is affected by both divalent cation composition and fluid shear rate.6 In whole blood, alpha 2beta 1 -mediated adhesion of platelets to fibrillar collagens, including types I and III, also activates platelets, leading to prothrombin conversion on the platelet surface7 and thrombus formation mediated by another integrin, alpha IIbbeta 3 .8,9 However, even in the presence of inhibitors of alpha IIbbeta 3 function, platelet activation initiated by alpha 2beta 1 -dependent adhesion leads to cellular events that catalyze prothrombin conversion and fibrin clot formation.7 Thus, alpha 2beta 1 has the potential to contribute significantly to platelet function in vivo. Indeed, patients with quantitative abnormalities of platelet alpha 2 present with prolonged bleeding times, chronic mucocutaneous bleeding, defective in vitro platelet adhesion to collagen and absent in vitro collagen-induced aggregation.10-12 Moreover, selected individuals with autoimmune platelet dysfunction have been found to express serum autoantibodies specific for alpha 2 that block in vitro platelet adhesion to collagen and collagen-induced aggregation.13,14

Although the levels of the integrins alpha 5beta 1 or alpha IIbbeta 3 and the glycoprotein Ib-IX complex on platelets (molecules per platelet) can vary from one individual to the next,15,16 these differences never exceed a fraction of the mean population level. On the other hand, the number of alpha 2beta 1 molecules per platelet varies by as much as an order of magnitude and correlates precisely with quantitative estimates of platelet adhesion to type-I or type-III collagens.15 In this report, we provide direct evidence for a genetic basis for the observed difference in platelet alpha 2beta 1 density.

    MATERIALS AND METHODS
Abstract
Introduction
Methods
Results
Discussion
References

Reagents. Murine monoclonal IgG antibody 6F1 (anti-alpha 2beta 1 ) has been described8 and is a gift from Dr B. Coller (Mount Sinai Medical Center, New York, NY). The murine hybridoma 12F1 producing IgG specific for alpha 2beta 1 has been well characterized17 and was generously provided by Dr V. Woods (University of California at San Diego, La Jolla, CA). The murine monoclonal IgG antibody 8C12, also specific for the alpha 2beta 1 , was a gift from Dr M. Ginsberg (The Scripps Research Institute, La Jolla, CA). AP2 is a murine monoclonal IgG antibody specific for the integrin alpha IIbbeta 3 developed and characterized in our laboratory.18

mRNA amplification and sequencing. Total platelet RNA was isolated as described,19 and alpha 2 -specific mRNA was amplified as four overlapping segments by reverse transcription-polymerase chain reaction (RT-PCR)20 using either Taq I (Perkin Elmer, Foster City, CA) or VENT (New England Biolabs, Beverly, MA) polymerases. The oligonucleotide primer 5'-CACTTAAGGCTTGGAAACTG-3' representing bp 2772-2791 of mature alpha 2 mRNA21 was used for the production of first-strand cDNA using RT. Two-stage PCR reactions were then used to amplify each of four cDNA segments, designated A through D, from 5' to 3'. These oligonucleotide primers were as follows: for segment A, GAATTCCTGCAAACCCAGCG (bp 1-20) and CTGTTTAAGTACCCAAGAACTGC (bp 976-998) followed by ATT<UNL>CtcGag</UNL>AACCCAGCGCAACTACGG (bp 12-29)and GTT<UNL>TctagA</UNL>CCCAAGAACTGCTATGCC (bp 970-988); for segment B, GAATTCCTGCAAACCCAGCG (bp 1-20) and CACTTAAGGCTTGGAAACTG (bp 2772-2791) followed by GCA<UNL>ctcgag</UNL>GGTGGGCGACGAAGTGCTACG (bp853-873) and TCC<UNL>tctaGA</UNL>TCCCAAGATTTTCTGGG (bp 1850-1868); for segment C, GGTTCACCACTAGAAAATCAG (bp 1771-1791) and CACTTAAGGCTTGGAAACTG (bp 2772-2791) followed by TCA<UNL>Ctcgag</UNL>GAAAATCAGAATTCTGGAGC (bp 1783-1802) and ACT<UNL>TctaGa</UNL>TTGGAAACTGAGAGACGCC (bp 2763-2781); and for segment D, CAGCAGCTTCTGGTGGGCGAC(bp 842-862) and GTCTGCTGGTTCAGCTACTGAGC (bp 3582-3604) followed by GCT<UNL>ctcgag</UNL>CAGAAGTCTGTTGCCTGCG (bp 2659-2677) and GCT<UNL>tcTagA</UNL>GCTACTGAGCTCTGTGG (bp 3575-3592). In each case, the Xho I or Xba I restriction sites used for cloning into M13 are underlined, and lowercase letters indicate base changes introduced to create these restriction sites. For reference, the start codon begins at base 49, whereas the stop codon begins at base 3592.21 cDNA segments were sequenced by the dideoxy termination method using Sequenase 2.0 (Promega Biotec, Inc, Madison, WI).

Southern blot hybridization. These studies were designed to identify the specific allelic polymorphisms at codons 807 and 873 of the alpha 2 coding sequence. First-strand cDNA was generated using RT as described above. The product served as a template for a primary PCR using primers 5'-GAATTCCTGCAAACCCAGCG-3' (bp 1-20) and 5'-CTGTTTAAGTACCCAAGAACTGC-3' (bp 976-998). The desired segment of this product was further amplified in a secondary PCR using the primer pair ATT<UNL>CtcGag</UNL>AACCCAGCGCAACTACGG and GTT<UNL>TctagA</UNL>CCCAAGAACTGCTATGCC to produce a segment corresponding to base pairs 12-988 or using the primer pair GAA<UNL>CTCGAG</UNL>GTTTTCTCACATGTGG and CTGTTTAAGTACCCAAGAACTGC to produce a segment corresponding to base pairs 419-998. Vent DNA polymerase (New England Biolabs, Inc, Beverly, MA) was used in all PCR reactions.

The desired segment of the alpha 2 gene was also amplified using leukocyte DNA as the template. PCR was performed using primer pair GTGTTTAACTTGAACACATATAAAACC (bp 715-741) plus CTCAGTATATTGTCATGGTTGCATTG (bp 940-965) in the first stage and then the nested primer pair TCC<UNL>CtcgAg</UNL>TCCCAATATGGTGGGGACCTCAC (Xho I: bp 775-797) plus CTC<UNL>tcTAgA</UNL>TTGTCATGGCATTGATCAATCAC (bp 931-956: Xba I) in the second stage. The product is an approx 4.5-kb DNA segment that includes both the 807 and 873 allelic sequences and 4.35 kb of intervening, noncoding sequence. It is likely that this represents a single large intron separating two exons that encode each of the allelic sequences. The Xho I and Xba I restriction sites were introduced to facilitate subcloning of the segment. On digestion with Xba I, it became apparent that there was one additional restriction site within the noncoding sequence. Thus, complete digestion of cloned DNA with Xho I and Xba I yields a 3.7-kb 5' fragment and a 650-bp 3' fragment. The sequence of the entire 650-bp fragment as well as over 600 bp of the larger 3.7-kb fragment were obtained by the dideoxy method using Sequenase 2.0 (Promega Biotec, Inc).

Using the newly found intron sequence, PCR conditions were established to amplify smaller genomic DNA fragments that would include either the 807 or 873 allelic sequences, so that these could be used in Southern blot hybridization assays. A 298-bp genomic fragment that includes the 807 alleles is amplified with the primer pair GTGTTTAACTTGAACACATATAAAACC (bp 715-741) and GATTTAACTTTCCCAGCTGCCTTC (intron sequence 173-196). The allelic sequences at 807 are then detected by hybridization to the probes 807C or 807T (Table 1). An oligonucleotide corresponding to intron sequence ACATTGGCCTATTAGCA serves as a positive control. At the same time, a 398-bp genomic fragment that includes the 873 alleles is amplified with primer pair CGAATACTGGGATAAATACATGCAC (intron sequence) and CTCAGTATATTGTCATGGTTGCATTG (bp 940-965). The allelic sequences at 873 are then detected by hybridization to the probes 873G or 873A (Table 1). An oligonucleotide corresponding to coding sequence 887-903 serves as the positive control for this DNA segment.

 
View this table:
[in this window] [in a new window]
 
Table 1. Southern Blot Oligonucleotide Probes

DNA products were denatured with 0.36 mol/L NaOH plus 25 mmol/L EDTA, followed by neutralization with 1 mol/L ammonium acetate (final concentration). The DNA samples were applied to a prewetted nylon membrane using a vacuum dot-blot apparatus, and the DNA was fixed to the membrane by cross-linking with UV light. The blots were prehybridized by incubation in 5× SSC (saline sodium citrate), 0.2% sodium dodecyl sulfate, 0.1% hybridization component (Amersham, Arlington Heights, IL), plus 0.5% blocking agent (Amersham) for 3 hours. Fluorescein-labeled oligonucleotide probes were then added at a final concentration of 5 ng/mL. After incubation at 39°C for 12 to 16 hours, each blot was subjected to specific stringency washes. We used two oligonucleotide probes to detect each of the two alleles of codons 807 and 873 (Table 1). Each oligonucleotide probe was labeled using the enhanced chemiluminescence 3'-oligolabeling and detection system from Amersham Life Science, Inc, according to the manufacturer's instructions. This method uses terminal transferase to conjugate the 3' end of the probe with fluorescein-deoxyuridine triphosphate. Bound probe is detected with horseradish peroxidase-conjugated, antifluorescein antibody and subsequent addition of enhanced chemiluminescence detection reagents supplied with the Amersham kit.

Quantitation of platelet alpha 2beta 1. Murine monoclonal antibodies specific for the alpha 2beta 1 complex, 6F1, 12F1, and 8C12, were used to quantitate levels of this receptor on platelets by flow cytometry or direct binding of radioiodinated Fab molecules, as previously described.15 For analyses of washed platelets by flow cytometry (as in family study no. 2), bound murine antibodies 6F1 or AP2 (anti-alpha IIbbeta 3 ) were detected using a 1:50 dilution of fluorescein isothiocyanate (FITC)-F(ab')2 goat antimouse IgG (heavy and light chains; Zymed Laboratories, Inc, South San Francisco, CA). Levels of bound 6F1 or AP2 were then expressed by mean fluorescence intensity (MFI) after subtraction of MFI observed for nonimmune murine IgG. For flow cytometric assays of whole blood samples, platelets were gated by forward versus side scatter, and the levels of bound 12F1, 8C12, AP2, or nonimmune murine IgG (mIgGl) were determined using a single FITC-F(ab')2 goat antimouse IgG (heavy and light chains; Zymed). The levels of bound 12F1 and 8C12 were first corrected by subtracting the level of bound mIgG and were then normalized by dividing by the corrected MFI obtained with AP2, using the formulas: n8C12 = 100 × [8C12 - mIgG] div [AP2 - mIgG] or n12F1 = 100 × [12F1 - mIgG] div [AP2 - mIgG].

Platelet adhesion to human collagens. Platelet adhesion to purified type-I or type-III human collagens was quantitated exactly as descibed.15

    RESULTS
Abstract
Introduction
Methods
Results
Discussion
References

Based on the results from six individuals, we found no differences in the deduced amino acid sequence of alpha 2 relative to the published sequence of Takada and Hemler,21 except for the allelic Br polymorphism at codon 505 (Lys/Glu).22 On the other hand, we noted two conservative differences within the coding sequence (C/T at bp 807 and G/A at bp 873) that apparently are allelic polymorphisms.

We sought to determine whether there is a correlation between these alpha 2 sequence differences and the level of the integrin alpha 2beta 1 on platelets of a panel of normal subjects. Platelet alpha 2beta 1 levels of 30 individuals were measured in whole blood samples by flow cytometry. In Fig 1, individual platelet alpha 2beta 1 levels, as determined by the binding of monoclonal antibody 12F1, are plotted according to the alpha 2 genotype of each individual, as determined by hybridization of specific allelic probes to genomic DNA. There is an obvious association of 807C and 873G with low receptor densities; conversely, increasing receptor density is associated with the alleles 807T and 873A. Equivalent findings were made with antibody 8C12 (data not shown). A 1-way analysis of variance using the Student-Newman-Keuls method indicates that there is a statistically significant difference between genotype and alpha 2beta 1 level (for 8C12, P = .000188; for 12F1, P = .00147).


View larger version (8K):
[in this window]
[in a new window]
 
Fig 1. Relationship between alpha 2 807 genotype and platelet alpha 2beta 1 levels. The level of platelet alpha 2beta 1 was determined by flow cytometry using the binding of monoclonal antibody 12F1. The corrected and normalized MFI values are indicated on the ordinate, and the results from each donor are plotted as a function of donor genotype with respect to the 807C and 807T alleles. Values are single measurements from each of 30 individuals but are representative of repeated measurements performed on several occasions. The boxed area in each data set represents the mean ± 1 SD. The difference in the means between donor groups is statistically significant (CC v CT, P < .05; and CC v TT, P < .05).

Allele frequencies were then calculated from a larger group of 65 randomly selected individuals. Based on these results, the gene frequencies for the 807C (or 873G) and 807T (or 873A) allelic pairs are 0.585 and 0.415, respectively. Furthermore, this extended comparison of the 807 and 873 alleles confirms linkage between the two polymorphisms.

We next analyzed the inheritance of collagen receptor density and these allelic sequences in the immediate family of donor no. 1, who was studied in our previous report15 and who expresses the lowest platelet receptor density of all donors examined to date. The platelet alpha 2beta 1 density of each child (donors no. 16 and 17), as measured by the direct binding of antibody 125I-6F1 Fab fragments to washed platelets, is almost precisely the arithmetic mean of the platelet receptor densities of the parents (Table 2). The genotype of each family member was determined by Southern blot analysis of cDNA. Donor no. 1 (low receptor density) expresses only the 807C allele, whereas donor no. 15 (high receptor density) expresses only the 807T allele. The two offspring (donors no. 16 and 17) are obligate heterozygotes and express both the 807C and 807T alleles. The control oligonucleotide 887 bound to all cDNA samples, as expected. Each cDNA sample gave an identical result when probes specific for the alleles 873G and 873A were used (data not shown).

 
View this table:
[in this window] [in a new window]
 
Table 2. Platelet Integrin alpha 2beta 1

In a second family study, flow cytometry was used to quantitate receptor densities on washed platelets (donors no. 18, 19, 20, and 21; see Table 2). AP2 was used to quantitate alpha IIbbeta 3 , whereas 6F1 was used to quantitate alpha 2beta 1 . Bound primary antibody was detected with FITC-conjugated goat antimouse IgG. Comparisons of MFI give a valid estimate of receptor levels among family members. The genotype of individuals in family no. 2 was determined by hybridization of labeled probes to amplified segments of genomic DNA. The mother (donor no. 18) in this family is homozygous for the 807C allele, whereas the father (donor no. 19) is heterozygous. A son (donor no. 20), whose antigen level mirrors that of the father, is also heterozygous, whereas a daughter (donor no. 21), whose antigen level is similar to that of the mother, is also homozygous for the 807C allele. Comparable findings were made with probes specific for the 873 alleles (not shown).

    DISCUSSION
Abstract
Introduction
Methods
Results
Discussion
References

From a comparison of the sequences of platelet alpha 2 cDNA derived from several individuals, we were able to identify allelic polymorphisms that are linked to the genetic basis of variation in alpha 2beta 1 receptor density. These polymorphisms in codons Phe224 (TTT/TTC) and Thr246 (AGA/AGC) are conservative and do not alter the deduced amino acid sequence of the translated protein. However, the inheritance of these silent polymorphisms correlates precisely with the inheritance of receptor density. Our finding that these allelic differences are inherited strongly supports our hypothesis that differences within the alpha 2 gene are responsible for the variation in platelet alpha 2beta 1 density that we previously reported.15

There are a number of possible explanations for our findings. On the one hand, the silent alleles within the coding sequence may be linked to other causative polymorphisms within the alpha 2 gene, eg, variants of the alpha 2 gene promoter region. The linkage of genetic mutations with otherwise silent polymorphisms within or outside of the coding sequence has been established in a number of inherited disorders, including pyruvate kinase deficiency23,24 and Gaucher disease.25,26 Alternatively, seemingly minor polymorphisms in mRNA sequence such as these may influence mRNA stability and/or turnover, resulting in disproportionate levels of each message.27 At this time, our results do not favor any one putative mechanism.

Even though alpha 2beta 1 is widely distributed in a large variety of tissues, among the hematopoietic cells, it is constitutively expressed exclusively on megakaryocytes and platelets.28 Consistent with this observation, the megakaryoblastic cell line Dami constitutively expresses alpha 2beta 1 ,29 and the level of alpha 2beta 1 expressed by the erythroleukemic cell line K562 increases with the acquisition of the megakaryocytic phenotype induced by phorbol ester.30 This results from increased steady-state levels of alpha 2 mRNA caused by transcriptional activation of the alpha 2 gene.31 In contrast to these findings on megakaryocytic cells, T lymphocyte or monocyte expression requires sustained cell activation.32 The structural organization of a reported 5-kb promoter region of the alpha 2 gene29,33 is very analogous to that of other megakaryocyte-specific genes, including PF4 and alpha IIb ,34 and several megakaryocyte-associated gene elements, such as GATA-like sequences and consensus binding sites for SAR/MAR proteins, are found in the most 5' portion of this promoter region.29

Even though the extent of the variation in receptor density suggests that more than a single genetic factor is involved in establishing the number of alpha 2beta 1 molecules per platelet in any one individual, our preliminary findings indicate that a significant correlation exists between receptor density and the cluster of linked polymorphisms that we have defined. Additional polymorphisms in either the coding sequence or noncoding sequence may well contribute to secondary variation in receptor density, but we maintain that we have already identified a polymorphic region of the gene that most likely correlates with differences in expression. It remains to be determined whether this region is itself responsible for the differences in receptor density or whether it is in linkage with another region of the gene that controls either transcription rate or stability/turnover of mRNA. Regardless of the outcome, our preliminary findings lay a solid foundation on which to investigate the genetic basis for the observed variation in alpha 2beta 1 density among normal individuals.

The finding of an inherited basis for platelet alpha 2beta 1 density has important implications in the diagnosis and treatment of cardiovascular disease. A number of hereditary and environmental factors most likely act in synergy to determine the overall risk for thrombosis and cardiovascular disease in any individual. Because blood platelets are responsible for the initiation of a thrombus, any variation in an adhesion receptor on blood platelets would logically become a potential risk factor. We postulate that increased expression of alpha 2beta 1 can increase long-term risk of thrombotic disease, whereas decreased expression can impair hemostasis. It is not likely that heterogeneity of alpha 2beta 1 alone compromises platelet function in an otherwise healthy individual, but inherited differences in receptor density could have an impact on the clinical outcomes in individuals who are at increased risk of thrombosis or bleeding as a result of unrelated disease processes or surgical interventions.

The potential impact of variation in alpha 2beta 1 numbers on platelets must be given consideration because of the fact that fibrillar collagens are major components of the subendothelial matrix that can trigger thrombus formation in flowing blood. Platelets activated by contact with collagens can both participate in the formation of aggregates via fibrinogen binding to the integrin alpha IIbbeta 3 and provide sites for the assembly of coagulation factor VIIIa/IXa and factor Va/Xa complexes.35-39

    FOOTNOTES

   Submitted April 14, 1996; accepted October 21, 1996.
   Supported by the National Heart, Lung, and Blood Institute Grant No. HL-46979 and by a grant from the Gustavus and Louise Pfeiffer Research Foundation (Redlands, CA). This is manuscript no. 8978-MEM from The Scripps Research Institute.
   Address reprint requests to Thomas J. Kunicki, PhD, Department of Molecular and Experimental Medicine, The Scripps Research Institute, Room SR11, Maildrop SBR13, 10550 N Torrey Pines Rd, La Jolla, CA 92037.

   The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hearly marked ``advertisment'' in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

    ACKNOWLEDGMENT

We are especially grateful to Ms K. Cox and the General Clinical Research Center of the Scripps Clinic and Research Foundation for measurements of platelet receptor levels in whole blood samples by flow cytometry and isolation of mononuclear cells. We thank Mr R. Orchekowski and Dr Y. Honda for their valuable technical contributions during the initiation of these studies; Dr J. Ware (Scripps Research Institute) for his thoughtful contributions to our work and for sharing important protocols with us; and Dr E. Beutler (The Scripps Research Institute) for providing anonymous donor DNA samples. Monoclonal antibodies were provided by colleagues, and for these we wish to thank Dr B. Coller for monoclonal antibody 6F1, Dr M. Ginsberg (The Scripps Research Institute) for monoclonal antibody 8C12, and Dr V. Woods for the hybridoma cell line 12F1.

    REFERENCES
Abstract
Introduction
Methods
Results
Discussion
References

1. Santoro SA, Rajpara SM, Staatz WD, Woods VL Jr: Isolation and characterization of a platelet surface collagen binding complex related to VLA-2. Biochem Biophys Res Commun 153:217, 1988[Medline] [Order article via Infotrieve]

2. Kunicki TJ, Nugent DJ, Staats SJ, Orchekowski RP, Wayner EA, Carter WG: The human fibroblast class II extracellular matrix receptor mediates platelet adhesion to collagen and is identical to the platelet glycoprotein Ia-IIa complex. J Biol Chem 263:4516, 1988[Abstract/Free Full Text]

3. Kunicki TJ, Nurden AT, Pidard D, Russel NR, Caen JP: Characterization of human platelet glycoprotein antigens giving rise to individual immunoprecipitates in crossed immunoelectrophoresis. Blood 58:1190, 1981[Abstract/Free Full Text]

4. Pischel KD, Bluestein HG, Woods VL: Platelet glycoprotein Ia,Ic, and IIa are physicochemically indistinguishable from the very late activation antigens adhesion-related proteins of lymphocytes and other cell types. J Clin Invest 81:505, 1988

5. Takada Y, Wayner EA, Carter WG, Hemler ME: Extracellular matrix receptors, ECMRII and ECMRI, for collagen and fibronectin correspond to VLA-2 and VLA-3 in the VLA family of heterodimers. J Cell Biochem 37:385, 1988[Medline] [Order article via Infotrieve]

6. Saelman EUM, Nieuwenhuis HK, Hese KM, De Groot PG, Heijnen HFG, Sage EH, Williams S, McKeown L, Gralnick HR, Sixma JJ: Platelet adhesion to collagen types I through VIII under conditions of stasis and flow is mediated by GPIa/IIa (alpha 2beta 1 -integrin). Blood 83:1244, 1994[Abstract/Free Full Text]

7. Kirchhofer D, Tschopp TB, Steiner B, Baumgartner HR: Role of collagen-adherent platelets in mediating fibrin formation in flowing whole blood. Blood 86:3815, 1995[Abstract/Free Full Text]

8. Coller BS, Beer JH, Scudder LE, Steinberg MH: Collagen-platelet interactions: Evidence for a direct interaction of collagen with platelet GPIa/IIa and an indirect interaction with platelet GPIIb/IIIa mediated by adhesive proteins. Blood 74:182, 1989[Abstract/Free Full Text]

9. Savage B, Marzec UM, Chao BH, Harker LA, Maraganore JM, Ruggeri ZM: Binding of the snake venom-derived proteins applaggin and echistatin to the arginine-glycine-aspartic acid recognition site(s) on platelet glycoprotein IIb.IIIa complex inhibits receptor function. J Biol Chem 265:11766, 1990[Abstract/Free Full Text]

10. Nieuwenhuis HK, Akkerman JWN, Houdijk WPM, Sixma JJ: Human blood platelets showing no response to collagen fail to express surface glycoprotein Ia. Nature 318:470, 1985[Medline] [Order article via Infotrieve]

11. Nieuwenhuis HK, Sakariassen S, Houdijk WPM, Nievelstein PFEM, Sixma JJ: Deficiency of platelet membrane glycoprotein Ia associated with a decreased platelet adhesion to subendothelium: A defect in platelet spreading. Blood 68:692, 1986[Abstract/Free Full Text]

12. Kehrel B, Balleisen L, Kokott R, Mesters R, Stenzinger W, Clemetson KJ, van de Loo J: Deficiency of intact thrombospondin and membrane glycoprotein Ia in platelets with defective collagen-induced aggregation and spontaneous loss of disorder. Blood 71:1074, 1988[Abstract/Free Full Text]

13. Deckmyn H, Chew SL, Vermylen L: Lack of platelet response to collagen associated with an autoantibody against glycoprotein Ia: A novel cause of acquired qualitative platelet dysfunction. Thromb Haemost 64:74, 1990[Medline] [Order article via Infotrieve]

14. Deckmyn H, Zhang J, Van Houtte E, Vermylen J: Production and nucleotide sequence of an inhibitory human IgM autoantibody directed against platelet glycoprotin Ia/IIa. Blood 84:1968, 1994[Abstract/Free Full Text]

15. Kunicki TJ, Orchekowski R, Annis D, Honda Y: Variability of integrin alpha 2beta 1 activity on human platelets. Blood 82:2693, 1993[Abstract/Free Full Text]

16. Montgomery RR, Kunicki TJ, Taves C, Pidard D, Corcoran M: Diagnosis of Bernard-Soulier syndrome and Glanzmann's thrombasthenia with a monoclonal assay on whole blood. J Clin Invest 71:385, 1983

17. Pischel KD, Hemler ME, Huang C, Bluestein HG, Woods VL Jr: Use of the monoclonal antibody 12F1 to characterize the differentiation antigen VLA-2. J Immunol 138:226, 1987[Abstract]

18. Pidard D, Montgomery RR, Bennett JS, Kunicki TJ: Interaction of AP-2, a monoclonal antibody specific for human platelet glycoprotein IIb-IIIa complex, with intact platelets. J Biol Chem 258:12582, 1983[Abstract/Free Full Text]

19. Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ: Isolation of biologically active ribonucleic acid from sources rich in ribonuclease. Biochemistry 18:5294, 1979[Medline] [Order article via Infotrieve]

20. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, Mullis KB, Erlich HA: Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487, 1988[Abstract/Free Full Text]

21. Takada Y, Hemler ME: The primary structure of the VLA-2/collagen receptor a2 subunit (platelet GPIa): Homology to other integrins and the presence of a possible collagen-binding domain. J Cell Biol 109:397, 1989[Abstract/Free Full Text]

22. Santoso S, Kalb R, Walka V, Kiefel V, Mueller-Eckhardt C, Newman PJ: The human platelet alloantigens Br(a) and Br(b) are associated with a single amino acid polymorphism on glycoprotein Ia (integrin subunit alpha 2). J Clin Invest 92:2427, 1993

23. Beutler E, West C, Gelbart T: Polymorphisms in the human glucocerebrosidase gene. Genomics 12:795, 1995

24. Glenn D, Gelbart T, Beutler E: Tight linkage of pyruvate kinase (PKLR) and glucocerebrosidase (GBA) genes. Hum Genet 93:635, 1994[Medline] [Order article via Infotrieve]

25. Zimran A, Gelbart T, Beutler E: Linkage of PvuII polymorphism with the common Jewish mutation for Gaucher disease. Am J Hum Genet 46:902, 1990[Medline] [Order article via Infotrieve]

26. Beutler E, Kuhl W: Linkage between a PvuII restriction fragment length polymorphism of G6PD A-202A/376G: Evidence for a single origin of the common G6PD A-mutation. Hum Genet 85:9, 1990[Medline] [Order article via Infotrieve]

27. Beelman CA, Parker R: Degradation of mRNA in eukaryotes. Cell 81:179, 1995[Medline] [Order article via Infotrieve]

28. Zutter MM, Santoro SA: Widespread histologic distribution of the alpha 2beta 1 integrin cell-surface collagen receptor. Am J Pathol 137:113, 1990[Abstract]

29. Zutter MM, Painter AA, Staatz WD, Tsung YL: Regulation of alpha 2 integrin gene expression in cells with megakaryocytic features: A common theme of three necessary elements. Blood 86:3006, 1995[Abstract/Free Full Text]

30. Burger SR, Zutter MM, Sturgill-Koszycki S, Santoro SA: Induced cell surface expression of functional alpha 2beta 1 integrin during megakaryocytic differentiation of K562 leukemic cells. Exp Cell Res 202:28, 1992[Medline] [Order article via Infotrieve]

31. Zutter MM, Fong AM, Krigman HR, Santoro SA: Differential regulation of the alpha 2beta 1 and alpha IIbbeta 3 integrin genes during megakaryocytic differentiation of pluripotential K562 cells. J Biol Chem 267:20233, 1992[Abstract/Free Full Text]

32. Hemler ME: VLA proteins in the integrin family: Structures, functions, and their role on leukocytes. Annu Rev Immunol 8:365, 1990[Medline] [Order article via Infotrieve]

33. Zutter MM, Santoro SA, Painter AS, Tsung YL, Gafford A: The human alpha 2 integrin gene promoter. Identification of positive and negative regulatory elements important for cell-type and developmentally restricted gene expression. J Biol Chem 269:463, 1994[Abstract/Free Full Text]

34. Ravid K, Doi T, Beeler DL, Kuter DJ, Rosenberg RD: Transcriptional regulation of the rat platelet factor 4 gene: Interaction between an enhancer/silencer domain and the GATA site. Mol Cell Biol 11:6116, 1991[Abstract/Free Full Text]

35. Weiss HJ, Turitto VT, Baumgartner HR: Role of shear rate and platelets in promoting fibrin formation on rabbit subendothelium. Studies utilizing patients with quantitative and qualitative platelet defects. J Clin Invest 78:1072, 1986

36. Walsh PN: Platelet-coagulant protein interactions, in Colman RW, Hirsh J, Marder VJ, Salzman EW (eds): Hemostasis and Thrombosis, Philadelphia, PA, Lippincott, 1994, p 629

37. Hemker HC, van Rijn JLML, Rosing J, van Dieijen G, Bevers EM, Zwaal RFA: Platelet membrane involvement in blood coagulation. Blood Cells 9:303, 1983[Medline] [Order article via Infotrieve]

38. Mann KG, Krishnaswamy S, Lawson JH: Surface-dependent hemostasis. Semin Hematol 29:213, 1992[Medline] [Order article via Infotrieve]

39. Kawamoto Y, Kaibara M: Reconstituted collagen is not capable of activating factor XII but causes intrinsic coagulation by activating platelets. Blood Coagul Fibrinolysis 3:1, 1992


© 1997 by The American Society of Hematology.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Ann Rheum DisHome page
S Jimenez, D Tassies, G Espinosa, A Garcia-Criado, J Plaza, J Monteagudo, R Cervera, and J C Reverter
Double heterozygosity polymorphisms for platelet glycoproteins Ia/IIa and IIb/IIIa increases arterial thrombosis and arteriosclerosis in patients with the antiphospholipid syndrome or with systemic lupus erythematosus
Ann Rheum Dis, June 1, 2008; 67(6): 835 - 840.
[Abstract] [Full Text] [PDF]


Home page
Ann. Thorac. Surg.Home page
E. Lim, S. Carballo, J. Cornelissen, Z. A. Ali, R. Grignani, S. Bellm, and S. Large
Dose-Related Efficacy of Aspirin After Coronary Surgery in Patients With PlA2 Polymorphism (NCT00262275)
Ann. Thorac. Surg., January 1, 2007; 83(1): 134 - 138.
[Abstract] [Full Text] [PDF]


Home page
CLIN APPL THROMB HEMOSTHome page
G. Okumus, E. Kiyan, O. Arseven, L. Tabak, E. K. Bayrak, N. E. Unaltuna, and H. Issever
Platelet Glycoprotein Ia 807c/T and 873g/A Polymorphisms in Patients With Venous Thromboembolism
Clinical and Applied Thrombosis/Hemostasis, January 1, 2007; 13(1): 101 - 103.
[Abstract] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
F. F. Samaha and M. L. Kahn
Novel Platelet and Vascular Roles for Immunoreceptor Signaling
Arterioscler. Thromb. Vasc. Biol., December 1, 2006; 26(12): 2588 - 2593.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
C. Antoniades, D. Tousoulis, C. Vasiliadou, E. Stefanadi, K. Marinou, and C. Stefanadis
Genetic Polymorphisms of Platelet Glycoprotein Ia and the Risk for Premature Myocardial Infarction: Effects on the Release of sCD40L During the Acute Phase of Premature Myocardial Infarction
J. Am. Coll. Cardiol., May 16, 2006; 47(10): 1959 - 1966.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
K. V. Vijayan and P. F. Bray
Molecular Mechanisms of Prothrombotic Risk Due to Genetic Variations in Platelet Genes: Enhanced Outside-In Signaling Through the Pro33 Variant of Integrin {beta}3.
Experimental Biology and Medicine, May 1, 2006; 231(5): 505 - 513.
[Abstract] [Full Text] [PDF]


Home page
JDRHome page
M. Ogino, J. Kido, M. Bando, N. Hayashi, C. Wada, T. Nagata, F. Nishimura, Y. Soga, S. Takashiba, T. Kubota, et al.
{alpha}2 Integrin +807 Polymorphism in Drug-induced Gingival Overgrowth
Journal of Dental Research, December 1, 2005; 84(12): 1183 - 1186.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
N. Ajzenberg, C. Berroeta, I. Philip, B. Grandchamp, P. Ducellier, V. Huart, P. Verpillat, M.-C. Guillin, and J. Benessiano
Association of the -92C/G and 807C/T Polymorphisms of the {alpha}2 Subunit Gene With Human Platelets {alpha}2{beta}1 Receptor Density
Arterioscler. Thromb. Vasc. Biol., August 1, 2005; 25(8): 1756 - 1760.
[Abstract] [Full Text] [PDF]


Home page
Diabetes and Vascular Disease ResearchHome page
B. Stratmann and D. Tschoepe
Pathobiology and cell interactions of platelets in diabetes
Diabetes and Vascular Disease Research, February 1, 2005; 2(1): 16 - 23.
[Abstract] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
S. L. Hetherington, R. K. Singh, D. Lodwick, J. R. Thompson, A. H. Goodall, and N. J. Samani
Dimorphism in the P2Y1 ADP Receptor Gene Is Associated With Increased Platelet Activation Response to ADP
Arterioscler. Thromb. Vasc. Biol., January 1, 2005; 25(1): 252 - 257.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
S. Gruner, M. Prostredna, B. Aktas, A. Moers, V. Schulte, T. Krieg, S. Offermanns, B. Eckes, and B. Nieswandt
Anti-Glycoprotein VI Treatment Severely Compromises Hemostasis in Mice With Reduced {alpha}2{beta}1 Levels or Concomitant Aspirin Therapy
Circulation, November 2, 2004; 110(18): 2946 - 2951.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
F. F. Samaha, C. Hibbard, J. Sacks, H. Chen, M. A. Varello, T. George, and M. L. Kahn
Measurement of Platelet Collagen Receptor Density in Human Subjects
Arterioscler. Thromb. Vasc. Biol., November 1, 2004; 24(11): e181 - e182.
[Full Text] [PDF]


Home page
BloodHome page
P. Nurden, M. Jandrot-Perrus, R. Combrie, J. Winckler, V. Arocas, C. Lecut, J.-M. Pasquet, T. J. Kunicki, and A. T. Nurden
Severe deficiency of glycoprotein VI in a patient with gray platelet syndrome
Blood, July 1, 2004; 104(1): 107 - 114.
[Abstract] [Full Text] [PDF]


Home page
HeartHome page
A M Leone, V De Stefano, F Burzotta, P Chiusolo, I Casorelli, K Paciaroni, E Rossi, A Sciahbasi, L Testa, G Leone, et al.
Glycoprotein Ia C807T gene polymorphism and increased risk of recurrent acute coronary syndromes: a five year follow up
Heart, May 1, 2004; 90(5): 567 - 569.
[Full Text] [PDF]


Home page
BloodHome page
T.-T. Li, S. Larrucea, S. Souza, S. M. Leal, J. A. Lopez, E. M. Rubin, B. Nieswandt, and P. F. Bray
Genetic variation responsible for mouse strain differences in integrin {alpha}2 expression is associated with altered platelet responses to collagen
Blood, May 1, 2004; 103(9): 3396 - 3402.
[Abstract] [Full Text] [PDF]


Home page
SEMIN CARDIOTHORAC VASC ANESTHHome page
R. D. McBane II
Genetically Determined Procoagulant States and Heparin Use
Seminars in Cardiothoracic and Vascular Anesthesia, December 1, 2003; 7(4): 427 - 442.
[Abstract] [PDF]


Home page
BloodHome page
S. Gruner, M. Prostredna, V. Schulte, T. Krieg, B. Eckes, C. Brakebusch, and B. Nieswandt
Multiple integrin-ligand interactions synergize in shear-resistant platelet adhesion at sites of arterial injury in vivo
Blood, December 1, 2003; 102(12): 4021 - 4027.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. He, L. K. Pappan, D. G. Grenache, Z. Li, D. M. Tollefsen, S. A. Santoro, and M. M. Zutter
The contributions of the {alpha}2{beta}1 integrin to vascular thrombosis in vivo
Blood, November 15, 2003; 102(10): 3652 - 3657.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
D. G. Grenache, T. Coleman, C. F. Semenkovich, S. A. Santoro, and M. M. Zutter
{alpha}2{beta}1 Integrin and Development of Atherosclerosis in a Mouse Model: Assessment of Risk
Arterioscler. Thromb. Vasc. Biol., November 1, 2003; 23(11): 2104 - 2109.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
L. Macchi, L. Christiaens, S. Brabant, N. Sorel, S. Ragot, J. Allal, G. Mauco, and A. Brizard
Resistance in vitro to low-dose aspirin is associated with platelet PlA1 (GP IIIa) polymorphism but not with C807T(GP Ia/IIa) and C-5T kozak (GP Ib{alpha}) polymorphisms
J. Am. Coll. Cardiol., September 17, 2003; 42(6): 1115 - 1119.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. Nieswandt and S. P. Watson
Platelet-collagen interaction: is GPVI the central receptor?
Blood, July 15, 2003; 102(2): 449 - 461.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Joutsi-Korhonen, P. A. Smethurst, A. Rankin, E. Gray, M. IJsseldijk, C. M. Onley, N. A. Watkins, L. M. Williamson, A. H. Goodall, P. G. de Groot, et al.
The low-frequency allele of the platelet collagen signaling receptor glycoprotein VI is associated with reduced functional responses and expression
Blood, June 1, 2003; 101(11): 4372 - 4379.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Dupont, P. Fontana, C. Bachelot-Loza, J.-L. Reny, I. Bieche, F. Desvard, M. Aiach, and P. Gaussem
An intronic polymorphism in the PAR-1 gene is associated with platelet receptor density and the response to SFLLRN
Blood, March 1, 2003; 101(5): 1833 - 1840.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
L. Pontiggia, R. Lassila, S. Pederiva, H.-R. Schmid, M. Burger, and J. H. Beer
Increased Platelet-Collagen Interaction Associated With Double Homozygosity for Receptor Polymorphisms of Platelet GPIa and GPIIIa
Arterioscler. Thromb. Vasc. Biol., December 1, 2002; 22(12): 2093 - 2098.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
T. Maeno, H. Koyama, H. Tahara, M. Komatsu, M. Emoto, T. Shoji, M. Inaba, T. Miki, Y. Okuno, and Y. Nishizawa
The 807T Allele in {alpha}2 Integrin Is Protective Against Atherosclerotic Arterial Wall Thickening and the Occurrence of Plaque in Patients With Type 2 Diabetes
Diabetes, May 1, 2002; 51(5): 1523 - 1528.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
G. Benze, J. Heinrich, H. Schulte, S. Rust, U. Nowak-Gottl, M.-C. Tataru, E. Kohler, G. Assmann, and R. Junker
Association of the GPIa C807T and GPIIIa PlA1/A2 polymorphisms with premature myocardial infarction in men
Eur. Heart J., February 2, 2002; 23(4): 325 - 330.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. J. Raife, S. R. Lentz, B. S. Atkinson, S. K. Vesely, and M. J. Hessner
Factor V Leiden: a genetic risk factor for thrombotic microangiopathy in patients with normal von Willebrand factor-cleaving protease activity
Blood, January 15, 2002; 99(2): 437 - 442.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. J. Kunicki
The Influence of Platelet Collagen Receptor Polymorphisms in Hemostasis and Thrombotic Disease
Arterioscler. Thromb. Vasc. Biol., January 1, 2002; 22(1): 14 - 20.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
K. Furihata, K. J. Clemetson, H. Deguchi, and T. J. Kunicki
Variation in Human Platelet Glycoprotein VI Content Modulates Glycoprotein VI-Specific Prothrombinase Activity
Arterioscler. Thromb. Vasc. Biol., November 1, 2001; 21(11): 1857 - 1863.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
M. J. Hessner, D. M. Dinauer, R. Kwiatkowski, B. Neri, and T. J. Raife
Age-dependent Prevalence of Vascular Disease-associated Polymorphisms among 2689 Volunteer Blood Donors
Clin. Chem., October 1, 2001; 47(10): 1879 - 1884.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
S. Ilveskero, P. Siljander, and R. Lassila
Procoagulant Activity on Platelets Adhered to Collagen or Plasma Clot
Arterioscler. Thromb. Vasc. Biol., April 1, 2001; 21(4): 628 - 635.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. Jacquelin, M. D. Tarantino, M. Kritzik, D. Rozenshteyn, J. A. Koziol, A. T. Nurden, and T. J. Kunicki
Allele-dependent transcriptional regulation of the human integrin {alpha}2 gene
Blood, March 15, 2001; 97(6): 1721 - 1726.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
M. Roest, J. D. Banga, D. E. Grobbee, P. G. de Groot, J. J. Sixma, M. J. Tempelman, and Y. T. van der Schouw
Homozygosity for 807 T Polymorphism in {alpha}2 Subunit of Platelet {alpha}2{beta}1 Is Associated With Increased Risk of Cardiovascular Mortality in High-Risk Women
Circulation, October 3, 2000; 102(14): 1645 - 1650.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Roest, J. J. Sixma, Y.-P. Wu, M. J. W. Ijsseldijk, M. Tempelman, P. J. Slootweg, P. G. de Groot, and G. H. van Zanten
Platelet adhesion to collagen in healthy volunteers is influenced by variation of both alpha 2beta 1 density and von Willebrand factor
Blood, August 15, 2000; 96(4): 1433 - 1437.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
A. P. Reiner, P. N. Kumar, S. M. Schwartz, W. T. Longstreth Jr, R. M. Pearce, F. R. Rosendaal, B. M. Psaty, and D. S. Siscovick
Genetic Variants of Platelet Glycoprotein Receptors and Risk of Stroke in Young Women
Stroke, July 1, 2000; 31(7): 1628 - 1633.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. von Beckerath, W. Koch, J. Mehilli, C. Bottiger, A. Schomig, and A. Kastrati
Glycoprotein Ia gene C807T polymorphism and risk for major adverse cardiac events within the first 30 days after coronary artery stenting
Blood, June 1, 2000; 95(11): 3297 - 3301.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Matsubara, M. Murata, T. Maruyama, M. Handa, N. Yamagata, G. Watanabe, T. Saruta, and Y. Ikeda
Association between diabetic retinopathy and genetic variations in alpha 2beta 1 integrin, a platelet receptor for collagen
Blood, March 1, 2000; 95(5): 1560 - 1564.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Santoso, J. Amrhein, H. A. Hofmann, U. J.H. Sachs, M. M. Walka, H. Kroll, and V. Kiefel
A Point Mutation Thr799Met on the alpha 2 Integrin Leads to the Formation of New Human Platelet Alloantigen Sita and Affects Collagen-Induced Aggregation
Blood, December 15, 1999; 94(12): 4103 - 4111.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. A. Santoro
Platelet Surface Collagen Receptor Polymorphisms: Variable Receptor Expression and Thrombotic/Hemorrhagic Risk
Blood, June 1, 1999; 93(11): 3575 - 3577.
[Full Text] [PDF]


Home page
BloodHome page
J. Di Paola, A. B. Federici, P.M. Mannucci, M. T. Canciani, M. Kritzik, T. J. Kunicki, and D. Nugent
Low Platelet alpha 2beta 1 Levels in Type I von Willebrand Disease Correlate With Impaired Platelet Function in a High Shear Stress System
Blood, June 1, 1999; 93(11): 3578 - 3582.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. E. Carlsson, S. Santoso, C. Spitzer, C. Kessler, and A. Greinacher
The alpha 2 Gene Coding Sequence T807/A873 of the Platelet Collagen Receptor Integrin alpha 2beta 1 Might Be a Genetic Risk Factor for the Development of Stroke in Younger Patients
Blood, June 1, 1999; 93(11): 3583 - 3586.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Santoso, T.J. Kunicki, H. Kroll, W. Haberbosch, and A. Gardemann
Association of the Platelet Glycoprotein Ia C807T Gene Polymorphism With Nonfatal Myocardial Infarction in Younger Patients
Blood, April 15, 1999; 93(8): 2449 - 2453.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Kritzik, B. Savage, D. J. Nugent, S. Santoso, Z. M. Ruggeri, and T. J. Kunicki
Nucleotide Polymorphisms in the alpha 2 Gene Define Multiple Alleles That Are Associated With Differences in Platelet alpha 2beta 1 Density
Blood, October 1, 1998; 92(7): 2382 - 2388.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. M. Jung and M. Moroi
Platelets Interact with Soluble and Insoluble Collagens through Characteristically Different Reactions
J. Biol. Chem., June 12, 1998; 273(24): 14827 - 14837.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A.-H. Lagrue-Lak-Hal, N. Debili, G. Kingbury, C. Lecut, J.-P. Le Couedic, J.-L. Villeval, M. Jandrot-Perrus, and W. Vainchenker
Expression and Function of the Collagen Receptor GPVI during Megakaryocyte Maturation
J. Biol. Chem., April 27, 2001; 276(18): 15316 - 15325.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Jacquelin, D. Rozenshteyn, S. Kanaji, J. A. Koziol, A. T. Nurden, and T. J. Kunicki
Characterization of Inherited Differences in Transcription of the Human Integrin alpha 2 Gene
J. Biol. Chem., June 22, 2001; 276(26): 23518 - 23524.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kunicki, T. J.
Right arrow Articles by Nugent, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kunicki, T. J.
Right arrow Articles by Nugent, D. J.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1997 by American Society of Hematology         Online ISSN: 1528-0020