|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 89 No. 9 (May 1), 1997:
pp. 3148-3154
CIS, a Cytokine Inducible SH2 Protein, Is a Target of the JAK-STAT5 Pathway and Modulates STAT5 Activation
By
Akira Matsumoto,
Masaaki Masuhara,
Kaoru Mitsui,
Masahiro Yokouchi,
Motoaki Ohtsubo,
Hiroyuki Misawa,
Atsushi Miyajima, and
Akihiko Yoshimura
From the Institute of Life Science, Kurume University, Kurume; and the Institute of Molecular and Cellular Biosciences, The University of Tokyo, Tokyo, Japan.
 |
ABSTRACT |
We searched for immediate early cytokine responsive genes and isolated a novel gene, CIS (Cytokine Inducible SH2 containing protein) that is induced in hematopoietic cells by a subset of cytokines including interleukin-2 (IL-2), IL-3, and erythropoietin (EPO). The mutant IL-2 receptor that fails to activate STAT5 could not induce CIS, suggesting that STAT5 is involved in the cytokine-inducible expression of CIS. We cloned the 5'-flanking region of the CIS gene and found that about 200 bases upstream of the transcription-initiation site contain four potential STAT5 binding sites (MGF boxes). Luciferase reporter assays showed that these MGF boxes were essential for EPO-dependent promoter activity. Expression of STAT5 and the EPO receptor in HEK293 cells conferred EPO-dependent activation of the CIS promoter. These data indicate that CIS is a target of the JAK-STAT5 pathway of cytokine receptors. CIS contains an SH2 domain and binds to tyrosine-phosphorylated EPO and IL-3 receptors. In HEK293 cells expressing STAT5 and the EPO receptor, EPO-dependent tyrosine phosphorylation of STAT5, as well as EPO-dependent CIS-promoter activation, was suppressed when CIS was coexpressed. Moreover, the induction of oncostatin M, another STAT5 target, as well as the tyrosine-phosphorylation of STAT5, were partially suppressed by CIS expression in Ba/F3 cells. Thus, CIS is a feedback modulator of STAT5; its expression is induced by STAT5 and it negatively modulates STAT5 activation.
| |
INTRODUCTION |
GROWTH, DIFFERENTIATION, and functions of immune and hematopoietic cells are controlled by multiple cytokines, including interleukins (ILs) and colony-stimulating factors (CSFs).1 These cytokines exert their biological functions through specific receptors expressed on their target cells. A novel subfamily of protein tyrosine kinases, known as Janus kinases (JAKs), plays an important role in cytokine signaling. This pathway, originally found in interferon (IFN) signaling, is now known to be shared by various cytokines.2,3 This signaling system is unique for its direct link of the receptor-ligand interaction on the cell surface to gene expression in the nucleus. JAKs associate with cytokine receptors and are stimulated when cytokines bind to their cognate receptors. The activated JAKs, in turn, convert latent cytoplasmic transcription factors, known as STATs (signal transducer and activator of transcription), into active forms by tyrosine phosphorylation. The tyrosine phosphorylated STATs form homo or heterodimers and translocate into the nucleus where they bind to their specific target sequences, most of which are related to gamma interferon (IFN- ) activated sites (GAS), a key regulatory element in the promoter of IFN--inducible genes.4
The STAT family presently includes six members, each of which functions in a specific cytokine system.4 STAT5, which was originally identified as mammary gland factor (MGF ) regulated by prolactin,5 is activated by multiple cytokines such as IL-2, IL-3, IL-5, granulocyte macrophage colony-stimulating factor (GM-CSF ), erythropoietin (EPO) and thrombopoietin (TPO).6-11 Although IL-2 and the other cytokines activate different JAKs, they all activate STAT5. The consensus STAT5 recognition sequence TTCNNNGAA (MGF box) overlaps STAT1 and STAT3 binding motifs. However, in contrast to STAT1 and STAT3, the target genes of STAT5 in tissues other than mammary gland remain largely unknown.
We searched for immediate early genes induced by multiple cytokines, using IL-3 and EPO-dependent hematopoietic cells and identified a novel immediate early gene, CIS.12 It encodes an SH2 domain, which stably associates with tyrosine-phosphorylated IL-3 and EPO receptors. Because CIS is induced by IL-2, IL-3, GM-CSF, and EPO, but not by IL-6, granulocyte colony-stimulating factor (G-CSF ) and stem cell factor (SCF ), it seems to be a target of STAT5. We analyzed the promoter region of the murine CIS gene and found that MGF boxes are essential for induction by EPO. Moreover, CIS expression inhibited the EPO-dependent activation of STAT5, indicating that CIS is a kind of feedback modulator of STAT5.
| |
MATERIALS AND METHODS |
Cells.
Murine IL-3-dependent lymphoid Ba/F3 cells and their transformants were maintained in RPMI medium supplemented with 10% fetal calf serum (FCS) and 10% conditioned medium from the WEHI-3B cell line as a source of IL-3.13 Ba/F3 transformants expressing Dexamethasone (Dex)-inducible CIS, as well as the EPO receptor (BF-CIS-ER),12 the IL-2 receptor  chain (F-7), and the C-terminal truncated IL-2 receptor chain (H-4) were described previously.9 L cell transformants stably expressing the EPO receptor (L-ER) were obtained by transfection with pEF-EPOR14 and selection with G418. L, L-ER, and HEK293 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% FCS.
Cloning of the 5'-flanking region of the CIS gene.
The 5'-flanking region of the CIS gene was cloned by means of cassette-ligation mediated polymerase chain reaction (PCR)15 using a Takara in vitro PCR cloning kit (Takara, Japan). Briefly, mouse genomic DNA was digested with EcoRI, then ligated with an EcoRI cassette oligonucleotide. PCR was performed using a sense cassette primer and the antisense CIS cDNA primer, AAGGAGAAAGGAGCCAATGGGTCCAGGGGT according to the manufacturer's instructions. The PCR product was cloned into the pCRII vector (Invitrogen, San Diego, CA). The full-length cloned promoter region, BglII/Xho I fragment and mutated fragments were subcloned into the upstream region of the luciferase gene in pGV (Nippon Gene, Tokyo, Japan). In vitro mutagenesis of the MGF boxes proceeded as described.16 The following primers were designed to replace consecutively two MGF boxes (TTCNNNGAA) with GAATTC (EcoRI site): A (TCCAGATCTCACAGCAC), B (TTAGAATTCCGGGCGGGAGCTCCTAGA), C (ATCGAATTCATCTGTCAAAGGTGTTT), D (ATAGAATTCCCGCGGGCTTTGCGGCG), E (TTAGAATTCGGGCTGGGACGCAGCGG), F (AAGCTTGAGAAAGGAGCCAATGGG). The PCR fragment produced by A and B primers (AB) and that by C and F primers (CF ) were joined using EcoRI sites, then ligated into the pGV basic vector (construct B). Similarly, fragments produced by AD and EF primers were ligated into pGV (construct C). Construct D lacking all MGF boxes were produced by replacing the Sac I-HindIII fragment of construct B with that of construct C. Reporter gene containing wild-type promoter region is designated construct A.
Luciferase assay.
Plasmids (10 µg/transfection) of various CIS promoter-luciferase constructs in pGV were introduced into L-ER cells using a calcium-phosphate method as described.17 After 24 hours, the cells were factor depleted for 5 hours, then stimulated with 5 ng/mL IL-3, 10 U/mL EPO, or 10 ng/mL IL-2 for 2 hours. Cell extracts were prepared and luciferase activity was measured as described.5,6 HEK293 cells were also transfected with pGV-promoter-reporter gene constructs in combination with the expression vector (10 µg/transfection) carrying the EPO receptor (pXM-EPOR), STAT5 (pXM-MGF ), and CIS (pME-CIS). These plasmids have been described previously.6,7,12,16
Northern hybridization.
The BF-CIS-ER cells were factor-depleted for 6 hours in RPMI medium containing 1% bovine serum albumin (BSA) in the presence of absence of 500 nmol/L Dex, then stimulated with 10 ng/mL IL-3 or 10 U/mL EPO. For Northern blotting, total RNA (5 µg) was separated on 1.0% agarose gels containing 2.4% formaldehyde, then transferred to positively charged nylon membranes. After fixation under calibrated ultraviolet (UV) irradiation, the membranes were hybridized with DIG-labeled riboprobes prepared using a DIG-RNA labeling kit (Boehringer, Tokyo, Japan). The blot was visualized using alkaline-phosphatase labeled anti-digoxigenin (DIG) antibody and a chemiluminescent substrate according to the manufacturer's instructions.
Detection of tyrosine-phosphorylation of STAT5.
BF-CIS-ER or transfected HEK293 cells (5 × 107/sample) were incubated in the medium containing 0.5% FCS and 0.2 mmol/L sodium vanadate for 15 minutes at 37°C, then stimulated with 10 ng/mL IL-3 or 10 U/mL EPO at 25°C for 10 minutes. Cells were then solubilized with 1 mL of 1.0% Triton X-100 in phosphate-buffered saline (PBS) containing 50 mmol/L NaF, 10 mmol/L sodium pyrophosphate, 1 mmol/L sodium vanadate, and 1% aprotinin. After centrifugation, cleared lysates were incubated with 4 µL of anti-STAT55 for 1 hour at 4°C. The immune complexes adsorbed with protein A-Sepharose were resolved on 8.5% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), immunoblotted with monoclonal antiphosphotyrosine antibody (4G10) or anti-STAT5, and detected as described.14
| |
RESULTS |
Mutant IL-2 receptor chain that fails to activate STAT5 cannot induce CIS.
To determine the STAT5 requirement for CIS-induction, we used a mutant IL-2 receptor chain, which does not activate STAT5, but supports cell proliferation. Fujii et al9 showed that the H mutant of the IL-2 receptor chain lacking the 147 carboxyl-terminal amino acid activates JAK1 and JAK3 and supports cell growth, but fails to activate STAT5. As shown in Fig 1, both IL-2 and IL-3 induced CIS in Ba/F3 cells expressing the wild-type IL-2 receptor chain (F-7). However, in H-4 cells expressing the H mutant receptor, IL-2 failed to induce CIS. Because IL-2 still induced c-myc, the H-mutant receptor was actually activated by IL-2. Failure of CIS-induction by IL-2 was not due to the alteration of the CIS gene itself, as IL-3 still induced CIS in H-4 cells. These data suggest that STAT5 plays an important role in CIS-induction.
View larger version (45K):
[in this window]
[in a new window]
| Fig 1.
CIS-induction by IL-2 in F-7 and H-4 cells. Ba/F3 cells expressing the wild-type IL-2 receptor chain (F-7) or cells expressing the H-mutant (H-4) were factor-depleted for 4 hours, and stimulated with either IL-2 or IL-3 for the indicated periods (h). Total RNA (5 µg/lane) was separated from the cells and blotted with CIS, c-myc, and  -enolase probes.
|
|
Isolation of the 5'-flanking region of the CIS gene and its promoter activity.
To explore the involvement of STAT5 on CIS-induction, we cloned the 5'-flanking region of the CIS gene. Approximately 0.8 kb of the 5'-flanking region of the CIS gene obtained by cassette-ligation mediated PCR is shown in Fig 2. The 5'-end of mRNA was determined by means of rapid amplification of the cDNA ends (RACE)-PCR as described previously.12 The major transcriptional-initiation site (the bold arrow in Fig 2) determined by this procedure was located 45 bases upstream from the translation start codon (the broken arrow), and a minor transcriptional start site was found 130 bases upstream (not shown). Although there was no apparent TATA box, there was a GC-rich region near the transcription-initiation site. Four MGF boxes (TTCNNNGAA) were located close to the transcription-initiation site. One of these sequences was identical to that of -casein (TTCTTGGAA). Two consecutive MGF boxes (boxes 1, 2 and boxes 3, 4) were separated by an insertion of approximately 80 bp. To examine the role of these elements in the activation by cytokines, this promoter region was linked to the luciferase reporter gene and transfected into Ba/F3 cells. As shown in Fig 3, stimulation with IL-3 increased the luciferase activity in Ba/F3 cells transformed with the reporter gene fourfold to fivefold. This indicates that a 5'-flanking region of approximately 0.8 kb is sufficient to confer IL-3-dependent promoter activity.
View larger version (74K):
[in this window]
[in a new window]
| Fig 2.
The nucleotide sequence of the 5'-flanking region of murine CIS gene. The 5'-untranslated flanking sequence obtained by PCR is numbered as minus from the major transcription-initiation site. The bold arrow indicates a major transcription-initiation site and the broken arrow indicates the first ATG codon. Four MGF boxes are underlined.
|
|
View larger version (14K):
[in this window]
[in a new window]
| Fig 3.
IL-3-induced activation of the reporter gene in Ba/F3 cells. Cells were transfected with 50 µg of the reporter gene carrying 0.8-kb promoter region linked to luciferase gene and 5 µg of pSV2neo by electroporation. After culture in the presence of 1 mg/mL G418 for 2 weeks, a pool of G418-resistant cells was starved for 16 hours in the absence of growth factor and then stimulated with ( ) or without ( ) 10 ng/mL IL-3 for the indicated periods. Cell extracts were prepared and luciferase activity was measured.
|
|
For a convenient reporter gene assay, we used L cell fibroblast cell line stably expressing the EPO receptor (L-ER). In this transformant, EPO induced tyrosine phosphorylation of JAK2, as well as the EPO receptor, and EPO also induced expression of endogenous CIS and c-myc (data not shown). Approximately 540 bases of the upstream region of the CIS gene (A construct; wild-type) was sufficient to confer EPO-inducible promoter activity (Fig 4). Promoter activity was not EPO-dependently increased in parental L cells lacking the EPO receptor. To determine the effect of MGF boxes on promoter activity, each or both of the consecutive MGF boxes were deleted (B, C, and D constructs). Deletion of one of the two consecutive MGF boxes decreased promoter activity, but still retained EPO inducibility (constructs B and C). However, disruption of all four MGF boxes severely abolished basal promoter activity and EPO dependence (construct D). These data indicate that MGF boxes were essential for EPO-dependent promoter activity, and the presence of all four MGF boxes was required for full promoter activity.
View larger version (23K):
[in this window]
[in a new window]
| Fig 4.
EPO stimulation of the CIS promoter-luciferase reporter gene in L-ER cells. Schematic representations of each reporter construct are shown in the lower portion (A-D). Boxes indicate MGF boxes, and their disruptions are shown in B, C, and D. The plasmids (10 µg) were introduced into wild-type L cells (open bars) or transformants expressing the EPO receptor (closed bars) using a calcium phosphate method for 12 hours. After transfection, cells were incubated in the presence or absence of EPO for 24 hours and luciferase activity was measured. Luciferase activity (arbitrary units) from triplicate experiments is shown.
|
|
To determine whether or not the CIS promoter can really be activated by STAT5, the wild-type reporter construct A (MGF+) and the mutant reporter construct D, which lacks all four MGF boxes (MGF-) were transfected in HEK293 cells in combination with the EPO receptor and STAT5 (Fig 5). HEK293 cells have been used for high efficiency of transient transfection, and we found that they do not overexpress the EPO receptor and STAT5 compared with the COS cells that we used previously (data not shown). As shown in Fig 5, the A promoter construct was activated in an EPO-dependent manner when both the EPO receptor and STAT5 were coexpressed. Disruption of the MGF boxes abolished the EPO-dependent activation of CIS promoter (D, MGF-). These data strongly support the notion that CIS is a direct target of STAT5.
View larger version (31K):
[in this window]
[in a new window]
| Fig 5.
Reconstitution of CIS promoter activation by STAT5 and the EPO receptor in HEK293 cells. HEK293 cells were transfected with CIS promoter-luciferase reporter constructs in combination with the EPO receptor and/or STAT5 cDNAs in pXM expression vector. MGF+ means A construct carrying wild-type promoter and MGF- means D construct containing mutant promoter lacking all four MGF boxes, as shown in Fig 4. In minus (-), same amount of pXM plasmid without insert cDNA was added. Twenty-four hours after transfection, cells were stimulated with or without EPO (10 U/mL) and cell extracts were analyzed for luciferase activity.
|
|
Forced expression of CIS suppressed STAT5 activation.
We reported that CIS binds to the tyrosine phosphorylated EPO and IL-3 receptors and partially suppresses cell proliferation.12 Because CIS seems to modulate signal transduction from the receptor, we examined the effect of CIS expression on STAT5 activation. The EPO receptor, STAT5, CIS, and reporter A constructs were transiently expressed in HEK293 cells. As shown in Fig 6, upper graph, the EPO-induced luciferase activity decreased to about one third when CIS was coexpressed with STAT5. To examine STAT5 activation, STAT5 protein was precipitated with anti-STAT5 antibody and immunoblotted with antiphosphotyrosine antibody (Fig 6, lower panel). Tyrosine phosphorylation of STAT5 was decreased when CIS was coexpressed. These data suggest that CIS inhibits STAT5 trans-activation activity by suppressing its tyrosine-phosphorylation.
View larger version (31K):
[in this window]
[in a new window]
| Fig 6.
CIS inhibits STAT5 activity in a reconstituted system in HEK293 cells. Upper graph, plasmids for the EPO receptor, STAT5, and luciferase-reporter gene (construct A) were introduced into HEK293 cells as described in the legend to Fig 5, in the presence of an expression vector carrying the CIS gene (pME-CIS)(+) or unrelated protein (pME-CCF18)(-). After a 24-hour incubation in the presence or absence of EPO (10 U/mL), luciferase activity in each transfection was measured. Lower gels, after transfection, cells were cultured for 24 hours in DMEM containing 10% FCS without EPO, then starved for 12 hours in the medium containing 0.5% FCS. Cells were stimulated with EPO (10 U/mL) for 10 minutes. Cell extracts were immunoprecipitated with anti-STAT5 antibody, then resolved by SDS-PAGE and probed with antiphosphotyrosine (anti-PY) or anti-STAT5 antibodies.
|
|
To determine the effect of CIS on cytokine-induced STAT5 activation in hematopoietic cells, we used BF-CIS-ER cells, which were transformed with Dex-inducible CIS and the EPO-receptor genes.12 As shown in Fig 7A, in the absence of Dex, the CIS protein level decreased rapidly after cytokines were removed. However, Dex maintained the CIS level even in the absence of growth factor up to 6 hours. We compared EPO or IL-3-induced oncostatin M (OSM) expression under these conditions. OSM is another target of the JAK-STAT5 pathway.16 As shown in Fig 7B, Dex suppressed EPO and IL-3-dependent OSM induction, but not c-myc. This suggests that CIS expression inhibits STAT5 activation. Next, we examined STAT5 tyrosine phosphorylation (Fig 7C). Although under our conditions, STAT5 was phosphorylated more efficiently by IL-3 than by EPO, Dex suppressed EPO and IL-3-dependent STAT5 phosphorylation. Tyrosine-phosphorylation of JAK2 was not affected by CIS expression (data not shown). These data indicate that forced CIS expression suppressed the cytokine-induced activation of STAT5.
View larger version (39K):
[in this window]
[in a new window]
| Fig 7.
Induction of CIS inhibits STAT5 activity in Ba/F3 cells. (A) After BF-CIS-ER cells were cultured in the absence of growth factor for 0, 2, 4, and 6 hours in the presence or absence of 500 nmol/L Dex, cell extracts were prepared and CIS content was measured by immunoblotting. (B) After 6 hours starvation in the presence or absence of Dex, cells were stimulated with the indicated concentrations of EPO or IL-3 for 20 minutes. Expression of OSM, c-myc, and cdk4 was measured by Northern blotting. (C) After starvation for 6 hours, cells were stimulated with 10 U/mL EPO or 10 ng/mL IL-3, and STAT5 was immunoprecipitated, resolved by SDS-PAGE, and tyrosine-phosphorylation was detected by immunoblotting with anti-PY. The STAT5 content was checked by reprobing the membrane with anti-STAT5.
|
|
| |
DISCUSSION |
We have searched for immediate early genes induced by multiple cytokines and identified the novel immediate early gene, CIS, which encodes an SH2 domain.12 We also isolated another immediate early gene, OSM, which is induced by a similar subset of cytokines. We characterized the promoter of the OSM gene and confirmed that OSM is a direct target of STAT5 in hematopoietic cells.16 Here we isolated and characterized the promoter region of the CIS gene. Several lines of evidence indicate that CIS is another target of STAT5. The promoter region of the CIS gene contained MGF boxes that are recognized by STAT5. The EPO-dependent promoter activity was abolished when MGF boxes in the promoter were deleted. Moreover, mutant IL-2 receptor chain, which cannot activate STAT5, did not induce CIS. Recently, Mui et al18 reported that a dominant negative STAT5 (dnSTAT5), which lacks C-terminal trans-activation domain, suppresses CIS, as well as OSM, gene induction. These data indicate that CIS is a direct target of STAT5.
Mui et al18 also found that induction of pim-1 and Id-1 by IL-3 was suppressed by dnSTAT5 expression. However, in contrast to CIS and OSM gene promoters, there was no MGF boxes in the 5'-flanking region close to the transcription-initiation site in the murine pim-1 gene.19 Id-related protein has also been isolated as a growth factor-inducible gene.20 However, an MGF box was not present within the reported promoter region. Because GAS or MGF boxes are usually present within 200 to 300 bp upstream of initiation sites of the responsive genes, pim-1 and Id-1 may not be direct targets of STAT5. These genes may be regulated indirectly by STAT5. Analysis of promoters of pim-1 and Id-1 gene may provide a clue for STAT5-dependent, but indirect transactivation.
Although GAS or MGF boxes are present in cytokine-responsive genes, the extent to which they are used depends on many other considerations. For example, CIS was not induced by cytokines like IL-6 and G-CSF that activate STAT3,12 although MGF boxes in the CIS promoter were also recognized by STAT3. The potential for serine/threonine phosphorylation and interaction with other transcription factors will modify the potential ability of a STAT complex.21-23 The mechanism of this selection in hematopoietic cells is under investigation.
Although CIS is a target of STAT5, its physiological function remains unclear. We showed that CIS binds to tyrosine phosphorylated EPO and IL-3 receptors. Because forced expression of CIS partially inhibits cell proliferation, CIS modifies the function of cytokine receptors. CIS contains an SH2 domain, but no other motifs or enzymatic activities are found. Thus, CIS may mask phosphotyrosine residues of activated receptors and thereby downmodulate the signaling involved in SH2 domains. In support of this notion, CIS overexpression reduced the level of tyrosine phosphorylation of STAT5 (see Figs 6 and 7). Our preliminary data indicate that CIS binds to phosphorylated Y401 of the EPO receptor. Y401 is also one of the two major tyrosine residues that are essential for STAT5 activation.24-27 Thus, CIS binding to the receptor may reduce interaction between STAT5 and the receptor, resulting in the suppression of STAT5 activation. We found that the effect of CIS expression on STAT5 activation was partial. This may be because CIS cannot inhibit activation through other tyrosine residues like Y343, which are also involved in the activation of STAT5. Thus, CIS may be a modulator of STAT5, but not a complete inhibitor. One can argue that CIS directly binds to STAT5 and inhibits its DNA binding. However, such possibility is small, as tyrosine-phosphorylated IL-3 or EPO receptor, but not STAT5 were coimmunoprecipitated with CIS in Ba/F3 and FDC-P1 cells.12
Probably, CIS can compete with other SH2 proteins interacting with the cytoplasmic domain of the EPO receptor such as Syp, a tyrosine-phosphatase, which binds to phosphorylated Y401 and positively regulates Ras pathway and EPO-dependent proliferation.28 In support of this idea, the overexpression of CIS reduced the activation of MAK kinase (ERK2) in Dex-treated BF-CIS cells to about 50% of untreated cells (A. Yoshimura, unpublished data, August 1996). Although the role of STAT5 on proliferation is still controversial, the negative effect of CIS on proliferation may be explained by the competitive inhibition of SH2-containing signal transducers, including STAT5. Further study is under way to define the influence of CIS on the activation of other SH2 proteins.
| |
FOOTNOTES |
Submitted October 2, 1996;
accepted December 5, 1996.
Supported in part by grants from the Ministry of Science, Education, and Culture of Japan, Kato Memorial Foundation (Tokyo, Japan), Japanese Foundation for Multidisciplinary Treatment of Cancer (Tokyo, Japan), Haraguchi Memorial Foundation (Tokyo, Japan), Uehara Memorial Foundation (Tokyo, Japan), Naito Memorial Foundation (Tokyo, Japan), and Kowa Life Science Foundation (Nagoya, Japan).
The nucleotide sequence reported in this paper will appear in the DDBJ, EMBL, and GenBank nucleotide sequence databases with the accession number D89613.
Address reprint requests to Akihiko Yoshimura, PhD, Institute of Life Science, Kurume University, Aikawamachi 2432-3 Kurume 839, Japan.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hearly marked
``advertisment'' in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
| |
ACKNOWLEDGMENT |
We thank H. Ohgusu for excellent technical assistance, Drs T. Taniguchi and H. Fujii for F-7 and H-4 cells, Dr H. Wakao for anti-STAT5 antibody and technical support.
| |
REFERENCES |
1.
Arai K,
Lee F,
Miyajima A,
Miyatake S,
Arai N,
Yokota T:
Cytokines: Coordinators of immune and inflammatory responses.
Annu Rev Biochem
59:783,
1990[Medline]
[Order article via Infotrieve]
2.
Darnell JE Jr,
Kerr IM,
Stark GR:
Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins.
Science
264:1415,
1994[Abstract/Free Full Text]
3.
Ihle JN:
Cytokine receptor signaling.
Nature
377:591,
1995[Medline]
[Order article via Infotrieve]
4.
Ihle JN:
STATs: Signal transducers and activators of transcription.
Cell
84:331,
1996[Medline]
[Order article via Infotrieve]
5.
Wakao H,
Gouilleux F,
Groner B:
Mammary gland factor (MGF ) is a novel member of the cytokine regulated transcription factor and confers the prolactin response.
EMBO J
13:2182,
1994[Medline]
[Order article via Infotrieve]
6.
Wakao H,
Harada N,
Kitamura T,
Mui AL-F,
Miyajima A:
Interleukin 2 (IL2) and erythropoietin (EPO) activate STAT5/MGF via distinct pathways.
EMBO J
14:2527,
1995[Medline]
[Order article via Infotrieve]
7.
Mui AL-F,
Wakao H,
O'Farrell A,
Harada N,
Miyajima A:
Interleukin-3, granulocyte-macrophage colony stimulating factor and interleukin-5 transduce signals through two STAT5 homologues.
EMBO J
14:1166,
1995[Medline]
[Order article via Infotrieve]
8.
Azam M,
Erdjument-Bromage H,
Kreider BL,
Xia M,
Quelle F,
Basu R,
Saris C,
Tempst P,
Ihle JN,
Schindler C:
Interleukin-3 signals through multiple isoforms of Stat5.
EMBO J
14:1402,
1995[Medline]
[Order article via Infotrieve]
9.
Fujii H,
Nakagawa Y,
Schindler U,
Kawahara A,
Mori H,
Gouilleux F,
Groner B,
Ihle JN,
Minami Y,
Miyazaki T,
Taniguchi T:
Activation of Stat5 by interleukin 2 requires carboxyl-terminal region of the interleukin 2 receptor beta chain but is not essential for the proliferative signal transduction.
Proc Natl Acad Sci USA
92:5482,
1995[Abstract/Free Full Text]
10.
Pallard C,
Gouilleux F,
Benit L,
Cocault L,
Souyri M,
Levy D,
Groner B,
Gisselbrecht S,
Dusanter-Fourt I:
Thrombopoietin activates a STAT5-like factor in hematopoietic cells.
EMBO J
14:2847,
1995[Medline]
[Order article via Infotrieve]
11.
Miyakawa Y,
Oda A,
Druker BJ,
Miyazaki H,
Handa M,
Ohashi H,
Ikeda Y:
Thrombopoietin induces tyrosine phosphorylation of Stat3 and Stat5 in human blood platelets.
Blood
87:439,
1996[Abstract/Free Full Text]
12.
Yoshimura A,
Ohkubo T,
Kiguchi T,
Jenkins NA,
Gilbert DJ,
Copeland NG,
Hara T,
Miyajima A:
A novel cytokine-inducible gene CIS encodes an SH2-containing protein that binds to tyrosine-phosphorylated interleukin 3 and erythropoietin receptors.
EMBO J
14:2816,
1995[Medline]
[Order article via Infotrieve]
13.
Yoshimura A,
D'Andrea AD,
Lodish HF:
Friend spleen focus-forming virus glycoprotein gp55 interacts with the erythropoietin receptor in the endoplasmic reticulum and affects receptor metabolism.
Proc Natl Acad Sci USA
87:4239,
1990
14.
Ohashi H,
Maruyama K,
Liu Y-C,
Yoshimura A:
Ligand-induced activation of chimeric receptors between the erythropoietin receptor and receptor tyrosine kinases.
Proc Natl Acad Sci USA
91:158,
1994[Abstract/Free Full Text]
15.
Isegawa Y,
Sheng J,
Sokawa Y,
Yamanishi K,
Nakagomi O,
Shigeharu U:
Selective amplification of cDNA sequence from total RNA by cassette-ligation mediated polymerase chain reaction (PCR): Amplification to sequencing 6.5 kb genome segment of hantavirus strain B-1.
Mol Cell Probes
6:476,
1992
16.
Yoshimura A,
Ichihara M,
Kinjyo I,
Moriyama M,
Copeland NG,
Gilbert DJ,
Jenkins NA,
Hara T,
Miyajima A:
Mouse oncostatin M: An immediate early gene induced by multiple cytokines through the JAK-STAT5 pathway.
EMBO J
15:1055,
1996[Medline]
[Order article via Infotrieve]
17.
Chen C,
Okayama H:
High efficiency transformation of mammalian cells by plasmid DNA.
Mol Cell Biol
7:2745,
1987[Abstract/Free Full Text]
18.
Mui AL-F,
Wakao H,
Kinoshita T,
Kitamura T,
Miyajima A:
Suppression of interleukin-3-induced gene expression by a C-terminal truncated Stat5: Role of Stat5 in proliferation.
EMBO J
15:2425,
1996[Medline]
[Order article via Infotrieve]
19.
Yip-Schneider MT,
Horie M,
Broxmeyer HE:
Transcriptional induction of pim-1 protein kinase gene expression by interferon gamma and posttranscriptional effects on costimulation with steel factor.
Blood
85:3494,
1995[Abstract/Free Full Text]
20.
Christy BA,
Sanders LK,
Lau LF,
Copeland NG,
Jenkins NA,
Nathans D:
An ID-related helix-loop-helix protein encoded by a growth factor-inducible gene.
Proc Natl Acad Sci USA
88:1815,
1991[Abstract/Free Full Text]
21.
Bluyssen HAR,
Muzaffar R,
Vlieststra RJ,
Van der Made ACJ,
Leung S,
Stark GR,
Kerr IM,
Trampman J,
Levy DE:
Combinational association and abundance of components of interferon-stimulated gene factor 3 dictate the selectivity of interferon responses.
Proc Natl Acad Sci USA
92:5645,
1995[Abstract/Free Full Text]
22.
Eilers A,
Georgellis D,
Klose G,
Schindler C,
Ziemiecki A,
Harpur AG,
Wilks AF,
Decker T:
Differentiation-regulated serine phosphorylation of STAT1 promotes GAF activation in macrophages.
Mol Cell Biol
15:3579,
1995[Abstract]
23.
Zhang X,
Blenis J,
Li H-C,
Schinder C,
Chen-Kiang S:
Requirement of serine phosphorylation for differential formation of Stat-promoter complexes in gp130 signaling.
Science
267:1990,
1995[Abstract/Free Full Text]
24.
Damen JE,
Wakao H,
Miyajima A,
Krosl B,
Humphries RK,
Cutler RL,
Krystal G:
Tyrosine 343 in the erythropoietin receptor positively regulates erythropoietin-induced cell proliferation and Stat5 activation.
EMBO J
14:5557,
1995[Medline]
[Order article via Infotrieve]
25.
Gobert S,
Chretien S,
Gouilleux F,
Muller O,
Pallard C,
Dusanter-Fourt I,
Groner B,
Lacombe C,
Gisselbrecht S,
Mayeux P:
Identification of tyrosine residues within the intracellular domain of the erythropoietin receptor curtail for STAT5 activation.
EMBO J
15:2434,
1996[Medline]
[Order article via Infotrieve]
26.
Quelle FW,
Wang D,
Nosaka T,
Thierfelder WE,
Stravopodis D,
Weinstein Y,
Ihle JN:
Erythropoietin induces activation of Stat5 through association with specific tyrosines on the receptor that are not required for a mitogenic response.
Mol Cell Biol
16:1622,
1996[Abstract]
27.
Klingmuller U,
Bergelson S,
Hsiao JG,
Lodish HF:
Multiple tyrosine residues in the cytoplasmic domain of the erythropoietin receptor promote activation of STAT5.
Proc Natl Acad Sci USA
93:8324,
1996[Abstract/Free Full Text]
28.
Tauchi T,
Damen JE,
Toyama K,
Feng G-S,
Broxmeyer HE,
Krystal G:
Tyrosine 425 within the activated erythropoietin receptor binds Syp, reduces the erythropoietin requirement for Syp tyrosine phosphorylation, and promotes mitogenesis.
Blood
87:4495,
1996[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
J. Piessevaux, L. De Ceuninck, D. Catteeuw, F. Peelman, and J. Tavernier
Elongin B/C Recruitment Regulates Substrate Binding by CIS
J. Biol. Chem.,
August 1, 2008;
283(31):
21334 - 21346.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Fang, M. Menon, D. Zhang, B. Torbett, L. Oxburgh, M. Tschan, E. Houde, and D. M. Wojchowski
Attenuation of EPO-dependent erythroblast formation by death-associated protein kinase-2
Blood,
August 1, 2008;
112(3):
886 - 890.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Kenth, J. A M. Mergelas, and C. G. Goodyer
Developmental changes in the human GH receptor and its signal transduction pathways
J. Endocrinol.,
July 1, 2008;
198(1):
71 - 82.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Basham, M. Sathe, J. Grein, T. McClanahan, A. D'Andrea, E. Lees, and A. Rascle
In vivo identification of novel STAT5 target genes
Nucleic Acids Res.,
June 1, 2008;
36(11):
3802 - 3818.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Eleswarapu, Z. Gu, and H. Jiang
Growth Hormone Regulation of Insulin-Like Growth Factor-I Gene Expression May Be Mediated by Multiple Distal Signal Transducer and Activator of Transcription 5 Binding Sites
Endocrinology,
May 1, 2008;
149(5):
2230 - 2240.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Ogawa, M. Satake, and K. Ikuta
Physical and Functional Interactions between STAT5 and Runx Transcription Factors
J. Biochem.,
May 1, 2008;
143(5):
695 - 709.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. M. Lockyer, E. Tran, and B. H. Nelson
STAT5 Is Essential for Akt/p70S6 Kinase Activity during IL-2-Induced Lymphocyte Proliferation
J. Immunol.,
October 15, 2007;
179(8):
5301 - 5308.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Sathyanarayana, M. P. Menon, O. Bogacheva, O. Bogachev, K. Niss, W. S. Kapelle, E. Houde, J. Fang, and D. M. Wojchowski
Erythropoietin modulation of podocalyxin and a proposed erythroblast niche
Blood,
July 15, 2007;
110(2):
509 - 518.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
I. Rochman, N. Watanabe, K. Arima, Y.-J. Liu, and W. J. Leonard
Cutting Edge: Direct Action of Thymic Stromal Lymphopoietin on Activated Human CD4+ T Cells
J. Immunol.,
June 1, 2007;
178(11):
6720 - 6724.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. G. Ronn, N. Billestrup, and T. Mandrup-Poulsen
Diabetes and Suppressors of Cytokine Signaling Proteins
Diabetes,
February 1, 2007;
56(2):
541 - 548.
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Gong and T. R. Malek
Cytokine-Dependent Blimp-1 Expression in Activated T Cells Inhibits IL-2 Production
J. Immunol.,
January 1, 2007;
178(1):
242 - 252.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
X. Zhu, M. S. Chang, R. C. Hsueh, R. Taussig, K. D. Smith, M. I. Simon, and S. Choi
Dual Ligand Stimulation of RAW 264.7 Cells Uncovers Feedback Mechanisms That Regulate TLR-Mediated Gene Expression
J. Immunol.,
October 1, 2006;
177(7):
4299 - 4310.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Nishigaki, C. Hanson, T. Ohashi, A. Spadaccini, and S. Ruscetti
Erythroblast Transformation by the Friend Spleen Focus-Forming Virus Is Associated with a Block in Erythropoietin-Induced STAT1 Phosphorylation and DNA Binding and Correlates with High Expression of the Hematopoietic Phosphatase SHP-1.
J. Virol.,
June 1, 2006;
80(12):
5678 - 5685.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Nakamura, Y. Miyakawa, A. Miyamura, A. Yamane, H. Suzuki, M. Ito, Y. Ohnishi, N. Ishiwata, Y. Ikeda, and N. Tsuruzoe
A novel nonpeptidyl human c-Mpl activator stimulates human megakaryopoiesis and thrombopoiesis
Blood,
June 1, 2006;
107(11):
4300 - 4307.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. M. Gorska, O. Cen, Q. Liang, S. J. Stafford, and R. Alam
Differential Regulation of Interleukin 5-stimulated Signaling Pathways by Dynamin
J. Biol. Chem.,
May 19, 2006;
281(20):
14429 - 14439.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Landsman and D. J. Waxman
Role of the Cytokine-induced SH2 Domain-containing Protein CIS in Growth Hormone Receptor Internalization
J. Biol. Chem.,
November 11, 2005;
280(45):
37471 - 37480.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Robb, K. Boyle, S. Rakar, L. Hartley, J. Lochland, A. W. Roberts, W. S. Alexander, and D. Metcalf
Genetic reduction of embryonic leukemia-inhibitory factor production rescues placentation in SOCS3-null embryos but does not prevent inflammatory disease
PNAS,
November 8, 2005;
102(45):
16333 - 16338.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. A. Litherland, K. M. Grebe, N. S. Belkin, E. Paek, J. Elf, M. Atkinson, L. Morel, M. J. Clare-Salzler, and M. McDuffie
Nonobese Diabetic Mouse Congenic Analysis Reveals Chromosome 11 Locus Contributing to Diabetes Susceptibility, Macrophage STAT5 Dysfunction, and Granulocyte-Macrophage Colony-Stimulating Factor Overproduction
J. Immunol.,
October 1, 2005;
175(7):
4561 - 4565.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Forget, D. J. Gregory, and M. Olivier
Proteasome-mediated Degradation of STAT1{alpha} following Infection of Macrophages with Leishmania donovani
J. Biol. Chem.,
August 26, 2005;
280(34):
30542 - 30549.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. E. Kovanen, L. Young, A. Al-Shami, V. Rovella, C. A. Pise-Masison, M. F. Radonovich, J. Powell, J. Fu, J. N. Brady, P. J. Munson, et al.
Global analysis of IL-2 target genes: identification of chromosomal clusters of expressed genes
Int. Immunol.,
August 1, 2005;
17(8):
1009 - 1021.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. Moucadel and S. N. Constantinescu
Differential STAT5 Signaling by Ligand-dependent and Constitutively Active Cytokine Receptors
J. Biol. Chem.,
April 8, 2005;
280(14):
13364 - 13373.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Olivier, D. J. Gregory, and G. Forget
Subversion Mechanisms by Which Leishmania Parasites Can Escape the Host Immune Response: a Signaling Point of View
Clin. Microbiol. Rev.,
April 1, 2005;
18(2):
293 - 305.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Sekine, T. Yamamoto, T. Yumioka, K. Sugiyama, S. Tsuji, K. Oritani, K. Shimoda, M. Minoguchi, A. Yoshimura, and T. Matsuda
Physical and Functional Interactions between STAP-2/BKS and STAT5
J. Biol. Chem.,
March 4, 2005;
280(9):
8188 - 8196.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. A. Nelson, S. R. Walker, J. V. Alvarez, and D. A. Frank
Isolation of Unique STAT5 Targets by Chromatin Immunoprecipitation-based Gene Identification
J. Biol. Chem.,
December 24, 2004;
279(52):
54724 - 54730.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Dreuw, S. Radtke, S. Pflanz, B. E. Lippok, P. C. Heinrich, and H. M. Hermanns
Characterization of the Signaling Capacities of the Novel gp130-like Cytokine Receptor
J. Biol. Chem.,
August 20, 2004;
279(34):
36112 - 36120.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G.-J. M. van de Geijn, J. Gits, L. H. J. Aarts, C. Heijmans-Antonissen, and I. P. Touw
G-CSF receptor truncations found in SCN/AML relieve SOCS3-controlled inhibition of STAT5 but leave suppression of STAT3 intact
Blood,
August 1, 2004;
104(3):
667 - 674.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G.-J. M. van de Geijn, J. Gits, and I. P. Touw
Distinct activities of suppressor of cytokine signaling (SOCS) proteins and involvement of the SOCS box in controlling G-CSF signaling
J. Leukoc. Biol.,
July 1, 2004;
76(1):
237 - 244.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. G. Miquet, A. I. Sotelo, A. Bartke, and D. Turyn
Suppression of Growth Hormone (GH) Janus Tyrosine Kinase 2/Signal Transducer and Activator of Transcription 5 Signaling Pathway in Transgenic Mice Overexpressing Bovine GH
Endocrinology,
June 1, 2004;
145(6):
2824 - 2832.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. J. Peltola, K. Paukku, T. L. T. Aho, M. Ruuska, O. Silvennoinen, and P. J. Koskinen
Pim-1 kinase inhibits STAT5-dependent transcription via its interactions with SOCS1 and SOCS3
Blood,
May 15, 2004;
103(10):
3744 - 3750.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. J. Bensinger, P. T. Walsh, J. Zhang, M. Carroll, R. Parsons, J. C. Rathmell, C. B. Thompson, M. A. Burchill, M. A. Farrar, and L. A. Turka
Distinct IL-2 Receptor Signaling Pattern in CD4+CD25+ Regulatory T Cells
J. Immunol.,
May 1, 2004;
172(9):
5287 - 5296.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Bayle, S. Letard, R. Frank, P. Dubreuil, and P. De Sepulveda
Suppressor of Cytokine Signaling 6 Associates with KIT and Regulates KIT Receptor Signaling
J. Biol. Chem.,
March 26, 2004;
279(13):
12249 - 12259.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. J. Moon, E. D. Rubio, A. Martino, A. Krumm, and B. H. Nelson
A Permissive Role for Phosphatidylinositol 3-Kinase in the Stat5- mediated Expression of Cyclin D2 by the Interleukin-2 Receptor
J. Biol. Chem.,
February 13, 2004;
279(7):
5520 - 5527.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Rascle and E. Lees
Chromatin acetylation and remodeling at the Cis promoter during STAT5-induced transcription
Nucleic Acids Res.,
December 1, 2003;
31(23):
6882 - 6890.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Hebenstreit, P. Luft, A. Schmiedlechner, G. Regl, A.-M. Frischauf, F. Aberger, A. Duschl, and J. Horejs-Hoeck
IL-4 and IL-13 Induce SOCS-1 Gene Expression in A549 Cells by Three Functional STAT6-Binding Motifs Located Upstream of the Transcription Initiation Site
J. Immunol.,
December 1, 2003;
171(11):
5901 - 5907.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Li, C. Miller, S. Hegde, and D. Wojchowski
Roles for an Epo Receptor Tyr-343 Stat5 Pathway in Proliferative Co-signaling with Kit
J. Biol. Chem.,
October 17, 2003;
278(42):
40702 - 40709.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Rascle, J. A. Johnston, and B. Amati
Deacetylase Activity Is Required for Recruitment of the Basal Transcription Machinery and Transactivation by STAT5
Mol. Cell. Biol.,
June 15, 2003;
23(12):
4162 - 4173.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. A. Denson, M. A. Held, R. K. Menon, S. J. Frank, A. F. Parlow, and D. L. Arnold
Interleukin-6 inhibits hepatic growth hormone signaling via upregulation of Cis and Socs-3
Am J Physiol Gastrointest Liver Physiol,
April 1, 2003;
284(4):
G646 - G654.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Chen, P. O. Anderson, L. Li, H.-O. Sjogren, P. Wang, and S.-L. Li
Functional association of cytokine-induced SH2 protein and protein kinase C in activated T cells
Int. Immunol.,
March 1, 2003;
15(3):
403 - 409.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Ketteler, C. S. Moghraby, J. G. Hsiao, O. Sandra, H. F. Lodish, and U. Klingmuller
The Cytokine-inducible Scr Homology Domain-containing Protein Negatively Regulates Signaling by Promoting Apoptosis in Erythroid Progenitor Cells
J. Biol. Chem.,
January 17, 2003;
278(4):
2654 - 2660.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Endo, A. Sasaki, M. Minoguchi, A. Joo, and A. Yoshimura
CIS1 Interacts with the Y532 of the Prolactin Receptor and Suppresses Prolactin-Dependent STAT5 Activation
J. Biochem.,
January 1, 2003;
133(1):
109 - 113.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Asai, S. Hachimura, M. Kimura, T. Toraya, M. Yamashita, T. Nakayama, and S. Kaminogawa
T Cell Hyporesponsiveness Induced by Oral Administration of Ovalbumin Is Associated with Impaired NFAT Nuclear Translocation and p27kip1 Degradation
J. Immunol.,
November 1, 2002;
169(9):
4723 - 4731.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. D. Curlewis, S. P. Tam, P. Lau, D. H. L. Kusters, J. L. Barclay, S. T. Anderson, and M. J. Waters
A Prostaglandin F2{alpha} Analog Induces Suppressors of Cytokine Signaling-3 Expression in the Corpus Luteum of the Pregnant Rat: A Potential New Mechanism in Luteolysis
Endocrinology,
October 1, 2002;
143(10):
3984 - 3993.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Peng, K. D. Sutherland, E. Y. M. Sum, M. Olayioye, S. Wittlin, T. K. Tang, G. J. Lindeman, and J. E. Visvader
CPAP Is a Novel Stat5-Interacting Cofactor that Augments Stat5-Mediated Transcriptional Activity
Mol. Endocrinol.,
September 1, 2002;
16(9):
2019 - 2033.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. G. Ronn, J. A. Hansen, K. Lindberg, A. E. Karlsen, and N. Billestrup
The Effect of Suppressor of Cytokine Signaling 3 on GH Signaling in {beta}-Cells
Mol. Endocrinol.,
September 1, 2002;
16(9):
2124 - 2134.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Tonko-Geymayer, O. Goupille, M. Tonko, C. Soratroi, A. Yoshimura, C. Streuli, A. Ziemiecki, R. Kofler, and W. Doppler
Regulation and Function of the Cytokine-Inducible SH-2 Domain Proteins, CIS and SOCS3, in Mammary Epithelial Cells
Mol. Endocrinol.,
July 1, 2002;
16(7):
1680 - 1695.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. J. Greenhalgh, P. Bertolino, S. L. Asa, D. Metcalf, J. E. Corbin, T. E. Adams, H. W. Davey, N. A. Nicola, D. J. Hilton, and W. S. Alexander
Growth Enhancement in Suppressor of Cytokine Signaling 2 (SOCS-2)-Deficient Mice Is Dependent on Signal Transducer and Activator of Transcription 5b (STAT5b)
Mol. Endocrinol.,
June 1, 2002;
16(6):
1394 - 1406.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Nieborowska-Skorska, G. Hoser, P. Kossev, M. A. Wasik, and T. Skorski
Complementary functions of the antiapoptotic protein A1 and serine/threonine kinase pim-1 in the BCR/ABL-mediated leukemogenesis
Blood,
May 29, 2002;
99(12):
4531 - 4539.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. B. Maurer, C. Wichmann, A. Gross, H. Kunkel, T. Heinzel, M. Ruthardt, B. Groner, and M. Grez
The Stat5-RARalpha fusion protein represses transcription and differentiation through interaction with a corepressor complex
Blood,
April 15, 2002;
99(8):
2647 - 2652.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Lehtonen, S. Matikainen, M. Miettinen, and I. Julkunen
Granulocyte-macrophage colony-stimulating factor (GM-CSF)-induced STAT5 activation and target-gene expression during human monocyte/macrophage differentiation
J. Leukoc. Biol.,
March 1, 2002;
71(3):
511 - 519.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Gonzalez, J. G. Miquet, A. I. Sotelo, A. Bartke, and D. Turyn
Cytokine-Inducible SH2 Protein Up-Regulation Is Associated with Desensitization of GH Signaling in GHRH-Transgenic Mice
Endocrinology,
February 1, 2002;
143(2):
386 - 394.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Kirito, K. Nakajima, T. Watanabe, M. Uchida, M. Tanaka, K. Ozawa, and N. Komatsu
Identification of the human erythropoietin receptor region required for Stat1 and Stat3 activation
Blood,
January 1, 2002;
99(1):
102 - 110.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Emanuelli, P. Peraldi, C. Filloux, C. Chavey, K. Freidinger, D. J. Hilton, G. S. Hotamisligil, and E. Van Obberghen
SOCS-3 Inhibits Insulin Signaling and Is Up-regulated in Response to Tumor Necrosis Factor-alpha in the Adipose Tissue of Obese Mice
J. Biol. Chem.,
December 14, 2001;
276(51):
47944 - 47949.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Dif, E. Saunier, B. Demeneix, P. A. Kelly, and M. Edery
Cytokine-Inducible SH2-Containing Protein Suppresses PRL Signaling by Binding the PRL Receptor
Endocrinology,
December 1, 2001;
142(12):
5286 - 5293.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. P. Tam, P. Lau, J. Djiane, D. J. Hilton, and M. J. Waters
Tissue-Specific Induction of SOCS Gene Expression by PRL
Endocrinology,
November 1, 2001;
142(11):
5015 - 5026.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T.-S. Migone, M. Humbert, A. Rascle, D. Sanden, A. D'Andrea, and J. A. Johnston
The deubiquitinating enzyme DUB-2 prolongs cytokine-induced signal transducers and activators of transcription activation and suppresses apoptosis following cytokine withdrawal
Blood,
September 15, 2001;
98(6):
1935 - 1941.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. J. Greenhalgh and D. J. Hilton
Negative regulation of cytokine signaling
J. Leukoc. Biol.,
September 1, 2001;
70(3):
348 - 356.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Flores-Morales, L. Fernandez, E. Rico-Bautista, A. Umana, C. Negrin, J.-G. Zhang, and G. Norstedt
Endoplasmic Reticulum Stress Prolongs GH-Induced Janus Kinase (JAK2)/Signal Transducer and Activator of Transcription (STAT5) Signaling Pathway
Mol. Endocrinol.,
September 1, 2001;
15(9):
1471 - 1483.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. J. Moon and B. H. Nelson
Phosphatidylinositol 3-Kinase Potentiates, but Does Not Trigger, T Cell Proliferation Mediated by the IL-2 Receptor
J. Immunol.,
September 1, 2001;
167(5):
2714 - 2723.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Frantsve, J. Schwaller, D. W. Sternberg, J. Kutok, and D. G. Gilliland
Socs-1 Inhibits TEL-JAK2-Mediated Transformation of Hematopoietic Cells through Inhibition of JAK2 Kinase Activity and Induction of Proteasome-Mediated Degradation
Mol. Cell. Biol.,
May 15, 2001;
21(10):
3547 - 3557.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
D. L. Barber, B. K. Beattie, J. M. Mason, M. H.-H. Nguyen, M. Yoakim, B. G. Neel, A. D. D'Andrea, and D. A. Frank
A common epitope is shared by activated signal transducer and activator of transcription-5 (STAT5) and the phosphorylated erythropoietin receptor: implications for the docking model of STAT activation
Blood,
April 15, 2001;
97(8):
2230 - 2237.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Bhattacharya, B. A. Stout, M. E. Bates, P. J. Bertics, and J. S. Malter
Granulocyte Macrophage Colony-Stimulating Factor and Interleukin-5 Activate STAT5 and Induce CIS1 mRNA in Human Peripheral Blood Eosinophils
Am. J. Respir. Cell Mol. Biol.,
March 1, 2001;
24(3):
312 - 316.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Brender, M. Nielsen, K. Kaltoft, G. Mikkelsen, Q. Zhang, M. Wasik, N. Billestrup, and N. Odum
STAT3-mediated constitutive expression of SOCS-3 in cutaneous T-cell lymphoma
Blood,
February 15, 2001;
97(4):
1056 - 1062.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Sporri, P. E. Kovanen, A. Sasaki, A. Yoshimura, and W. J. Leonard
JAB/SOCS1/SSI-1 is an interleukin-2-induced inhibitor of IL-2 signaling
Blood,
January 1, 2001;
97(1):
221 - 226.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. L. Bergad, S. J. Schwarzenberg, J. T. Humbert, M. Morrison, S. Amarasinghe, H. C. Towle, and S. A. Berry
Inhibition of growth hormone action in models of inflammation
Am J Physiol Cell Physiol,
December 1, 2000;
279(6):
C1906 - C1917.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Gesbert and J. D. Griffin
Bcr/Abl activates transcription of the Bcl-X gene through STAT5
Blood,
September 15, 2000;
96(6):
2269 - 2276.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Li, S. Chen, X. Xu, A. Sundstedt, K. M. Paulsson, P. Anderson, S. Karlsson, H.-O. Sjogren, and P. Wang
Cytokine-Induced Src Homology 2 Protein (Cis) Promotes T Cell Receptor-Mediated Proliferation and Prolongs Survival of Activated T Cells
J. Exp. Med.,
March 20, 2000;
191(6):
985 - 994.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. Lacronique, A. Boureux, R. Monni, S. Dumon, M. Mauchauffe, P. Mayeux, F. Gouilleux, R. Berger, S. Gisselbrecht, J. Ghysdael, et al.
Transforming properties of chimeric TEL-JAK proteins in Ba/F3 cells
Blood,
March 15, 2000;
95(6):
2076 - 2083.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Sillaber, F. Gesbert, D. A. Frank, M. Sattler, and J. D. Griffin
STAT5 activation contributes to growth and viability in Bcr/Abl-transformed cells
Blood,
March 15, 2000;
95(6):
2118 - 2125.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. R. Boisclair, J. Wang, J. Shi, K. R. Hurst, and G. T. Ooi
Role of the Suppressor of Cytokine Signaling-3 in Mediating the Inhibitory Effects of Interleukin-1beta on the Growth Hormone-dependent Transcription of the Acid-labile Subunit Gene in Liver Cells
J. Biol. Chem.,
February 11, 2000;
275(6):
3841 - 3847.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Krebs and D. Hilton
SOCS: physiological suppressors of cytokine signaling
J. Cell Sci.,
January 8, 2000;
113(16):
2813 - 2819.
[Abstract]
[PDF]
|
|
|
|
|
|
|
C.-L. Yu, Y.-J. Jin, and S. J. Burakoff
Cytosolic Tyrosine Dephosphorylation of STAT5. POTENTIAL ROLE OF SHP-2 IN STAT5 REGULATION
J. Biol. Chem.,
January 7, 2000;
275(1):
599 - 604.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. C. Ward, I. Touw, and A. Yoshimura
The Jak-Stat pathway in normal and perturbed hematopoiesis
Blood,
January 1, 2000;
95(1):
19 - 29.
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. A. Ram and D. J. Waxman
SOCS/CIS Protein Inhibition of Growth Hormone-stimulated STAT5 Signaling by Multiple Mechanisms
J. Biol. Chem.,
December 10, 1999;
274(50):
35553 - 35561.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. E. Isaksen, H. Baumann, P. A. Trobridge, A. G. Farr, S. D. Levin, and S. F. Ziegler
Requirement for Stat5 in Thymic Stromal Lymphopoietin-Mediated Signal Transduction
J. Immunol.,
December 1, 1999;
163(11):
5971 - 5977.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S.-F. Lee, H.-M. Huang, J.-R. Chao, S. Lin, H.-F. Yang-Yen, and J. J.-Y. Yen
Cytokine Receptor Common beta Chain as a Potential Activator of Cytokine Withdrawal-Induced Apoptosis
Mol. Cell. Biol.,
November 1, 1999;
19(11):
7399 - 7409.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. A. Hansen, K. Lindberg, D. J. Hilton, J. H. Nielsen, and N. Billestrup
Mechanism of Inhibition of Growth Hormone Receptor Signaling by Suppressor of Cytokine Signaling Proteins
Mol. Endocrinol.,
November 1, 1999;
13(11):
1832 - 1843.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
I.-H. Lee, W. P. Li, K. B. Hisert, and L. B. Ivashkiv
Inhibition of Interleukin 2 Signaling and Signal Transducer and Activator of Transcription (Stat)5 Activation during T Cell Receptor-Mediated Feedback Inhibition of T Cell Expansion
J. Exp. Med.,
November 1, 1999;
190(9):
1263 - 1274.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Bjorbak, K. El-Haschimi, J. D. Frantz, and J. S. Flier
The Role of SOCS-3 in Leptin Signaling and Leptin Resistance
J. Biol. Chem.,
October 15, 1999;
274(42):
30059 - 30065.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. J. Aman, T.-S. Migone, A. Sasaki, D. P. Ascherman, M.-h. Zhu, E. Soldaini, K. Imada, A. Miyajima, A. Yoshimura, and W. J. Leonard
CIS Associates with the Interleukin-2 Receptor beta Chain and Inhibits Interleukin-2-dependent Signaling
J. Biol. Chem.,
October 15, 1999;
274(42):
30266 - 30272.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. L. Janas, P. Hodgkin, M. Hibbs, and D. Tarlinton
Genetic Evidence for Lyn as a Negative Regulator of IL-4 Signaling
J. Immunol.,
October 15, 1999;
163(8):
4192 - 4198.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. A. Cassatella, S. Gasperini, C. Bovolenta, F. Calzetti, M. Vollebregt, P. Scapini, M. Marchi, R. Suzuki, A. Suzuki, and A. Yoshimura
Interleukin-10 (IL-10) Selectively Enhances CIS3/SOCS3 mRNA Expression in Human Neutrophils: Evidence for an IL-10-Induced Pathway That Is Independent of STAT Protein Activation
Blood,
October 15, 1999;
94(8):
2880 - 2889.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. A. Qureshi, R. M. Kim, Z. Konteatis, D. E. Biazzo, H. Motamedi, R. Rodrigues, J. A. Boice, J. R. Calaycay, M. A. Bednarek, P. Griffin, et al.
Mimicry of erythropoietin by a nonpeptide molecule
PNAS,
October 12, 1999;
96(21):
12156 - 12161.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. S. Watowich, X. Xie, U. Klingmuller, J. Kere, M. Lindlof, S. Berglund, and A. de la Chapelle
Erythropoietin Receptor Mutations Associated With Familial Erythrocytosis Cause Hypersensitivity to Erythropoietin in the Heterozygous State
Blood,
October 1, 1999;
94(7):
2530 - 2532.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Matsumoto, Y. Seki, M. Kubo, S. Ohtsuka, A. Suzuki, I. Hayashi, K. Tsuji, T. Nakahata, M. Okabe, S. Yamada, et al.
Suppression of STAT5 Functions in Liver, Mammary Glands, and T Cells in Cytokine-Inducible SH2-Containing Protein 1 Transgenic Mice
Mol. Cell. Biol.,
September 1, 1999;
19(9):
6396 - 6407.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Pezet, H. Favre, P. A. Kelly, and M. Edery
Inhibition and Restoration of Prolactin Signal Transduction by Suppressors of Cytokine Signaling
J. Biol. Chem.,
August 27, 1999;
274(35):
24497 - 24502.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Tollet-Egnell, A. Flores-Morales, A. Stavréus-Evers, L. Sahlin, and G. Norstedt
Growth Hormone Regulation of SOCS-2, SOCS-3, and CIS Messenger Ribonucleic Acid Expression in the Rat
Endocrinology,
August 1, 1999;
140(8):
3693 - 3704.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
N. Tanaka, K. Kaneko, H. Asao, H. Kasai, Y. Endo, T. Fujita, T. Takeshita, and K. Sugamura
Possible Involvement of a Novel STAM-associated Molecule "AMSH" in Intracellular Signal Transduction Mediated by Cytokines
J. Biol. Chem.,
July 2, 1999;
274(27):
19129 - 19135.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. J. Cohney, D. Sanden, N. A. Cacalano, A. Yoshimura, A. Mui, T. S. Migone, and J. A. Johnston
SOCS-3 Is Tyrosine Phosphorylated in Response to Interleukin-2 and Suppresses STAT5 Phosphorylation and Lymphocyte Proliferation
Mol. Cell. Biol.,
July 1, 1999;
19(7):
4980 - 4988.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. L. Gaffen, S. Y. Lai, G. D. Longmore, K. D. Liu, and M. A. Goldsmith
Genetic Evidence for an Additional Factor Required for Erythropoietin-Induced Signal Transduction
Blood,
July 1, 1999;
94(1):
74 - 86.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. J. Auernhammer, C. Bousquet, and S. Melmed
Autoregulation of pituitary corticotroph SOCS-3 expression: Characterization of the murine SOCS-3 promoter
PNAS,
June 8, 1999;
96(12):
6964 - 6969.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Bjørbæk, J. K. Elmquist, K. El-Haschimi, J. Kelly, R. S. Ahima, S. Hileman, and J. S. Flier
Activation of SOCS-3 Messenger Ribonucleic Acid in the Hypothalamus by Ciliary Neurotrophic Factor
Endocrinology,
May 1, 1999;
140(5):
2035 - 2043.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
M. Nieborowska-Skorska, M. A. Wasik, A. Slupianek, P. Salomoni, T. Kitamura, B. Calabretta, and T. Skorski
Signal Transducer and Activator of Transcription (STAT)5 Activation by BCR/ABL Is Dependent on Intact Src Homology (SH)3 and SH2 Domains of BCR/ABL and Is Required for Leukemogenesis
J. Exp. Med.,
April 19, 1999;
189(8):
1229 - 1242.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Y. Liu, C. Fan, R. Garcia, R. Jove, and K. S. Zuckerman
Constitutive Activation of the JAK2/STAT5 Signal Transduction Pathway Correlates With Growth Factor Independence of Megakaryocytic Leukemic Cell Lines
Blood,
April 1, 1999;
93(7):
2369 - 2379.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C.G. Begley and N.A. Nicola
Resolving Conflicting Signals: Cross Inhibition of Cytokine Signaling Pathways
Blood,
March 1, 1999;
93(5):
1443 - 1447.
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Ito, P. Ansari, M. Sakatsume, H. Dickensheets, N. Vazquez, R. P. Donnelly, A. C. Larner, and D. S. Finbloom
Interleukin-10 Inhibits Expression of Both Interferon alpha - and Interferon gamma - Induced Genes by Suppressing Tyrosine Phosphorylation of STAT1
Blood,
March 1, 1999;
93(5):
1456 - 1463.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. S. Watowich, K. D. Liu, X. Xie, S. Y. Lai, A. Mikami, G. D. Longmore, and M. A. Goldsmith
Oligomerization and Scaffolding Functions of the Erythropoietin Receptor Cytoplasmic Tail
J. Biol. Chem.,
February 26, 1999;
274(9):
5415 - 5421.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. A. Gebert, S.-H. Park, and D. J. Waxman
Down-Regulation of Liver JAK2-STAT5b Signaling by the Female Plasma Pattern of Continuous Growth Hormone Stimulation
Mol. Endocrinol.,
February 1, 1999;
13(2):
213 - 227.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
A. Castro, T. K. Sengupta, D. C. Ruiz, E. Yang, and L. B. Ivashkiv
IL-4 Selectively Inhibits IL-2-Triggered Stat5 Activation, But Not Proliferation, in Human T Cells
J. Immunol.,
February 1, 1999;
162(3):
1261 - 1269.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. A. Gebert, S.-H. Park, and D. J. Waxman
Termination of Growth Hormone Pulse-Induced STAT5b Signaling
Mol. Endocrinol.,
January 1, 1999;
13(1):
38 - 56.
[Abstract]
[Full Text]
|
|
|
|
|
Abstract
Introduction
Abstract