SEARCH:   Advanced

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Ozsahin, H. Articles by Hershfield, M. S. Search for Related Content PubMed PubMed Citation Articles by Ozsahin, H. Articles by Hershfield, M. S. Related Collections Immunobiology Social Bookmarking                   What's this?  Previous Article  |  Table of Contents  |  Next Article  Blood, Vol. 89 No. 8 (April 15), 1997: pp. 2849-2855 Adenosine Deaminase Deficiency in Adults By Hulya Ozsahin, Francisco X. Arredondo-Vega, Ines Santisteban, Hanspeter Fuhrer, Peter Tuchschmid, Wolfram Jochum, Adriano Aguzzi, Howard M. Lederman, Amy Fleischman, Jerry A. Winkelstein, Reinhard A. Seger, and Michael S. Hershfield From the Division of Immunology/Hematology, University Children's Hospital, Zurich, Switzerland; the Departments of Medicine and Biochemistry, Duke University School of Medicine, Durham, NC; the Department of Medicine. Triemli Hospital, Zurich Switzerland; the Neuropathology Institute of the University of Zurich, Switzerland; and the Eudowood Division of Pediatric Immunology, The Johns Hopkins University School of Medicine, Baltimore, MD.     ABSTRACT Abstract Introduction Methods Results Discussion References Adenosine deaminase (ADA) deficiency typically causes severe combined immunodeficiency (SCID) in infants. We report metabolic, immunologic, and genetic findings in two ADA-deficient adults with distinct phenotypes. Patient no. 1 (39 years of age) had combined immunodeficiency. She had frequent infections, lymphopenia, and recurrent hepatitis as a child but did relatively well in her second and third decades. Then she developed chronic sinopulmonary infections, including tuberculosis, and hepatobiliary disease; she died of viral leukoencephalopathy at 40 years of age. Patient no. 2, a healthy 28-year-old man with normal immune function, was identified after his niece died of SCID. Both patients lacked erythrocyte ADA activity but had only modestly elevated deoxyadenosine nucleotides. Both were heteroallelic for missense mutations: patient no. 1, G216R and P126Q (novel); patient no. 2, R101Q and A215T. Three of these mutations eliminated ADA activity, but A215T reduced activity by only 85%. Owing to a single nucleotide change in the middle of exon 7, A215T also appeared to induce exon 7 skipping. ADA deficiency is treatable and should be considered in older patients with unexplained lymphopenia and immune deficiency, who may also manifest autoimmunity or unexplained hepatobiliary disease. Metabolic status and genotype may help in assessing prognosis of more mildly affected patients.     INTRODUCTION Abstract Introduction Methods Results Discussion References DEFICIENCY OF adenosine deaminase (ADA) typically causes Severe Combined Immune Deficiency (SCID) in infants, who present with growth failure, opportunistic infections, lymphopenia, and defective cellular and humoral immune function.1,2 Immunodeficiency results from toxic effects of ADA substrates, including apoptosis induced by deoxyadenosine triphosphate (dATP) pool expansion3-5 and inhibition of transmethylation reactions caused by impaired catabolism of S-adenosylhomocysteine6-8 (reviewed in Hershfield et al2 ). ADA- SCID is treatable by marrow transplantation and enzyme replacement; gene therapy trials are underway. After the discovery of ADA- SCID in 1972, screening programs identified rare healthy children whose red blood cells (RBCs) lacked ADA but whose nucleated cells had 5% to 70% of normal activity (partial deficiency).9-13 More recently, ADA deficiency has been discovered in several older children and in two sisters in their mid-30s with late or adult onset of immunodeficiency.14-17 More than 40 mutant ADA alleles have been identified.2,18 In SCID patients, neither allele encodes an active enzyme, whereas in more mildly affected patients, at least one ADA gene product appears to have some function. The extent of deoxyadenosine (dAdo) induced dATP accumulation and S-adenosylhomocysteine hydrolase inactivation in RBCs reflect the degree of ADA deficiency.19-21 Whether some children with partial ADA deficiency progress to an immune deficient state is unclear. To date, ADA deficiency has been identified as a cause of adult-onset immunodeficiency in only a single family.17 Because of atypical features, older patients may be misdiagnosed with a disease of unknown cause, such as common variable immunodeficiency or idiopathic CD4+ T lymphocytopenia.22,23 To better define and increase awareness of the spectrum of manifestations in adults, we report the metabolic, immunologic, and genetic findings in two patients diagnosed with ADA deficiency in adult life: one overtly immunodeficient and the other still in good health.     MATERIALS AND METHODS Abstract Introduction Methods Results Discussion References Study Subjects Patient no. 1. This cachectic 39-year-old woman was referred to the University of Zurich pediatric clinic for immunologic evaluation. She had been hospitalized eight times for pneumonitis in the previous year. Her family history was unremarkable and included a healthy 13-year-old daughter. In early childhood she had eczematoid dermatitis and frequent febrile convulsions, otitis media, pneumonitis, hepatitis, furunculosis, and diarrhea. At 5 years of age, perforating appendicitis was complicated by abdominal wall necrosis; her granulocyte count was 1,100/µL and her lymphocyte count was 900/µL. An extensive search, including spleen biopsy, failed to account for neutropenia, lymphopenia, thrombocytopenia, hepatitis, and splenomegaly. Pulmonary infections were frequent until age 11; leukopenia persisted. The patient then did fairly well until age 28, when she became septic after cesarian section. A year later she developed hepatomegaly, cholecystitis, and cholelithiasis. Liver biopsy specimens showed granulomas of undetermined cause. She developed pancytopenia and chronic sinopulmonary infections. Asthma and serum IgE of 1,780 International Units (IU)/mL (normal, 47 to 200 IU/mL) raised suspicion of hyper-IgE syndrome. At age 30 she was treated for pulmonary tuberculosis; at age 34 she underwent lobectomy for hemoptysis. At age 38, computerized tomography (CT) showed diffuse pulmonary miliary infiltrates with fibrosis and bronchiectasis, hepatosplenomegaly, and cholelithiasis. Immunologic evaluation at age 39 showed a total lymphocyte count of 275/µL (CD4+ T lymphocytes, 190/µL; CD8+ T lymphocytes, 60/µL; and CD19+ B lymphocytes, 20/µL). Lymphoproliferative responses to mitogens were diminished (phytohemagglutinin, 34,051 disintigrations per minute (dpm); pokeweed mitogen, 10,917 dpm; and anti-CD3 34,947 dpm) and were absent to antigens (candidin, diphtheria, cytomegalovirus, and tetanus). IgG measured 1 week after an intravenous Ig infusion was normal at 14.7 g/L (IgG1, 12.0 g/L; IgG2, 0.61 g/L). IgA (1.05 g/L) and IgM (0.3 g/L) were both less than the 10th percentile. IgE was 1,232 IU/mL. No antibody response could be detected to pneumococcal polysaccharide, diphtheria, or tetanus toxoids. Rheumatoid factor (RF), antinuclear antibody (ANA), antinative DNA, and Coombs' tests were negative. Human immunodeficiency virus was excluded by polymerase chain reaction (PCR). Because these findings pointed to combined T- and B-cell immunodeficiency, metabolic studies were performed, which led to the diagnosis of ADA deficiency. Five months after diagnosis and while receiving corticosteroid therapy for chronic obstructive pulmonary disease, patient no. 1 developed gastrointestinal candidiasis and progressive hemiplegia. Brain CT and magnetic resonance imaging (MRI) studies showed the evolution over several weeks of multiple hypodense ischemic foci and central pontine myelinosis. Brain biopsy specimens established the diagnosis of progressive multifocal leukoencephalopathy caused by JC virus. She died after developing tetraplegia and bulbar paralysis. Patient no. 2. This 28-year-old man was found to lack erythrocyte ADA activity while screening the family of his infant niece, who had died after a haploidentical bone marrow transplant for ADA- SCID. His past history was unremarkable except for recurrent tonsillitis beginning at age 10 years, which ceased after a tonsillectomy at age 23. He had no history of recurrent otitis, bronchitis, pneumonia, sepsis, meningitis, or hepatitis. Hematologic and immunologic evaluation showed a white blood cell (WBC) count of 5,700/µL with 25% lymphocytes (1,420/µL), 66% neutrophils, 5% monocytes, 3% eosinophils, and 1% basophils. He had 82.9% CD3+ T cells, 64.7% CD4+ T cells (906/µL), and 17.4% CD8+ T cells (CD4/CD8 ratio, 3.72). Serum IgG was 708 mg/dL, IgA was 246 mg/dL, and IgM was 65 mg/dL. He had protective levels of serum antibody to rubella, rubeola, mumps, tetanus, and Haemophilus influenzae type b. Lymphoproliferative responses to mitogens, tetanus toxoids, and allogeneic cells were normal. Mutational Analysis ADA cDNA and genomic sequences are as reported.24,25 General PCR methods for amplifying ADA genomic and cDNA segments (the latter numbered from the start of transcription, with translation starting at position 96) and for cloning and sequencing PCR products are as described.16,26,27 Specific target sequences amplified for this study included (primers listed in Table 1): cDNA nucleotide (nt) 16 to 1,497 (full length), primers 1 and 2; cDNA nt 96 to 1,188 (coding region), primers 3 and 4; genomic exon 7 (nt 28,376 to 29,115 spanning introns 6 to 9), primers 5 and 6; and genomic exon 5 (nt 25,794 to 26,169), primers 7 and 8.   View this table: [in this window] [in a new window]   Table 1. List of PCR Primers Single-Strand Conformational Polymorphism (SSCP) Analysis The amplified genomic exon 5 product was subjected to nested PCR of nt 25,861 to 26,031 with primer 9 (5' end-labeled with 32P-dATP) and primer 10. The product was denatured and electrophoresed on a 0.5× MDETM gel containing 10% glycerol, followed by autoradiography, as recommended by the gel manufacturer (AT Biochem, Malvern, PA). For dideoxy sequencing, a separate nested PCR product (nt 25,794 to 26,169) was generated using unlabeled primers 9 and 10. Screening cDNA Subclones for the R101Q Mutation and Retention of Exon 7 cDNA nt 96 to 872 (ATG start codon through exon 8) was amplified with primers 3 and 11. Bsg I digestion then distinguished exon 4 wild type (resistant) from R101Q mutant clones (sensitive). cDNA nt 471 to 1,126 (exons 5 to 11) was amplified using primers 12 and 13. Digestion with Nci I then distinguished clones containing exon 7 (sensitive) from those lacking exon 7 (resistant). The normal exon 7 Nci I site is unaffected by the A215T mutation. Construction of ADA cDNA Containing the P126Q or A215T Mutations P1260 cDNA. Using recombinant PCR,28 two primary PCR reactions were performed with wild-type ADA cDNA as template and the primer pairs (mutation underlined): (1) P126Q (+), 5'GAAGGGGACCTCACCCAGACGA and primer 4; and (2) primer 3 and P126Q (-) 5'CCACCTCGTCTGGGTGAGGT. The two PCR products (having a central 15-bp overlap) were gel purified, combined, annealed, and amplified with primers 3 and 4. The final product was gel purified, cut with EcoRI/HindIII, and cloned into pBluescript (Stratagene, La Jolla, CA). Sequencing identified the P126Q mutation and no other change. A215T cDNA. Primers for the primary reactions were (1) primer 2 and A215T (+) 5'ACTGTCCACCCGGGGAGGT; and (2) primer 1 and A215T (-) 5'CCTCCCCGGGTGGACAG. The products were purified, annealed, extended, amplified with primers 1 and 2, cut with EcoRI/HindIII, and cloned into pBluescript. Sequencing showed the A215T mutation and no other change. Effect of Mutations on ADA Catalytic Activity As reported,16,27,29 mRNA transcribed in vitro from wild-type and mutant ADA cDNA subclones was translated in a rabbit reticulocyte lysate in the presence of [35S]methionine. Aliquots containing equal amounts of wild-type and mutant translation products (shown by 10% sodium dodecyl sulfate-mercaptoethanol polyacrylamide gel electrophoresis and fluorography) were electrophoresed on cellulose acetate and stained for ADA activity in situ.     RESULTS Abstract Introduction Methods Results Discussion References Patient No. 1 (CKu) and Family In RBC of patient no. 1, ADA activity was 0.2 nmol/h/mg protein (normal ± 1 standard deviation [SD], 80.4 ± 40.2); S-adenosylhomocysteine hydrolase activity was 0.59 nmol/h/mg (normal, 4.2 ± 1.9); and total deoxyadenosine nucleotides (dAXP) were 28 nmol/mL (normal, <2). Blood mononuclear cells were not available for analysis. BstXI digestion of exon 7 amplified from genomic DNA of patient no. 1 indicated heterozygosity for the mutation, codon 216 GGGGlycine to AGGArginine (G216R) (data not shown), which occurs in 10% to 15% of ADA-deficient patients16,30 (and unpublished data). SSCP analysis suggested that her second ADA allele had a mutation in exon 5 (Fig 1A). Sequencing of amplified genomic exon 5 showed heterozygosity for a C > A transversion of genomic nt 25902 (mRNA nt 472; Fig 1B). This mutation, codon 126 CCAProline to CAAGlutamine (P126Q), has not been previously reported. Patient no. 1 had inherited G216R from her mother and P126Q from her father; she transmitted P126Q to her daughter (data not shown, Fig 1C). View larger version (109K): [in this window] [in a new window]   View larger version (129K): [in this window] [in a new window]   View larger version (31K): [in this window] [in a new window]   Fig 1. Analysis of ADA genotype of patient no. 1 and family. (A) SSCP analysis of genomic exon 5. Lanes 1 and 2, controls; lane 3, patient no. 1. (B) Sequencing gel showing heterozygosity of patient no. 1 for the P126Q mutation in genomic exon 5 DNA. (C) Pedigree of family 1. Arrow indicates patient no. 1 (II-1). Patient No. 2 and Family In the SCID proband (III-1, Fig 2A), RBC ADA was 0.1 nmol/h/mg protein, and dAXP were 508 nmol/mL. These values for patient no. 2, her healthy maternal uncle (II-3, Fig 2A), were <0.1 nmol/h/mg and 15 nmol/ml, respectively. All other family members studied had normal or heterozygous range ADA activity and undetectable dAXP. ADA activity in cultured T cells from patient no. 2 was 170 nmol/h/mg protein versus 1,435 and 1,918 for T cells of his sister and her husband, the parents of the SCID proband (normal, 2,047 ± 1,36016). View larger version (24K): [in this window] [in a new window]   View larger version (91K): [in this window] [in a new window]   View larger version (75K): [in this window] [in a new window]   Fig 2. Analysis of ADA cDNA and genomic DNA of patient no. 2 and family. (A) Pedigree of family 2. Arrow indicates patient no. 2 (II-3); indicates the deceased proband (III-1), an infant with SCID whose genotype is presumed. (B) Sequence of genomic exon 7 DNA (patient no. 2, left; control, right). Patient no. 2 is heterozygous for the A215T mutation. (C) Ethidium-stained agarose gel illustrating the method of screening cDNA clones for the R101Q mutation and for retention of exon 7 (see the Materials and Methods). Numbers at right indicate length in nucleotides of DNA markers. Lanes 1 and 2, PCR fragments (exons 1 to 8) digested with Bsg I. Lane 1, clone bearing R101Q mutation (cuts with Bsg I); lane 2, clone with wild-type (R101) exon 4 (lacks Bsg I site). Lanes 3 and 4, PCR fragments (exons 5 to 11) digested with Nci I. Lane 3, clone containing exon 7 (cuts with Nci I within exon 7); lane 4, clone with a deletion of exon 7 (lacks exon 7 Nci I site). Five ADA cDNA subclones from T cells of patient no. 2 had a previously reported exon 4 mutation, codon 101 CGGArginine to CAGGlutamine (R101Q).31 Amplified genomic DNA was heterozygous for a Bsg I site created by R101Q. Three cDNA subclones lacking this Bsg I site had a deletion of exon 7, but no other mutation, suggesting that his second allele might have a deletion or splice site mutation of exon 7. Sequencing of his amplified genomic DNA showed normal exon 7 splice junctions, but heterozygosity for a previously reported exon 7 missense mutation, codon 215 GCCAlanine to ACCThreonine (A215T; Fig 2B).13 Analysis of family members indicated that patient no. 2 had inherited A215T maternally and R101Q paternally (Fig 2A). His sister had inherited a wild-type allele and R101Q, and her husband was heterozygous for G216R; they had presumably transmitted R101Q and G216R alleles to their ADA- SCID daughter (who was not studied; Fig 2A). Our initial analysis of cDNA from patient no. 2 suggested an allele-specific skipping of exon 7. To assess this further, we screened a second random group of cDNA clones from his T cells (Fig 2C). Overall, of 32 clones analyzed, 4 of 8 (50%) A215T-derived clones lacked exon 7, compared with 3 of 24 (12.5%) bearing the R101Q mutation (similar to the 10% to 15% frequency of exon 7 skipping in normal cells31 ). In a previous report of a child homozygous for A215T, only four cDNA clones were sequenced, but one lacked exon 7 and another had missplicing of intron 6.13 Our data on a larger number of cDNA clones from a heteroallelic patient more clearly indicate that A215T is associated with both increased loss of exon 7 and a relative decrease in transcript level. Two other exon 7 missense mutations (G216R and R211H) did not appear to have such effects16,27 (and F.X. A.-V., I.S., M.S.H., unpublished data, Duke University). Activity of Expressed Mutant ADA Alleles The A215T in vitro translation product was 10% to 20% as active as the wild type; the newly identified P126Q mutant protein was inactive, as were the R101Q and G216R proteins (Fig 3). We have also expressed these cDNAs in Escherichia coli Sø3834 (an ADA deletion strain32 ). A215T had approximately 15% of wild-type ADA activity, compared with approximately 0.1% for P126Q and R101Q and less than 0.01% for G216R (F.X.A., I.S., M.S.H., study in progress). Because exon 7 skipping eliminates activity,33 the loss of ADA activity owing to the A215T mutation may be greater than is evident from the expressed cDNA, which reflects only the effect of the amino acid substitution. View larger version (80K): [in this window] [in a new window]   Fig 3. In situ stain for ADA activity of in vitro translation products. Arrow indicates position of human ADA. The dark bands at the bottom and top are rabbit hemoglobin and rabbit ADA, respectively, carried over from the reticulocyte translation reaction. The translation reactions were primed with the normal (wild-type) or mutant human ADA mRNAs (transcribed from cDNA); lane 1, wild-type control; lane 2, blank; lane 3, A215T (patient no. 2); lane 4, R101Q (patient no. 2); lane 5, P126Q (patient no. 1); lane 6, G216R (patient no. 1); lane 7, wild-type control.     DISCUSSION Abstract Introduction Methods Results Discussion References Lymphopenia and immune deficiency were appreciated in patient no. 1 at age 5, but ADA deficiency was then unknown and only aggressive treatment of infections could be offered. Remarkably, she survived and did relatively well from puberty until age 28, when she began to have serious respiratory infections, including tuberculosis. She developed chronic pulmonary and hepatobiliary insufficiency and at 40, fatal leukoencephalopathy caused by JC papovavirus, a disorder prevalent in the acquired immunodeficiency syndrome (AIDS).34 This history suggests that cellular and humoral immune dysfunction were not initially as complete as in SCID, which if uncorrected is fatal by age 1 to 2 years, but decreased to critical levels in the fourth decade, presumably owing to ongoing exposure to toxic metabolites. We wish to speculate that unexplained episodes of hepatitis from childhood in patient no. 1 may also have had a metabolic basis. Thus, hepatocellular degeneration is fatal in newborn ADA knockout mice,35,36 and we have reported a child with ADA- SCID who presented with persistent neonatal hepatitis, apparently without infectious cause, which resolved rapidly with enzyme replacement.37 Both mutations of patient no. 1, G216R and P126Q, greatly reduced ADA activity. However, her RBC dAXP level (28 nmol/mL) was lower than has been reported for immunodeficient patients (350 to >1,800 nmol/mL for SCID; 60 to 300 nmol/mL for those with a later onset16,26,38,39 ). This may reflect a hypoplastic marrow, because RBC dAdo (precursor of dAXP) arises from DNA degraded during normal marrow cell turnover.40,41 However, modest dAXP elevation may reflect greater residual ADA activity in vivo than suggested from cDNA expression. G216R probably eliminates activity irreversibly by interacting with the active site residue glutamate 21742; it is always associated with SCID when homozygous or combined with another severe allele (Hirschhorn et al30 and unpublished data). However, P126Q occurs in a helical segment that has no contact with the active site; this protein might be stabilized or induced to fold properly in lymphoid cells, which normally express very high ADA activity (as discussed elsewhere43 ). Another phenomenon that should be considered is somatic mosaicism, which was recently found in two ADA-deficient patients who were immunodeficient as children, but then, like patient no. 1, had remissions lasting at least into their second decade.44,45 Selective survival of ADA+ lymphocytes was postulated to explain their low RBC dAXP levels and improved immune function. Tissues from patient no. 1 were not available for study. However, her clinical improvement, although prolonged, was not sustained. If present, mosaicism may not have occurred in a stem cell, and thus might have been unstable. The A215T allele, discovered in a healthy child with partial ADA deficiency,13 can plausibly explain the benign status of patient no. 2 at age 28. A215T cDNA-encoded protein had 10% to 15% of wild-type activity, 100-fold more than his R101Q cDNA product (the SCID phenotype and high RBC dAXP of the niece of patient no. 2 is consistent with R101Q being a null mutation). Significant in vivo ADA function in patient no. 2 is indicated by activity in lysates of his T cells and by RBC dAXP in a range (20 nmol/mL) found in healthy individuals with partial ADA deficiency.20,29,46,47 We plan to monitor dAXP yearly for correlation with immunologic and clinical status. The mechanism by which A215T alters exon 7 processing (apparently enhancing an effect that occurs with normal ADA pre-mRNA31 ) is unclear. The mutation occurs at nt 37/72 of exon 7, distant from splice junctions, and it does not create a new splice site. Some midexonic nonsense mutations can, through unclear mechanisms, induce exon skipping and reduce mRNA abundance,48,49 eg, the R142X mutation at nt 62/116 of ADA exon 5.29 Skipping of exon 7 maintains reading frame, so A215T does not induce a secondary nonsense codon. Further study of the effects of A215T on splicing are warranted. ADA deficiency is treatable, but the longer diagnosis is delayed, the less reversible are its chronic consequences. Because of her age and clinical status, patient no. 1 was not a candidate for marrow transplantation. Local regulatory issues prevented access to polyethylene glycol-modified ADA (approved as an "Orphan Drug" in the United States and used in eight other countries for treating ADA deficiency50-52 ). Earlier diagnosis would have enhanced the chance of benefiting from either therapy and might have prompted avoidance of glucocorticoids, which were also used extensively before diagnosis of ADA deficiency in the adult sisters reported previously.38 There are no strict immunological parameters for identifying older ADA-deficient patients. Opportunistic infections may play a less prominent role than in patients with early onset, and older patients have manifested asthma, autoimmunity, and signs of immune dysregulation, eg, IgG subclass deficiency or elevated serum IgE.15,16,38,39 The diagnosis should be considered in adults with persistent lymphopenia and immunodeficiency of unknown cause (eg, some cases of common variable immune deficiency). Once ADA deficiency is diagnosed, metabolite and genotype analysis may help in assessing prognosis and in providing genetic counseling.     FOOTNOTES    Submitted August 2, 1996; accepted November 25, 1996.    Supported in part by grants from the National Institutes of Health (DK20902) and from Enzon, Inc to M.S.H.    Address reprint requests to Michael S. Hershfield, MD, Box 3049, Duke University Medical Center, Durham, NC 27710.    The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hearly marked ``advertisment'' in accordance with 18 U.S.C. section 1734 solely to indicate this fact.     ACKNOWLEDGMENT We gratefully acknowledge the expert technical assistance of Stephan Toutain and Marlis Schmid.     REFERENCES Abstract Introduction Methods Results Discussion References 1. Giblett ER, Anderson JE, Cohen F, Pollara B, Meuwissen HJ: Adenosine deaminase deficiency in two patients with severely impaired cellular immunity. Lancet 2:1067 1972 2. Hershfield MS, Mitchell BS: Immunodeficiency diseases caused by adenosine deaminase deficiency and purine nucleoside phosphorylase deficiency, in Scriver CR, Beaudet AL, Sly WS, Valle D (eds): The Metabolic and Molecular Bases of Inherited Disease. New York, NY, McGraw-Hill, 1995, p 1725 3. Seto S, Carrera CJ, Kubota M, Wasson DB, Carson DA: Mechanism of deoxyadenosine and 2-chlorodeoxyadenosine toxicity to nondividing human lymphocytes. J Clin Invest 75:377, 1985 4. Gao X, Knudsen TB, Ibrahim MM, Haldar S: Bcl-2 relieves deoxyadenylate stress and suppresses apoptosis in pre-B leukemia cells. Cell Death Diff 2:69, 1995 5. Benveniste P, Cohen A: p53 expression is required for thymocyte apoptosis induced by adenosine deaminase deficiency. Proc Natl Acad Sci USA 92:8373, 1995[Abstract/Free Full Text] 6. Kredich NM, Hershfield MS: S-Adenosylhomocysteine toxicity in normal and adenosine kinase-deficient lymphoblasts of human origin. Proc Natl Acad Sci USA 76:2450, 1979[Abstract/Free Full Text] 7. Hershfield MH, Kredich NM: Resistance of an adenosine kinase-deficient human lymphoblastoid cell line to effects of deoxyadenosine on growth, S-adenosylhomocysteine hydrolase inactivation, and dATP accumulation. Proc Natl Acad Sci USA 77:4292, 1980[Abstract/Free Full Text] 8. Wolos JA, Frondorf KA, Esser RE: Immunosuppression mediated by an inhibitor of S-adenosyl-L-homocysteine hydrolase. J Immunol 151:526, 1993[Abstract] 9. Jenkins T, Rabson AR, Nurse GT, Lane AB: Deficiency of adenosine deaminase not associated with severe combined immunodeficiency. J Pediatr 89:732, 1976[Medline] [Order article via Infotrieve] 10. Daddona PE, Davidson BL, Perignon JL, Kelley WN: Genetic expression in partial adenosine deaminase deficiency: mRNA levels and protein turnover for the enzyme variants in human B-lymphoblast cell lines. J Biol Chem 260:3875, 1985[Abstract/Free Full Text] 11. Hirschhorn R, Ellenbogen A: Genetic heterogeneity in adenosine deaminase (ADA) deficiency: Five different mutations in five new patients with partial ADA deficiency. Am J Hum Genet 38:13, 1986[Medline] [Order article via Infotrieve] 12. Hirschhorn R, Tzall S, Ellenbogen A, Orkin SH: Identification of a point mutation resulting in a heat-labile adenosine deaminase (ADA) in two unrelated children with partial ADA deficiency. J Clin Invest 83:497, 1989 13. Hirschhorn R, Tzall S, Ellenbogen A: Hot spot mutations in adenosine deaminase deficiency. Proc Natl Acad Sci USA 87:6171, 1990[Abstract/Free Full Text] 14. Geffner ME, Stiehm ER, Stephure D, Cowan MJ: Probable autoimmune thyroid disease and combined immunodeficiency disease. Am J Dis Child 140:1194, 1986[Abstract/Free Full Text] 15. Levy Y, Hershfield MS, Fernandez-Mejia C, Polmar SH, Scudiery D, Berger M, Sorensen RU: Adenosine deaminase deficiency with late onset of recurrent infections: Response to treatment with polyethylene glycol-modified adenosine deaminase (PEG-ADA). J Pediatr 113:312, 1988[Medline] [Order article via Infotrieve] 16. Santisteban I, Arredondo-Vega FX, Kelly S, Mary A, Fischer A, Hummell DS, Lawton A, Sorensen RU, Stiehm ER, Uribe L, Weinberg K, Hershfield MS: Novel splicing, missense, and deletion mutations in 7 adenosine deaminase deficient patients with late/delayed onset of combined immunodeficiency disease: Contribution of genotype to phenotype. J Clin Invest 92:2291, 1993 17. Shovlin CL, Hughes JMB, Simmonds HA, Fairbanks L, Deacock S, Lechler R, Roberts I, Webster ADB: Adult presentation of adenosine deaminase deficiency. Lancet 341:1471, 1993[Medline] [Order article via Infotrieve] 18. Hirschhorn R: Adenosine deaminase deficiency: Molecular basis and recent developments. Clin Immunol Immunopathol 76:S219, 1995 (suppl) 19. Coleman MS, Donofrio J, Hutton JJ, Hahn L, Daoud A, Lampkin B, Dyminski J: Identification and quantification of adenine deoxynucleotides in erythrocytes of a patient with adenosine deaminase deficiency and severe combined immunodeficiency. J Biol Chem 253:1619, 1978[Free Full Text] 20. Cohen A, Hirschhorn R, Horowitz SD, Rubinstein A, Polmar SH, Hong R, Martin DW Jr: Deoxyadenosine triphosphate as a potentially toxic metabolite in adenosine deaminase deficiency. Proc Natl Acad Sci USA 75:472, 1978[Abstract/Free Full Text] 21. Hershfield MS, Kredich NM, Ownby DR, Ownby H, Buckley R: In vivo inactivation of erythrocyte S-adenosylhomocysteine hydrolase by 2'-deoxyadenosine in adenosine deaminase-deficient patients. J Clin Invest 63:807, 1979 22. Fauci AS: CD4+ T lymphocytopenia without HIV infection No lights, no camera, just facts. N Engl J Med 328:429, 1993[Free Full Text] 23. Laurence J, Mitra D, Steiner M, Lynch DH, Siegal FP, Staiano-Coico L: Apoptotic depletion of CD4+ T cells in idiopathic CD4+ T lymphocytopenia. J Clin Invest 97:672, 1996[Medline] [Order article via Infotrieve] 24. Wiginton DA, Adrian GS, Hutton JJ: Sequence of human adenosine deaminase cDNA including the coding region and a small intron. Nucleic Acids Res 12:2439, 1984[Abstract/Free Full Text] 25. Wiginton DA, Kaplan DJ, States JC, Akeson AL, Perme CM, Bilyk IJ, Vaughn AJ, Lattier DL, Hutton JJ: Complete sequence and structure of the gene for human adenosine deaminase. Biochemistry 25:8234, 1986[Medline] [Order article via Infotrieve] 26. Arredondo-Vega FX, Santisteban I, Kelly S, Schlossman C, Umetsu D, Hershfield MS: Correct splicing despite a G > A mutation at the invariant first nucleotide of a 5' splice site: A possible basis for disparate clinical phenotypes in siblings with adenosine deaminase (ADA) deficiency. Am J Hum Genet 54:820, 1994[Medline] [Order article via Infotrieve] 27. Santisteban I, Arredondo-Vega FX, Kelly S, Debré M, Fischer A, Pérignon JL, Hilman B, ElDahr J, Dreyfus GH, Gelfand EW, Howell PL, Hershfield MS: Four new adenosine deaminase mutations, altering a zinc-binding histidine, two conserved alanines, and a 5' splice site. Hum Mut 5:243, 1995[Medline] [Order article via Infotrieve] 28. Higuchi R: Recombinant PCR, in Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds): PCR Protocols. San Diego, CA, Academic, 1990, p 177 29. Santisteban I, Arredondo-Vega FX, Kelly S, Loubser M, Meydan N, Roifman C, Howell PL, Bowen T, Weinberg KI, Schroeder ML, Hershfield MS: Three new adenosine deaminase mutations that define a splicing enhancer and cause severe and partial phenotypes: Implications for evolution of a CpG hotspot and expression of a transduced ADA cDNA. Hum Molec Genet 4:2081, 1995[Abstract/Free Full Text] 30. Hirschhorn R, Chakravarti V, Puck J, Douglas SD: Homozygosity for a newly identified missense mutation in a patient with very severe combined immunodeficiency due to adenosine deaminase deficiency (ADA-SCID). Am J Hum Genet 49:878, 1991[Medline] [Order article via Infotrieve] 31. Akeson AL, Wiginton DA, States JC, Perme CM, Dusing MR, Hutton JJ: Mutations in the human adenosine deaminase gene that affect protein structure and RNA splicing. Proc Natl Acad Sci USA 84:5947, 1987[Abstract/Free Full Text] 32. Chang ZY, Nygaard P, Chinault AC, Kellems RE: Deduced amino acid sequence of Escherichia coli adenosine deaminase reveals evolutionarily conserved amino acid residues: Implications for catalytic function. Biochem 30:2273, 1991[Medline] [Order article via Infotrieve] 33. Kawamoto H, Ito K, Kashii S, Monden S, Fujita M, Norioka M, Sasai Y, Okuma M: A point mutation in the 5' splice region of intron 7 causes a deletion of exon 7 in adenosine deaminase mRNA. J Cell Biochem 51:322, 1993[Medline] [Order article via Infotrieve] 34. von Einsidel RW, Fife TD, Aksamit AJ, Cornford ME, Secor DL, Tomiyasu U, Itabashi HH, Vinters HV: Progressive multifocal leukoencephalopathy in AIDS: A clinicopathological study and review of the literature. J Neurol 240:391, 1993[Medline] [Order article via Infotrieve] 35. Wakamiya M, Blackburn MR, Jurecic R, McArthur MJ, Geske RS, Cartwright J Jr, Mitani K, Vaishnav S, Belmont JW, Kellems RE, Finegold MJ, Montgomery CA Jr, Bradley A, Caskey CT: Disruption of the adenosine deaminase gene causes hepatocellular impairment and perinatal lethality in mice. Proc Natl Acad Sci USA 92:3673, 1995[Abstract/Free Full Text] 36. Migchielsen AAJ, Breuer ML, van Roon MA, te Riele H, Zurcher C, Ossendorp F, Toutain S, Hershfield MS, Berns A, Valerio D: Adenosine deaminase-deficient mice die perinatally, exhibiting liver-cell degeneration, small intestinal cell death, and lung atelectasis. Nat Genet 10:279, 1995[Medline] [Order article via Infotrieve] 37. Bollinger ME, Arredondo-Vega FX, Santisteban I, Schwarz K, Hershfield MS, Lederman HM: Hepatic dysfunction as a complication of adenosine deaminase (ADA) deficiency. N Engl J Med 334:1367, 1996[Free Full Text] 38. Shovlin CL, Simmonds HA, Fairbanks L, Deacock S, Hughes JMB, Lechler R, Webster ADB, Sun X-M, Webb JC, Soutar AK: Adult onset immunodeficiency caused by inherited adenosine deaminase deficiency. J Immunol 153:2331, 1994[Abstract] 39. Hirschhorn R, Yang DR, Insel RA, Ballow M: Severe combined immunodeficiency of reduced severity due to homozygosity for an adenosine deaminase missense mutation (ARg253Pro). Cell Immunol 152:383, 1993[Medline] [Order article via Infotrieve] 40. Henderson JF, Smith CM: Mechanisms of deoxycoformycin toxicity in vivo, in Tattersal MHN, Fox RM (eds): Nucleosides in Cancer Treatment. Sydney, Australia, Academic, 1981, p 208 41. Smith CM, Henderson JF: Deoxyadenosine triphosphate accumulation in erythrocytes of deoxycoformycin-treated mice. Biochem Pharmacol 31:1545, 1982[Medline] [Order article via Infotrieve] 42. Wilson DK, Rudolph FB, Quiocho FA: Atomic structure of adenosine deaminase complexed with a transition-state analog: Understanding catalysis and immunodeficiency mutations. Science 252:1278, 1991[Abstract/Free Full Text] 43. Arredondo-Vega FX, Kurtzberg J, Chaffee S, Santisteban I, Reisner E, Povey MS, Hershfield MS: Paradoxical expression of adenosine deaminase in T cells cultured from a patient with adenosine deaminase deficiency and combined immunodeficiency. J Clin Invest 86:444, 1990 44. Hirschhorn R, Yang DR, Israni A, Huie ML, Ownby DR: Somatic mosaicism for a newly identified splice-site mutation in a patient with adenosine deaminase-deficient immunodeficiency and spontaneous clinical recovery. Am J Hum Genet 55:59, 1994[Medline] [Order article via Infotrieve] 45. Hirschhorn R, Yang DR, Puck JM, Huie ML, Jiang C-K, Kurlandsky LE: Spontaneous reversion to normal of an inherited mutation in a patient with adenosine deaminase deficiency. Nat Genet 13:290, 1996[Medline] [Order article via Infotrieve] 46. Hirschhorn R, Roegner V, Jenkins T, Seaman C, Piomelli S, Borkowsky W: Erythrocyte adenosine deaminase deficiency without immunodeficiency. Evidence for an unstable mutant enzyme. J Clin Invest 64:1130, 1979 47. Daddona PE, Mitchell BS, Meuwissen HJ, Davidson BL, Wilson JM, Koller CA: Adenosine deaminase deficiency with normal immune function. J Clin Invest 72:483, 1983 48. Berget SM: Exon recognition in vertebrate splicing. J Biol Chem 270:2411, 1995[Free Full Text] 49. Aoufouchi S, Yelamos J, Milstein C: Nonsense mutations inhibit RNA splicing in a cell-free system: Recognition of mutant codon is independent of protein synthesis. Cell 85:415, 1996[Medline] [Order article via Infotrieve] 50. Hershfield MS, Buckley RH, Greenberg ML, Melton AL, Schiff R, Hatem C, Kurtzberg J, Markert ML, Kobayashi RH, Kobayashi AL, Abuchowski A: Treatment of adenosine deaminase deficiency with polyethylene glycol-modified adenosine deaminase. N Engl J Med 316:589, 1987[Abstract] 51. Hershfield MS: PEG-ADA: An alternative to haploidentical bone marrow transplantation and an adjunct to gene therapy for adenosine deaminase deficiency. Hum Mut 5:107, 1995[Medline] [Order article via Infotrieve] 52. Hershfield MS: PEG-ADA replacement therapy for adenosine deaminase deficiency: An update after 8.5 years. Clin Immunol Immunopathol 76:S228, 1995 (suppl) © 1997 by The American Society of Hematology. CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this? This article has been cited by other articles: A. Masuda, X.-M. Shen, M. Ito, T. Matsuura, A. G. Engel, and K. Ohno hnRNP H enhances skipping of a nonfunctional exon P3A in CHRNA1 and a mutation disrupting its binding causes congenital myasthenic syndrome Hum. Mol. Genet., December 15, 2008; 17(24): 4022 - 4035. [Abstract] [Full Text] [PDF] B. Cassani, M. Mirolo, F. Cattaneo, U. Benninghoff, M. Hershfield, F. Carlucci, A. Tabucchi, C. Bordignon, M. G. Roncarolo, and A. Aiuti Altered intracellular and extracellular signaling leads to impaired T-cell functions in ADA-SCID patients Blood, April 15, 2008; 111(8): 4209 - 4219. [Abstract] [Full Text] [PDF] C. R. Weiler and J. L. Bankers-Fulbright Common Variable Immunodeficiency: Test Indications and Interpretations Mayo Clin. Proc., September 1, 2005; 80(9): 1187 - 1200. [Abstract] [PDF] M. S. Lim and K. S.J. Elenitoba-Johnson The Molecular Pathology of Primary Immunodeficiencies J. Mol. Diagn., May 1, 2004; 6(2): 59 - 83. [Full Text] [PDF] F. Carlucci, A. Tabucchi, A. Aiuti, F. Rosi, F. Floccari, R. Pagani, and E. Marinello Capillary Electrophoresis in Diagnosis and Monitoring of Adenosine Deaminase Deficiency Clin. Chem., November 1, 2003; 49(11): 1830 - 1838. [Abstract] [Full Text] [PDF] F. X. Arredondo-Vega, I. Santisteban, E. Richard, P. Bali, M. Koleilat, M. Loubser, A. Al-Ghonaium, M. Al-Helali, and M. S. Hershfield Adenosine deaminase deficiency with mosaicism for a "second-site suppressor" of a splicing mutation: decline in revertant T lymphocytes during enzyme replacement therapy Blood, February 1, 2002; 99(3): 1005 - 1013. [Abstract] [Full Text] [PDF] A. M. Fonseca, G. Porto, K. Uchida, and F. A. Arosa Red blood cells inhibit activation-induced cell death and oxidative stress in human peripheral blood T lymphocytes Blood, May 15, 2001; 97(10): 3152 - 3160. [Abstract] [Full Text] [PDF] T. Ariga, N. Oda, I. Sanstisteban, F. X. Arredondo-Vega, M. Shioda, H. Ueno, K. Terada, K. Kobayashi, M. S. Hershfield, and Y. Sakiyama Molecular Basis for Paradoxical Carriers of Adenosine Deaminase (ADA) Deficiency That Show Extremely Low Levels of ADA Activity in Peripheral Blood Cells Without Immunodeficiency J. Immunol., February 1, 2001; 166(3): 1698 - 1702. [Abstract] [Full Text] [PDF] H B Gaspar, K C Gilmour, and A M Jones Current topic: Severe combined immunodeficiency{---}molecular pathogenesis and diagnosis Arch. Dis. Child., February 1, 2001; 84(2): 169 - 173. [Full Text] R. J. Rubocki, J. R. Parsa, M. S. Hershfield, W. G. Sanger, S. J. Pirruccello, I. Santisteban, B. G. Gordon, S. E. Strandjord, P. I. Warkentin, and P. F. Coccia Full hematopoietic engraftment after allogeneic bone marrow transplantation without cytoreduction in a child with severe combined immunodeficiency Blood, February 1, 2001; 97(3): 809 - 811. [Abstract] [Full Text] [PDF] E. Richard, F. X. Arredondo-Vega, I. Santisteban, S. J. Kelly, D. D. Patel, and M. S. Hershfield The Binding Site of Human Adenosine Deaminase for Cd26/Dipeptidyl Peptidase IV: The Arg142gln Mutation Impairs Binding to Cd26 but Does Not Cause Immune Deficiency J. Exp. Med., November 6, 2000; 192(9): 1223 - 1236. [Abstract] [Full Text] [PDF] A. Fleischman, M. S. Hershfield, S. Toutain, H. M. Lederman, K. E. Sullivan, M. B. Fasano, J. Greene, and J. A. Winkelstein Clin. Vaccine Immunol., May 1, 1998; 5(3): 399 - 400. [Abstract] S. H. Sicherer and J. A. Winkelstein Primary Immunodeficiency Diseases in Adults JAMA, January 7, 1998; 279(1): 58 - 61. [Full Text] [PDF] This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Ozsahin, H. Articles by Hershfield, M. S. Search for Related Content PubMed PubMed Citation Articles by Ozsahin, H. Articles by Hershfield, M. S. Related Collections Immunobiology Social Bookmarking                   What's this?

	Copyright © 1997 by American Society of Hematology         Online ISSN: 1528-0020