Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pless, M.
Right arrow Articles by Mathey-Prevot, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pless, M.
Right arrow Articles by Mathey-Prevot, B.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 89 No. 9 (May 1), 1997: pp. 3175-3185

Receptors That Induce Erythroid Differentiation of Ba/F3 Cells: Structural Requirements and Effect on STAT5 Binding

By Miklos Pless, Koenraad Norga, Martin Carroll, Markus H. Heim, Alan D. D'Andrea, and Bernard Mathey-Prevot

From the Division of Pediatric Oncology and Hematology, Dana-Farber Cancer Institute, Boston; Children's Hospital, Boston; the Beth Israel Hospital Boston, MA; and the Department of Internal Medicine, Kantonsspital Basel, Switzerland.


    ABSTRACT
Abstract
Introduction
Methods
Results
Discussion
References

Ectopic expression of the erythropoietin receptor (EpoR) in the interleukin-3 (IL-3)-dependent cell line Ba/F3 results in growth and partial erythroid differentiation in Epo. In contrast, introduction and activation of the interleukin-5 receptor (IL-5R) or of the granulocyte-macrophage colony-stimulating factor receptor (GM-CSFR) results in proliferation only. As this effect is specific to the EpoR, the role of its extracellular or cytoplasmic domain in differentiation was tested after construction of two chimeric receptors. One receptor contained the extracellular domain of EpoR fused to the endodomain of IL-3R beta -chain (E/beta ), while the other contained the EpoR cytoplasmic region fused to the extracellular domain of GM-CSFR alpha -chain (GMER). Surprisingly, both receptors induced differentiation ruling out a strict specificity of the extracellular or cytoplasmic region of EpoR in this process. Instead the ability to signal differentiation correlated with structural features shared by the EpoR, GMER, and E/beta receptors. Dimerization of all three receptors results in the pairing of two signal transducing chains in the cytoplasm, in contrast to the mitogenic receptors IL-3R, IL-5R, GM-CSFR, which assemble as alpha beta heterodimers. Two new chimeric receptors that fulfilled the structural requirement exemplified by EpoR, but lacked any part of EpoR, were designed to consolidate this model. They consisted of the ectodomains of the GMR-alpha and IL-5Ralpha , respectively, fused to the endodomain of IL-3R beta -chain. Both receptors were as effective as EpoR in signaling differentiation in response to their cognate ligand. Another property of receptors fulfilling these structural requirements is that they cause a marked delay in signal transducers and activators of transcription 5 (STAT5) activation on ligand stimulation. Taken together our studies show that structural assembly of receptors dictates their potential to signal erythroid differentiation in Ba/F3 cells, that differentiation can take place in the absence of Epo and that a delay in STAT5 activation is highly predictive of this process.

    INTRODUCTION
Abstract
Introduction
Methods
Results
Discussion
References

THE ERYTHROPOIETIN receptor (EpoR) is a member of the hematopoietic growth factor receptor family expressed on hematopoietic progenitor cells and committed erythroid precursor cells. Under the influence of Epo, progenitor cells first undergo a phase of pronounced expansion followed by a period of differentiation. Although multiple experiments show the pivotal role of the EpoR for growth,1-5 questions remain about the role of the Epo/EpoR interaction in differentiation. One line of evidence consistent with a stochastic model for erythroid differentiation, suggests that the EpoR has a marginal role in promoting differentiation, serving merely as a survival factor,6,7 whereas another, supporting an instructive model, claims that expression and activation of the EpoR is required for differentiation of late progenitor cells.8-11

To help define the role of the EpoR in differentiation, we took advantage of a model system provided by Ba/F3 cells.8,9 This strictly interleukin-3 (IL-3) dependent, murine progenitor cell line proliferates and undergoes limited erythroid differentiation in Epo on ectopic expression of the EpoR.10,11 Although this observation was consistent with the instructive model, it did not address two critical points. Is EpoR-mediated differentiation of Ba/F3 cells specific to this receptor, or is it merely a trivial consequence of the ectopic expression in Ba/F3 cells of a hematopoietic receptor other than the endogenous IL-3 receptor IL-3R? Second, if the EpoR differs from other receptors in its ability to support both proliferation and differentiation of Ba/F3 cells, what accounts for its unique specificity?

Initial studies with truncation mutants of the EpoR had failed to dissociate proliferation from differentiation.12 Furthermore, studies of chimeric receptors containing either the ectodomain or endodomain of the EpoR gave conflicting results: both the extracellular and the endodomain of the EpoR contributed independently to differentiation of Ba/F3 cells.12-14 As attempts to identify a differentiation-specific domain of the EpoR had remained uninformative, we decided to approach this question differently and investigate whether structural features in receptor assembly, characteristic of the EpoR and of the differentiation-competent chimeric receptors, might not provide an insight to their specificity. Indeed, structural differences in the assembled chains in the cytoplasm might lead to qualitative or quantitative differences in signal transduction, and thus explain why certain receptors primarily mediate proliferation while others support both proliferation and differentiation.

Although hematopoietic growth factor receptor subunits lack a cytoplasmic kinase activity, rapid tyrosine phosphorylation events follow activation of the receptor.15,16 In the case of the EpoR, the JAK2 kinase phosphorylates the EpoR itself,17,18 as well as signal transducers and activators of transcription (STAT) transcription factors.19,20 The integrity of the JAK/STAT pathway seems to be crucial for the proliferative response induced by hematopoietic growth factor receptors.21 Among the various STAT proteins identified, STAT5 (which exists as two isoforms, STAT5A and STAT5B22,23 ) is thought to be important in the proliferation of hematopoietic cell lines in response to IL-3, granulocyte-macrophage colony-stimulating factor (GM-CSF ), IL-5, and Epo.24,25

In this report, we show that differentiation induced by the EpoR is a specific event, which cannot be achieved by signaling through other physiologic receptors such as the GM-CSF receptor (GMR) or the IL-5R. Furthermore, we present evidence that the cytoplasmic pairing of two signal transducing receptor chains is sufficient to promote differentiation of Ba/F3 cells. This observation reconciles all the previous findings and suggests that erythroid differentiation can be signaled by receptors containing no part of the EpoR. We also found an inverse correlation between early STAT5 activation and beta -globin induction. Stimulation of differentiation-competent receptors led to a marked reduction in STAT5 binding, particularly in the early time points. This difference was not observed with other members of the STAT family. Our experiments offer biochemical evidence that EPO signaling in Ba/F3 cells is different from that of IL-3, GM-CSF, and IL-5. Furthermore they show that the status of early STAT5 activation can be used as a marker of erythroid differentiation in Ba/F3 cells.

    MATERIALS AND METHODS
Abstract
Introduction
Methods
Results
Discussion
References

Cells

Ba/F3 cells8 were grown in a humidified incubator at 37°C with 5% CO2 in growth medium (RPMI 1640 medium supplemented with 10% fetal calf serum [FCS], penicillin [50 U/mL], streptomycin [50 µg/mL], glutamine [2 mmol/L], and murine rIL-3 [R&D, Minneapolis, MN] at 0.5 ng/mL).

Transfections

DNA constructs (25 µg) were stably introduced into 107 Ba/F3 cells by electroporation using a BioRAD apparatus set (Hercules, CA) at 300 V and 960 µF. Each construct was electroporated at least twice. Forty-eight hours after electroporation, cells were replated in growth medium supplemented with G418 (1 mg/mL). G418 resistant cells were kept in medium with IL-3 and G418 or switched to a given cytokine at the indicated concentration: murine rGM-CSF (R&D): 1 ng/mL; murine rIL-5 (R&D): 1 ng/mL; human rEpo: 0.5 U/mL.

Constructs

EpoR. The EpoR cDNA has been described.26

E/beta . A BglII site was introduced over the codons encoding the 10th and 11th amino acid (a.a.) of the cytoplasmic region of murine beta IL3 cDNA,27 and used to join in frame EpoR DNA (encoding a.a. 1 to 282) with beta IL3 DNA (encoding a.a. 476 to 882) (see Fig 1).


View larger version (17K):
[in this window]
[in a new window]
 
Fig 1. Schematic of the wild-type and chimeric receptors introduced into Ba/F3 cells. All receptor cDNAs were subcloned into the expression vector pLXSN, which contains a neomycin resistance gene as a selectable marker.30 Receptor complexes are shown as dimers. The endogenous beta c chain is represented by a thin, black rectangle.

GMR-alpha . A cDNA for the GM-CSF receptor alpha -chain (GMR-alpha ) was obtained by reverse transcriptse-polymerase chain reaction (PCR) of polyA+ RNA isolated from MKVS cells. MKVS is a murine myeloid cell line isolated after infection of Balb/c bone marrow cells with a retrovirus containing the v-myc and v-src oncogenes (B.M.-P., unpublished results, September 1988).

GM-CSFR alpha -chain (GMER). The chimeric receptor has a.a. 1 to 325 of the GMR-alpha chain fused to a.a. 250 to 571 of the EpoR (see Fig 1). The in-frame fusion was obtained using the gene splicing by overlap extension method.28

GMR-alpha /beta IL3 . The chimeric receptor consists of a.a 1 to 325 of the GMR-alpha chain fused to a.a. 420 to 882 of beta IL3 (see Fig 1). Construction of the bipartite cDNA was aided by PCR technology.

IL-5Ralpha . The cDNA was a kind gift of Dr Tavernier (Hoffmann LaRoche, Gent, Belgium).29

IL-5alpha /beta IL3 . The chimeric receptor (see Fig 1) consists of a.a. 1 to 361 of the IL-5Ralpha chain fused to a.a. 466 to 882 of beta IL3 using a strategy similar to that described above. All PCR-derived fragments in the above constructs were sequenced to confirm the integrity of the fusion and to rule out any additional unwanted mutations. cDNAs (wild-type or chimeric) were subcloned into the retroviral expression vector pLXSN, which contains the selectable marker neoR gene under the control of the SV40 promoter.30

RNA, Northern Blots, and RNase Protection Assays

RNA was isolated from cells grown in IL-3 or in the indicated cytokine, using TRIzol Reagent (GIBCO-BRL, Gaithersburg, MD) according to the manufacturer's recommendations.

Northern blot assay. RNA samples (15 µg) were run on a 1% agarose formaldehyde gel, transferred onto a nylon membrane (Duralon; Stratagene, La Jolla, CA), and hybridized in QuickHyb Solution (Stratagene) for 2 hours at 68°C. Blots were washed twice in 2 × saline sodium citrate /0.1% sodium dodecyle sulfate at room temperature for 15 minutes. Probes were 32P-labeled using the random primer method. Murine beta -globin and (GAPDH) glyceraldehyde-3-phosphate dehydrogenase probes have been described.12

RNase protection. RNA samples (25 µg) were analyzed as previously described.31 The following probes were used: IL-5Ralpha riboprobe: the 169-base pair (bp) fragment (HincII-BglII) spanning the transmembrane region of the IL-5Ralpha chain cDNA was cloned into the Bluescript KS vector. Antisense riboprobe derived from that fragment was generated using T7 RNA polymerase. GMR-alpha riboprobe: Genomic DNA was used to amplify a GMR-alpha specific probe, directed against the 3' coding region of the cDNA. A 110-bp fragment, containing 50 bp of the penultimate coding exon of GMR-alpha and extending into the following intron up to a Sty I site, was subcloned into Bluescript KS (EcoRI/Sma I). Antisense probe was generated with T7 polymerase. EpoR riboprobe: A 90-bp fragment from the BglII site to the 3' Pst I site of the EpoR cDNA was subcloned into SP72 (BglII/Pst I). Antisense probe was generated with SP6 polymerase.

Dose Response Assays

The XTT reduction assay (Sigma, St Louis, MO) was performed as described.12 Each dose response curve was done three times in triplicate.

Nuclear Extracts and Electrophoretic Mobility Shift Assays

Cells were washed three times in phosphate-buffered saline (PBS) and starved in the absence of cytokines for 6 hours in RPMI 1640. Cells were then stimulated for 10 minutes with the indicated cytokine at a concentration used in growth medium (see above). Nuclear extracts were prepared as previously described.32 Oligonucleotides used were (top strand is indicated): beta -casein promoter element: AGATTTCTAGGAATTCAAATC33; hSIE probe: GCATTTCCCGTAAATCC34; unrelated oligonucleotide: GATCCTCTCACCTTCTGCTAG. Nuclear extracts were incubated in binding buffer (13 mmol/L HEPES [pH 7.9], 65 mmol/L NaCl, 1 mmol/L DTT, 0.15 mmol/L EDTA, 8% Glycerol, and 1 µg of poydIdC)35 in the presence or absence of excess unlabeled competitor (40 ng/µL) before addition of the 32P-labeled oligonucleotide probe. Amounts of nuclear extracts were normalized on a per microgram of protein basis. Samples were electrophoresed on nondenaturing polyacrylamide gels, in 0.5 × (TBE) Tris/Borate/EDTA buffer.

Stat5 antiserum. Stat5 antiserum was raised in rabbits against a.a. 687 to 794 of ovine Stat5.

STAT6 antiserum. Polyclonal rabbit antiserum against Stat6 was raised in rabbits against a.a. 633 to 837 of murine Stat6. For supershift experiments, 1 µL of a 1:10 dilution of the crude antiserum was added to the reaction and incubated for 20 minutes on ice, before adding the radiolabeled oligonucleotide.

Flow Cytometry

Two-hundred thousand cells grown in IL-3 were used for each condition. Cells were washed in PBS containing 0.2% FCS and 0.02% NaAzide, and incubated with the first antibody for 30 minutes at 4°C. As isotype control, a polyclonal rabbit antimouse (Southern Biotech, Birmingham, AL) was used. Following two washes with PBS, cells were then incubated with the secondary antibody (biotinylated goat antirat or antimouse) for 30 minutes at 4°C. After two more washes, fluorescein isothiocyanate-labeled Streptavidin was added (30 minutes, 4°C), and cells were analyzed on a FACScan (Becton Dickinson & Co, San Jose, CA). Each experiment was performed three times.

    RESULTS
Abstract
Introduction
Methods
Results
Discussion
References

The EpoR But Not the GMR Nor the IL-5R Signals Erythroid Differentiation in Ba/F3 Cells

We first wanted to clarify whether beta -globin production in Ba/F3 cells is a specific differentiation event in response to signaling through the EpoR or whether it is a general response of Ba/F3 cells grown in a factor other than IL-3. To this end, we subcloned the murine GM-CSFRalpha (GMR-alpha ), IL-5Ralpha , and EpoR (shown schematically in Fig 1) into the pLXSN expression vector and introduced them independently into Ba/F3 cells. After neomycin selection, cells were maintained in IL-3 or switched to medium containing GM-CSF (1 ng/mL), IL-5 (1 ng/mL), and Epo (0.5 U/mL), respectively. In all cases, cells proliferated in the new cytokine. Ten days later, total RNA was isolated and probed for beta -globin (Fig 2). As previously reported,10 Ba/F3 cells, as a population, are negative for beta -globin mRNA (lane 1). On occasion, a low background level of beta -globin can be detected in isolated clones, as reflected by some of the transfectants grown in IL-3 (Fig 2) The same low level can be seen in cells transfected with the pLXSN vector alone (data not shown). As expected, growth of Ba/F3-EpoR cells in Epo leads to a high level of beta -globin expression. In contrast, activation of the GM-CSF or IL-5 receptors by their respective ligands results in little or no induction of beta -globin above background. Levels were consistently 10- to 100-fold lower than those observed in cells expressing the EpoR. Identical findings were observed in three independent transfections (data not shown). Northern blot analysis confirmed equivalent amount of the three ectopically expressed receptor chain mRNAs (data not shown) and fluorescence-activated cell sorting (FACS) analysis confirmed surface expression for EpoR and IL-5Ralpha (Fig 3A). Lastly, all three receptors signaled proliferation in a dose dependent fashion and at comparable rates (Fig 4A through C). Thus, the difference in beta -globin expression observed between Ba/F3-EpoR cells and parental or GM-CSF and IL-5 receptor bearing Ba/F3 cells is a specific response to the activation of the EpoR and is not due to gross differences in receptor expression or rates of proliferation, nor can it be attributed to the removal of IL-3 from the growth condition.


View larger version (34K):
[in this window]
[in a new window]
 
Fig 2. Unlike the EpoR, GMR or IL-5R do not signal differentiation in Ba/F3 cells. Ba/F3 cells WT and Ba/F3 cells transfected with the indicated receptor chains EpoR, GMR-alpha , and IL-5Ralpha were grown in IL-3 (0.5 ng/mL) and G418, or in Epo (0.5 U/mL), GM-CSF (1 ng/mL), and IL-5 (1 ng/mL), as shown above each lane. Total RNA was isolated after 10 days, and probed for beta -globin expression. Fifteen micrograms was analyzed in each lane. Loading efficiency was controlled by hybridization of the same blot with a GAPDH probe (shown below).


View larger version (27K):
[in this window]
[in a new window]
 


View larger version (42K):
[in this window]
[in a new window]
 
Fig 3. Expression of transfected wild-type and chimeric receptors but not of endogenous EpoR, GMR-alpha and IL-5Ralpha in Ba/F3 clones. (A) Surface expression of EpoR and E/beta receptors (left-hand side) or IL-5Ralpha and IL-5alpha /beta IL3 receptors (right-hand side). 2 × 105 cells were treated as described in Materials and Methods and processed for FACS analysis. The type of cells and the antibodies used are indicated in each panel. Anti-EpoR antibody: antibody 8866; isotype control 1: polyclonal rabbit antimouse. Anti-IL-5Ralpha antibody: antibody 20H9; isotype control 2: polyclonal rat antimouse IgG2b. A representative sample of 3 independent experiments is shown. (B) Detection of 3' specific EpoR, GMR-alpha , and IL-5Ralpha sequences, respectively. Twenty-five micrograms of total RNA was analyzed in each lane. Probes are described in Materials and Methods. Migration of each protected fragment agrees with the expected size and is indicated by an arrow. Top panel: RNase protection assay for EpoR RNA sequences. M: DNA markers (pBR322 Msp I digest); t: tRNA. WT: Ba/F3 cells; EpoR: Ba/F3-EpoR cells; E/beta : Ba/F3-E/beta cells. Middle panel: RNase protection assay for GMR-alpha RNA sequences. t: tRNA; WT: Ba/F3 cells; GMR-alpha : Ba/F3-GMR-alpha cells; GMER: Ba/F3-GMER cells; GMalpha /beta IL3 : Ba/F3-GMalpha /beta IL3 . Bottom panel: RNase protection assay for IL-5Ralpha RNA sequences. M; DNA markers; t: tRNA; WT: Ba/F3 cells; IL-5Ralpha : Ba/F3-IL-5Ralpha ; IL-5alpha /beta IL3 : Ba/F3-IL-5alpha /beta IL3 .


View larger version (26K):
[in this window]
[in a new window]
 
Fig 4. Dose-response curves of Ba/F3 cell clones. 5 × 104 cells were washed three times in PBS and starved for 6 hours in RPMI 1640 medium containing 10% FCS, and then stimulated with the indicated concentrations of Epo (A), GM-CSF (B), IL-5 (C). After 60 hours, XTT was added and the absorbance at 450 nm determined. RPMI medium was used as a blank. Each experiment was done in triplicates; values shown are means. Identical curves were observed in two other independent experiments.

The difference in beta -globin expression detected between Ba/F3-EpoR, Ba/F3-GMR, and Ba/F3-IL-5R cells was a consistent finding, as multiple clones isolated from independent electroporations were analyzed with identical results. In addition, varying GM-CSF and IL-5 concentrations over a 50-fold range (0.1 to 5 ng/mL) did not affect beta -globin expression by Ba/F3-GMR and Ba/F3-IL-5R cells. This was in contrast to what was observed in Ba/F3-EpoR cells, where lowering Epo concentration enhanced the expression of beta -globin mRNA (data not shown).36 To examine whether introduction of the GMR-alpha chain in Ba/F3 cells followed by growth in GM-CSF might select for a population of cells that have lost the capacity to differentiate, we transfected a cDNA for the GMR-alpha into Ba/F3-EpoR (clone 22) cells,36 which express the EpoR ectopically. Cells were maintained in IL-3 before electroporation and then directly selected in GM-CSF (1 ng/mL). Cells were either maintained in this cytokine, switched back to IL-3 (0.5 ng/mL) or switched to Epo (0.5 U/mL). Cells proliferated well in all three cytokines, with comparable kinetics (data not shown). There was no beta -globin expression when the cells were grown in IL-3 (Fig 5). GM-CSF induced a low level of beta -globin in clone 22-GMR-alpha (Fig 5), which is similar to that observed in Ba/F3 cells transfected with GMR-alpha (Fig 2). However, when clone 22-GMR-alpha cells were grown in Epo, there was a marked increase in beta -globin expression (Fig 5). Therefore, the low level of beta -globin observed in GM-CSF is not because of an inability of these cells to express a high level of beta -globin mRNA, but reflects a minimal degree of differentiation caused by GMR activation.


View larger version (49K):
[in this window]
[in a new window]
 
Fig 5. Inability of GMR-alpha to signal differentiation is not caused by clonal restriction. Clone 22 (Cl 22), a Ba/F3 clone that expresses the EpoR ectopically was transfected with GMR-alpha cDNA (Cl 22-GMR-alpha ). After selection in GM-CSF, cells were replated in IL-3, GM-CSF, and Epo, respectively. RNA was obtained and hybridized with a beta -globin probe as described. Cytokines used to grow cells are indicated above each lane.

Both the Endodomain and Ectodomain of the EpoR Can Signal Proliferation and Differentiation

To identify the region of the EpoR that is critically involved in differentiation, we constructed a series of chimeric receptors diagrammed in Fig 1. The ectodomain of the EpoR was initially fused to the cytoplasmic region of the IL-3Rbeta IL3 chain. cDNA encoding the resulting chimeric receptor (E/beta ) was transfected into Ba/F3 cells, and cells were successfully switched to growth in Epo after a first selection in IL-3 and G418. Ba/F3-E/beta cells proliferated in Epo in a dose-dependent manner with half-maximal growth at three times the concentration required for Ba/F3-EpoR cells (Fig 4A). This concentration is still in the range characteristic of high-affinity binding. Interestingly, E/beta cells expressed a high level of beta -globin mRNA after 10 days in Epo (Fig 6A). Expression of endogenous EpoR mRNA was ruled out by a highly sensitive RNase protection assay. Using a probe encoding a cytoplasmic portion of the EpoR, which is absent in E/beta , no specific protected band arising from expression of endogenous EpoR mRNA was detected. As expected, the same probe protected a specific band of the predicted size in Ba/F3-EpoR cells (Fig 3B). E/beta -receptor expression was confirmed at the RNA level by Northern blot analysis (data not shown) and FACS analysis showed surface expression of the chimeric receptor (Fig 3A). The fact that we can detect two populations that express E/beta at different receptor densities reflects the polyclonal nature of E/beta cells, and was observed in other transfection experiments. Taken together these results indicate that proliferation and differentiation of Ba/F3-E/beta cells are a direct consequence of the activation of the E/beta receptor.


View larger version (37K):
[in this window]
[in a new window]
 
Fig 6. Differentiation of Ba/F3 cells requires the cytoplasmic pairing of two signal transducing receptor chains. (A) RNA (15 µg) from Ba/F3 cells bearing the indicated receptors was analyzed as described in Fig 2. Cell lines and cytokines used for growth are indicated above each lane. beta -Globin and GAPDH signals are shown with closed arrowheads. Abbreviations are as in Figure 3B. (B) beta -Globin expression in IL-3 or GM-CSF (Ba/F3-GMa/beta IL3 ) or in IL-3 and IL-5 (Ba/F3-IL-5a/beta IL3 ). Ba/F3 cells and Ba/F3-EpoR cells are used as a negative and positive control, respectively.

We next examined the role of the EpoR endodomain by constructing a chimeric receptor (GMER) containing the extracellular domain of the GMR-alpha chain fused to the endodomain of the EpoR (Fig 1). As the GMR-alpha chain forms a high-affinity receptor with the beta c chain (which, like beta IL3 , is endogenously expressed in Ba/F3 cells31,37 ) it is likely that GMER associates with beta c on ligand binding. After selection in IL-3 and G418, Ba/F3-GMER cells were switched to GM-CSF and proliferated in a dose dependent fashion identical to Ba/F3-GMR cells (Fig 4B). Importantly, high beta -globin expression was observed in Ba/F3-GMER cells after 10 days in GM-CSF (Fig 6A). While GMER mRNA was highly expressed in these cells (data not shown), no GMR-alpha mRNA could be detected by RNase protection, ruling out expression and activation of a potential endogenous GMR-alpha chain (Fig 3B). These results implied that the EpoR endodomain encodes the critical information necessary for differentiation, even though the E/beta chimera had previously implicated the EpoR ectodomain as being crucial for beta -globin expression. These conflicting results raised an interesting paradox.


View larger version (54K):
[in this window]
[in a new window]
 


View larger version (35K):
[in this window]
[in a new window]
 


View larger version (41K):
[in this window]
[in a new window]
 


View larger version (29K):
[in this window]
[in a new window]
 
Fig 7. Inverse correlation between STAT5 activation and differentiation. Ba/F3 cells bearing the indicated receptors were washed 3 times in PBS, starved for 6 hours in RPMI, and then stimulated with the indicated growth factor for 10 minutes. Nuclear extracts were obtained as described. Electrophoretic mobility shift assays (EMSA) were performed using a beta -casein probe.33 Competition with unlabeled oligonucleotides were done with either the beta -casein probe S or an unrelated nonspecific oligonucleotide (NS). Migration of the specific complex is shown with an arrow. (A) EMSA with nuclear extracts from wild-type Ba/F3 cells, Ba/F3-EpoR, and Ba/F3 E/beta treated as indicated above each lane. (B) EMSA with nuclear extracts from Ba/F3-GMR-alpha and Ba/F3-GMalpha /beta IL3 cells.

(C) EMSA with nuclear extracts from Ba/F3-IL-5Ralpha and Ba/F3-IL-5alpha /beta IL3 cells. (D) EMSA were performed as in (A), in the absence or presence (+) of specific anti-STAT5 (alpha STAT5) or anti-STAT6 (alpha STAT6) antisera.

Erythroid Differentiation in the Absence of Epo and of Its Receptor

To reconcile these experimental data we hypothesized that receptor complexes, which failed to induce differentiation had an intracellular composition of a short alpha -chain paired to a longer, signal transducing beta -chain (eg, IL-3, GM-CSF, and the IL-5 receptors). In contrast, ligand-induced dimerization of two signal transducing receptor chains, supported differentiation (Fig 1). In such cases, intracellular pairing of two EpoR chains (EpoR), two beta IL3 (E/beta ), or of an EpoR and beta c chains (GMER) was equally effective. To test our model, we constructed two additional chimeric receptors. GMalpha /beta IL3 and IL-5alpha /beta IL3 are composed of the ectodomains of the GMR-alpha and IL-5Ralpha chains, respectively, fused to the endodomain of the beta IL3 chain (Fig 1). cDNAs encoding these constructs were transfected into Ba/F3 cells. After selection in IL-3 and G418, cells were successfully switched to GM-CSF or IL-5, respectively. Similar chimerae had been shown previously to form high-affinity receptors in hematopoietic cells by dimerizing with beta c .38,39 Ba/F3 cells expressing GMalpha /beta IL3 and IL-5alpha /beta IL3 were strictly factor-dependent and proliferated either in IL-3, or in the presence of their cognate ligand (GM-CSF or IL-5, respectively). As predicted by our model, growth of Ba/F3-GMalpha /beta IL3 and Ba/F3-IL-5alpha /beta IL3 in GM-CSF or IL-5, respectively, resulted in high beta -globin expression (Fig 6B). Although a higher background of beta -globin expression is detected in Ba/F3-GMalpha /beta IL3 grown in IL-3, expression in GM-CSF is induced in excess of 10-fold when differences in loading are taken into account (as controlled by GAPDH expression). Expression of the chimeric chains was confirmed at the RNA level (data not shown), and surface expression of IL-5alpha /beta IL3 protein was shown by FACS analysis (Fig 3A). As in the case of E/beta cells, two populations of cells bearing different receptor densities were detected. Since we lacked an antibody directed against the ectodomain of the murine GMR-alpha chain, a similar experiment could not be performed with Ba/F3-GMR-alpha , Ba/F3-GMER, and Ba/F3-GMalpha /beta IL3 cells. However, Northern blot analysis confirmed that all three ectopic chains were expressed at similar levels (data not shown). There was no evidence of endogenous GMR-alpha or IL-5Ralpha mRNA in Ba/F3-GMalpha /beta IL3 or IL-5alpha /beta IL3 cells by RNase protection, using probes directed against a specific 3' fragment of the GMR-alpha and IL-5Ralpha chains, respectively. In contrast, these probes protected fragments of the appropriate size in Ba/F3-GMR-alpha and Ba/F3-IL-5Ralpha cells, respectively (Fig 3B). Dose dependent proliferation curves indicate that GMalpha /beta IL3 supports half-maximal growth at a concentration similar to that of wild-type GMR, whereas IL-5alpha /beta IL3 requires a threefold higher concentration of IL-5 than does the IL-5R. A slightly lower affinity for a similar chimera was also observed in another report.39 These results indicate for the first time that differentiation of Ba/F3 cells can be achieved in the absence of Epo or an EpoR, as long as signaling is mediated by a dimer of two signal transducing chains and not by an alpha /beta heterodimer.

Differentiation Correlates With Delayed STAT5 Binding

In an attempt to link downstream signaling events to the differentiation process, we investigated activation of STAT proteins in Ba/F3 cells expressing the various wild-type and chimeric receptors. Cells were grown in IL-3, washed, and starved for 6 hours. At that time, cells were stimulated for 10 minutes with physiological concentrations of either IL-3 or the ligand recognized by the ectopically expressed receptor. Nuclear extracts were prepared and were used in a binding reaction with a beta -casein GAS consensus sequence.33 A distinct complex is detected by the beta -casein probe on IL-3 stimulation of all of the above cell lines. This complex is specific, since it is competed with excess unlabeled beta -casein oligonucleotides but not by unrelated oligonucleotides (Fig 7A through C). Supershift experiments show that the complex is comprised of STAT5 proteins, as it reacts with anti-STAT5 antibody (Fig 7D), but fails to be recognized by antibodies directed against STAT1-4 (data not shown) or against STAT6 (Fig 7D). Stimulation of cells expressing the wild-type GMR or IL-5R with their respective cytokine leads to the same high level binding of STAT5 complex. In contrast, a 10-minute stimulation of any receptor capable of mediating differentiation (EpoR, E/beta , GMalpha /beta IL3 , IL-5alpha /beta IL3 ) fails to fully activate STAT5 binding (Fig 7A through C). This difference can not be accounted by differences in nuclear protein concentration as an Oct-1 specific probe bound the same amount of Oct-1 complex in our nuclear extracts (data not shown). A time course experiment was performed with Ba/F3-EpoR cells and Ba/F3-IL-5alpha /beta IL3 cells. Cells were stimulated either with IL-3 (0.5 ng/mL) and Epo (0.5 U/mL) (Fig 8A), or with IL-3 and IL-5 (1 ng/mL) (Fig 8B). Electrophoretic mobility shift assay performed with the beta -casein probe revealed that STAT5 activation in Ba/F3-EpoR is significantly delayed on Epo stimulation (Fig 8A) compared to IL-3 stimulation. A similar delay was observed in Ba/F3-IL-5alpha /beta IL3 cells on IL-5 stimulation (Fig 8B). This delay was observed whether the cells were maintained in Epo (Ba/F3-EpoR), IL-5 (Ba/F3-IL-5alpha /beta IL3 ), or IL-3 containing medium before starvation. Interestingly, when supraphysiological concentrations of Epo (10 U/mL) or IL-5 (10 ng/mL) were used, beta -globin expression was dramatically decreased and the delay in STAT5 activation was abrogated (data not shown).


View larger version (29K):
[in this window]
[in a new window]
 
Fig 8. Time course of STAT5 binding in Ba/F3-EpoR and Ba/F3 -IL-5alpha /beta IL3 cells. (A) Ba/F3-EpoR cells were maintained in Epo (0.5 U/mL) washed 3× in PBS and starved for 6 hours in RPMI medium containing 10% FCS. Cells were then stimulated with either IL-3 (0.5 ng/mL) or Epo (0.5 U/mL) for the indicated period of time (1 × 107 cells per time point). Nuclear extracts were obtained and used for an EMSA with a beta -casein probe as described in Materials and Methods. (B) Ba/F3-IL-5alpha /beta IL3 were maintained in IL-5 (1 ng/mL) and treated as above. Stimulation was performed with either IL-3 (0.5 ng/mL) or IL-5 (1 ng/mL).

    DISCUSSION
Abstract
Introduction
Methods
Results
Discussion
References

Proliferation and differentiation of hematopoietic progenitor cells are promoted by activation of hematopoietic receptors by their respective ligands. To preserve specificity in these responses, receptors are likely to encode unique features that distinguish them functionally from one another. Here, we show that the ability of the EpoR to signal limited differentiation in Ba/F3 cells is not shared by other wild-type hematopoietic receptors like the IL-3, GM-CSF, and IL-5 receptors, even though these receptors are fully mitogenic in these cells. To determine what was unique about the EpoR, chimeric receptors were designed to test the role of the extracellular and cytoplasmic regions of the EpoR in supporting both growth and differentiation. The E/beta chimera, in which the endodomain of the EpoR was replaced by the corresponding beta IL3 receptor cytoplasmic chain behaved identically to the wild-type EpoR and retained the ability to induce beta -globin. This finding confirmed our previously published report describing similar chimeric EpoR mutants.12 Taken together, these results suggested that the EpoR ectodomain was a critical region for differentiation. Although important, the extracellular domain of the EpoR is not sufficient on its own unless it is coupled to a signal transducing cytoplasmic receptor unit. Indeed, truncation mutants of EpoR without its cytoplasmic region, or a chimera containing the EpoR ectodomain fused to the cytoplasmic region of GMR-alpha lack mitogenic and differentiating activities2 (data not shown).

If differentiation mapped to the ectodomain of the EpoR, what was then the function of the cytoplasmic portion of the EpoR? In our earlier study,12 this question had not been addressed. However, Maruyama et al14 had shown that a chimeric receptor carrying the extracellular domain of the epidermal growth factor (EGF ) receptor linked to the cytoplasmic domain of EpoR signaled both proliferation and erythroid differentiation of the leukemic cell line TSA8 in response to EGF. Likewise, when we replaced the EpoR ectodomain by the GMR-alpha chain (GMER), this receptor was equivalent to wild-type EpoR or E/beta in inducing differentiation. This raised the following conundrum: one set of experiments identified the extracellular domain of the EpoR as a region necessary, but not sufficient for differentiation; another found the cytoplasmic region to be responsible for differentiation. This apparent paradox had been raised previously.11,14 Although it had created considerable interest, it had not been resolved, in part because of a controversy over low level expression of endogenous EpoR in the studies of Chiba et al.11

A closer look at the predicted composition of the various receptor complexes suggested a unifying model. Receptors consisting of an alpha beta heterodimer only allowed proliferation of Ba/F3 cells. On the other hand, receptor complexes characterized by an association of two signal transducing chains in the cytoplasm, or alternatively, by the lack of an alpha -chain in the receptor complex, supported both cell growth and differentiation. This model made no obligate reference to having any part of the EpoR in the differentiation of Ba/F3 cells as long as the necessary structural requirements were met. Our model was confirmed with the chimeric receptors GMalpha /beta IL3 and IL-5alpha /beta IL3 . Both receptors fulfill the postulated requirements and lack any part of the EpoR (Fig 1). Importantly, they induce high beta -globin expression indicating that they are differentiation competent. When expressed in Ba/F3 cells, GMalpha /beta IL3 , and IL-5alpha /beta IL3 subunits associate with the endogenous beta c chain in the presence of GM-CSF and IL-5, consistent with the dose responsiveness of these cells to the two cytokines (Fig 4). This association was independently confirmed by others. A similar IL-5Ralpha /beta chimera was shown to coprecipitate with beta c in the presence of IL-5,39 while a human GMR-alpha /beta chimeric receptor required coexpression of human beta c in Ba/F3 cells for high-affinity binding of human GM-CSF.38

Removal of IL-3 from the medium has been described to trigger differentiation of Ba/F3-EpoR cells by impairing proliferation.40 This argument does not apply to our chimeric receptors since all experiments for differentiation were performed at saturating doses of cytokines. Thus, differentiation in Ba/F3 cells is not the result of a defect in proliferative potential, nor can it be attributed to dimerization and activation of endogenous EpoR induced by the Epo in the serum. Rather it is a specific outcome dictated by the growth factor receptor complex.

Although our data support a direct role for receptors in signaling differentiation, the cellular milieu in which they are acting is also critical. We have previously observed that the IL-2-dependent T-cell line CTLL can proliferate in Epo after introduction of the EpoR, but shows no sign of beta -globin production even after prolonged growth in Epo.10 It is likely that Ba/F3 cells are precommitted, or at least predisposed, to undergo erythroid differentiation. Therefore, cytokine receptors, as long as they meet certain structural requirements, may have the function of enabling progenitor cells to complete genetic programs already in place. It is tempting to speculate that receptors may have different effects depending on the array of transcription factors expressed at the time of receptor activation. Therefore, specificity and cellular fate in vivo may be achieved by carefully regulating the expression of a receptor both in a temporal and lineage-specific manner.

Our experiments indicate that functional distinctions exist between receptors that form homodimers (eg, EpoR) and those that form alpha beta heterodimers (eg, IL-3R, GMR, and IL-5R). To understand how two signal transducing chains might act differently from an alpha /beta heterodimer, we attempted to link downstream signaling events to the process of differentiation. A newly described class of signaling proteins, STATs, has gained much attention. Receptor-mediated activation leads to phosphorylation and translocation of STAT proteins to the nucleus where they serve as transcription activators. Recently, activation of STAT5 has been reported in hematopoietic cells after binding of IL-2, IL-3, GM-CSF, IL-5, and Epo to their receptors,19,20,22,23,41,42 and correlated with proliferation in response to the various cytokines.5 Our data confirm that STAT5 can be activated by these cytokines in Ba/F3 cells; however, with a notable difference. Among the wild-type receptors, the EpoR was unique in that it induced no or much less of the activated STAT5 complex after a 10 minute stimulation. This dramatic decrease in early STAT5 binding was also observed after stimulation of the E/beta , the GMR-alpha /beta IL3 and IL-5alpha /beta IL3 receptors with their respective ligands. Thus, diminished STAT5 binding at 10 minutes correlates with differentiation. Additionally, early STAT5 activation provides another assay for the ability of receptors to support differentiation of Ba/F3 cells. Using high-affinity probes for STAT1 and 3,34,43 and for STAT6,44 no discernible pattern of activation emerged for these transcription factors that could be linked to either proliferation or differentiation (data not shown). Thus, STAT 1, 3, and 6 are less likely to be involved in differentiation of Ba/F3 cells. The striking differences in STAT5 activation were most pronounced after a 10-minute stimulation. However, at later time points in Epo and IL-5, respectively, (20 and 30 minutes) the EpoR and IL-5alpha /beta IL3 receptors were also capable of inducing STAT5 binding, albeit to a lesser extent than after IL-3 stimulation (Fig 8). This delay can not be explained by impaired signaling by chimeric receptors, since activation of wild-type EpoR shows the same kinetics of STAT5 binding. Whether the delay in STAT5 activation influences the fate of a cell to choose between proliferation and differentiation can not be answered at this point and will be an area of future investigation. However, recent evidence suggests that erythroid differentiation of an erythroleukemic cell line correlates with impaired function of STAT5 in response to Epo.45 Therefore, it is possible that the strength or the timing of the STAT5 signal may be important determinants in choosing between proliferation and differentiation. Neuronal differentiation offers an interesting parallel. Nerve growth factor (NGF ), which causes neuronal differentiation of PC12 cells, leads to a sustained activation of the mitogen-activated protein kinase cascade. In contrast to NGF, EGF induces proliferation of PC12 cells only, and leads to the transient activation of the same cascade.46

In conclusion, our data support an enabling role for the EpoR in erythroid differentiation in an appropriate cellular environment. They further define the necessary structural requirements for differentiation at the receptor level and show that by complying with these requirements, the EpoR can be replaced by other receptors without a loss of differentiation capacity. An intriguing interpretation of our results is to propose an important role for the alpha -chain in preventing differentiation and promoting full STAT5 activation, rather than attribute differentiation and the delay of STAT5 activation to the presence of a second signal transducing receptor chain. Indeed, Krosl et al47 have reported that Epo-induced differentiation of Ba/F3 cells can be blocked by an interfering IL-3Ra chain.47 Finally, our results support a direct link between differentiation signals in hematopoiesis and the STAT pathway.

    FOOTNOTES

   Submitted September 23, 1996; accepted December 12, 1996.
   Supported in part by National Institutes of Health Grant No. 2P01 HL32262 (Bethesda, MD). M.P. is a recipient of fellowships by the Swiss National Research Foundation, by the Cantonal Cancer Leagues of Basel and Solothurn, and by the Margarete and Walther Lichtenstein Foundation. K.N. is a recipient of a Fulbright Scholarship and of a D. Collen Research Foundation fellowship. M.C. is a recipient of a fellowship by the American Cancer Society. B.M.-P. receives partial support from Genetics Institute.
   Address reprint requests to Miklos Pless, MD, Dana-Farber Cancer Institute, Division of Pediatric Oncology, 44 Binney St, Boston, MA 02115.

   The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hearly marked ``advertisment'' in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

    ACKNOWLEDGMENT

We thank E.C. TePas for her contribution in cloning the murine GMR-alpha cDNA. We are also indebted to Dr Tavernier and his group for their generosity in providing us with both murine IL-5R cDNA and monoclonal antibody against the IL-5Ralpha chain. We thank Dr David Nathan for his support, his thoughtful insights, and for his critical reading of our manuscript.

    REFERENCES
Abstract
Introduction
Methods
Results
Discussion
References

1. Kuramochi S, Ikawa Y, Todokoro K: Characterization of murine erythropoietin receptor genes. J Mol Biol 216:567, 1990[Medline] [Order article via Infotrieve]

2. D'Andrea AD, Yoshimura A, Youssoufian H, Zon LI, Koo J-W, Lodish HF: The cytoplasmic region of the erythropoietin receptor contains nonoverlapping positive and negative growth regulatory domains. Mol Cell Biol 11:1980, 1991[Abstract/Free Full Text]

3. Miura O, D'Andrea AD, Kabat D, Ihle JN: Induction of tyrosine phosphoryation by the erythropoietin receptor correlates with mitogenesis. Mol Cell Biol 11:4895, 1991[Abstract/Free Full Text]

4. Wu H, Klingmüller U, Besmer P, Lodish HF: Interaction of the erythropoietin and stem-cell-factor receptors. Nature 377:242, 1995[Medline] [Order article via Infotrieve]

5. Damen JE, Wakao H, Miyajima A, Krosl J, Humphries RK, Cutler RL, Krystal G: Tyrosine 343 in the erythropoietin receptor positively regulates erythropoietin-induced cell proliferation and Stat5 activation. EMBO J 14:5557, 1995[Medline] [Order article via Infotrieve]

6. Dubart A, Feger F, Lacout C, Goncalves F, Vainchenker W, Dumenil D: Murine pluripotent hematopoietic progenitors constitutively expressing a normal erythropoietin receptor proliferate in response to to erythropoietin without preferential erythroid cell differentiation. Mol Cell Biol 14:4834, 1994[Abstract/Free Full Text]

7. Nishijima I, Nakahata T, Hirabayashi Y, Inoue T, Kurata H, Miyajima A, Hayashi N, Iwakura Y, Arai K-i, Yokota T: A human GM-CSF receptor expressed in transgenic mice stimulates proliferation and differentiation of hematopoietic progenitors to all lineages in response to human GM-CSF. Mol Biol Cell 6:497, 1995[Abstract]

8. Palacios R, Steinmetz M: IL-3-dependent mouse clones that express B-220 antigen, contain Ig genes in germ-line configuration and generate B lymphocytes in vivo. Cell 41:727, 1985[Medline] [Order article via Infotrieve]

9. Mathey-Prevot B, Nabel G, Palacios R, Baltimore D: Abelson virus abrogation of interleukin-3 dependence in a lymphoid cell line. Mol Cell Biol 6:4133, 1986[Abstract/Free Full Text]

10. Liboi E, Carroll M, D'Andrea AD, Mathey-Prevot B: Erythropoietin receptor signals both proliferation and erythroid-specific differentiation. Proc Natl Acad Sci USA 90:11351, 1993[Abstract/Free Full Text]

11. Chiba T, Nagata Y, Kishi A, Sakamaki K, Miyajima A, Yamamoto M, Engel JD, Todokoro K: Induction of erythroid-specific gene expression in lymphoid cells. Proc Natl Acad Sci USA 90:11593, 1993[Abstract/Free Full Text]

12. Carroll M, Mathey-Prevot B, D'Andrea AD: Differentiation domains of the erythropoietin receptor. Proc Soc Exp Biol Med 206:289, 1994[Medline] [Order article via Infotrieve]

13. Chiba T, Nagata Y, Machide M, Kishi A, Amanuma H, Sugiyama M, Todokoro K: Tyrosine kinase activation through the extracellular domains of cytokine receptors. Nature 362:646, 1993[Medline] [Order article via Infotrieve]

14. Maruyama K, Miyata K, Yoshimura A: Proliferation and erythroid differentiation through the cytoplasmic domain of the erythropoietin receptor. J Biol Chem 269:5976, 1994[Abstract/Free Full Text]

15. Dusanter-Fourt INC, Lacombe C, Muller O, Billat C, Fischer S, Mayeux P: Erythropoietin induces the tyrosine phosphorylation of its own receptor in human erythropoietin-responsive cells. J Biol Chem 267:10670, 1992[Abstract/Free Full Text]

16. Quelle FW, Wojchowski DM: Proliferative action of erythropoietin is associated with rapid protein tyrosine phosphorylation in responsive B6SUt.EP cells. J Biol Chem 266:609, 1991[Abstract/Free Full Text]

17. Ihle JN, Kerr IA: Jaks and Stats in signaling by the cytokine receptor superfamily. Trends Genet 11:69, 1995[Medline] [Order article via Infotrieve]

18. Witthuhn BA, Quelle FW, Silvennoinen O, Yi T, Tang B, Miura O, Ihle JN: JAK2 associates with the erythropoietin receptor and is tyrosine phosphorylated and activated following stimulation with erythropoietin. Cell 74:227, 1993[Medline] [Order article via Infotrieve]

19. Gouilleux F, Pallard C, Dusanter-Fourt I, Wakao H, Haldosen L-A, Norstedt G, Levy D, Groner B: Prolactin, growth hormone, erythropoietin and granulocyte-macrophage colony stimulating factor induce MGF-Stat5 DNA binding activity. EMBO J 14:2005, 1995[Medline] [Order article via Infotrieve]

20. Pallard C, Gouilleux F, Charon M, Groner B, Gisselbrecht S, Dusanter-Fourt I: Interleukin-3, erythropoietin, and prolactin activate a STAT5-like factor in lymphoid cells. J Biol Chem 270:15942, 1995[Abstract/Free Full Text]

21. Quelle FW, Sato N, Witthuhn BA, Inhorn RC, Eder M, Miyajima A, Griffin JD, Ihle JN: JAK2 associates with the beta c chain of the receptor for granulocyte-macrophage colony-stimulating factor, and its activation requires the membrane-proximal region. Mol Cell Biol 14:4335, 1994[Abstract/Free Full Text]

22. Azam M, Erdjument-Bromage H, Kreider BL, Xia M, Quelle F, Basu R, Saris C, Tempst P, Ihle JN, Schindler C: Interleukin-3 signals through multiple isoforms of Stat5. EMBO J 14:1402, 1995[Medline] [Order article via Infotrieve]

23. Mui AL-F, Wakao H, O'Farrell A-M, Harada N, Miyajima A: Interleukin-3, granulocyte-macrophage colony stimulating factor and interleukin-5 transduce signals through two STAT5 homologs. EMBO J 14:1166, 1995[Medline] [Order article via Infotrieve]

24. Wakao H, Harada N, Kitamura T, Mui AL-F, Miyajima A: Interleukin 2 and erythropoietin activate STAT5/MGF via distinct pathways. EMBO J 14:2527, 1995[Medline] [Order article via Infotrieve]

25. Fenghao X, Saxon A, Nguyen A, Ke Z, Diaz-Sanchez D, Nel A: Interleukin 4 activates a signal transducer and activator of transcription (Stat) protein which interacts with an interferon-gamma activation site-like sequence upstream of the IE exon in a human B cell line. J Clin Invest 96:907, 1995

26. D'Andrea AD, Lodish HF, Wong GG: Expression cloning of the murine erythropoietin receptor. Cell 57:277, 1989[Medline] [Order article via Infotrieve]

27. Itoh N, Yonehara S, Schreurs J, Gorman DM, Maruyama K, Ishii A, Yahara I, Arai K, Miyajima A: Cloning of an Interleukin 3 receptor gene: A member of a distinct receptor gene family. Science 274:324, 1990[Free Full Text]

28. Horton MR, Cai Z, Ho SN, Pease LR: Gene splicing by overlap extension: Tailor-made genes using the polymerase chain reaction. Biotechniques 8:528, 1990[Medline] [Order article via Infotrieve]

29. Devos R, Plaetinck G, Van der Heyden J, Cornelis S, Vanderkerckhove J, Fiers W, Tavernier J: Molecular basis of a high affinity interleukin-5 receptor. EMBO J 10:2133, 1991[Medline] [Order article via Infotrieve]

30. Miller AD, Rosman GJ: Improved retroviral vectors for gene transfer and expression. Biotechniques 7:980, 1989[Medline] [Order article via Infotrieve]

31. Liboi E, Jubinsky P, Andrews NC, Nathan DG, Mathey-Prevot B: Enhanced expression of interleukin-3 and granulocyte-macrophage colony-stimulating factor receptor subunits in murine hematopoietic cells stimulated with hematopoietic growth factors. Blood 80:1183, 1992[Abstract/Free Full Text]

32. Andrews NC, Faller DV: A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acid Res 19:2499, 1991[Free Full Text]

33. Zhang X, Blenis J, Li H-C, Schindler C, Chen-Kiang S: Requirement of serine phosphorylation for formation of STAT-promoter complexes. Science 267:1990, 1995[Abstract/Free Full Text]

34. Wen Z, Zhong Z, Darnell JE Jr: Maximal activation of transcription by Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell 82:241, 1995[Medline] [Order article via Infotrieve]

35. Wagner BJ, Hayes TE, Hoban CJ, Cochran BH: The SIF binding element confers sis/PDGF inducibility onto the c-fos promoter. EMBO J 9:4477, 1990[Medline] [Order article via Infotrieve]

36. Carroll M, Zhu Y, D'Andrea AD: Erythropoietin-induced cellular differentiation requires prolongation of the G1 phase of the cell cycle. Proc Natl Acad Sci USA 92:2869, 1995[Abstract/Free Full Text]

37. Park LS, Martin U, Sorensen R, Luhr S, Morrissey PJ, Cosman D, Larsen A: Cloning of the low-affinity murine granulocyte-macrophage colony-stimulating factor receptor and reconstitution of a high-affinity receptor complex. Proc Natl Acad Sci USA 89:4295, 1992[Abstract/Free Full Text]

38. Muto A, Watanabe S, Miyajima A, Yokota T, Arai K-i: High affinity chimeric human granulocyte-macrophage colony stimulating factor receptor carrying the cytoplasmic domain of the beta subunit but not the a subunit transduces growth promoting signals in Ba/F3 cells. Biochem Biophys Res Comm 208:368, 1995[Medline] [Order article via Infotrieve]

39. Takaki S, Kanazawa H, Shiiba M, Takatsu K: A critical cytoplasmic domain of the interleukin-5 (IL-5) receptor alpha chain and its function in IL-5-mediated growth signal transduction. Mol Cell Biol 14:7404, 1994[Abstract/Free Full Text]

40. Krosl J, Damen JE, Krystal G, Humphries RK: Erythropoietin and interleukin-3 induce distinct events in erythropoietin receptor-expressing BA/F3 cells. Blood 85:50, 1995[Abstract/Free Full Text]

41. Hou J, Schindler U, Henzel WJ, Wong SC, McKnight SL: Identification and purification of human Stat proteins activated in response to interleukin-2. Immunity 2:321, 1995[Medline] [Order article via Infotrieve]

42. Lin J-X, Migone T-S, Tsang M, Friedmann M, Weatherbee JA, Zhou L, Yamauchi A, Bloom ET, Mietz J, John S, Leonard WJ: The role of shared receptor motifs and common Stat proteins in the generation of cytokine pleiotropy and redundancy by IL-2, IL-4, IL-7, IL-13, and IL-15. Immunity 2:331, 1995[Medline] [Order article via Infotrieve]

43. Hu H, Liu X, Jaenisch R, Lodish HF: Generation of committed erythroid BFU-E and CFU-E progenitors does not require erythropoietin or the erythropoietin receptor. Cell 83:59, 1995[Medline] [Order article via Infotrieve]

44. Yoshikawa A, Murakami H, Nagata S: Distinct signal transduction through the tyrosine-containing doamins of the granulocyte colony-stimulating factor receptor. EMBO J 14:5288, 1995[Medline] [Order article via Infotrieve]

45. Chrétien S, Varlet P, Verdier F, Gobert S, Cartron J-P, Gisselbrecht S, Mayeux P, Lacombe C: Erythropoietin-induced erythroid differentiation of the human erythroleukemia cell line TF-1 correlates with impaired STAT5 activation. EMBO J 15:4174, 1996[Medline] [Order article via Infotrieve]

46. Traverse S, Gomez N, Paterson M, Marshall C, Cohen P: Sustained activation of the mitogen-activated protein (MAP) kinase cascade may be required for diffrentiation of PC12 cells. Comparison of the effect of nerve growth factor and epidermal growth factor. Biochem J 288:351, 1992

47. Krosl J, Damen JE, Krystal G, Humphries RK: Interleukin-3 (IL-3) inhibits erythropoietin-induced differentiation in Ba/F3 cells via the IL-3 receptor alpha subunit. J Biol Chem 271:27432, 1996[Abstract/Free Full Text]


© 1997 by The American Society of Hematology.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Biol. Reprod.Home page
M. Nakasato, Y. Shirakura, M. Ooga, M. Iwatsuki, M. Ito, S.-i. Kageyama, S. Sakai, M. Nagata, and F. Aoki
Involvement of the STAT5 Signaling Pathway in the Regulation of Mouse Preimplantation Development
Biol Reprod, October 1, 2006; 75(4): 508 - 517.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
M. E. Stearns, M. Wang, Y. Hu, and F.U. Garcia
Interleukin-10 Activation of the Interleukin-10E1 Pathway and Tissue Inhibitor of Metalloproteinase-1 Expression Is Enhanced by Proteasome Inhibitors in Primary Prostate Tumor Lines
Mol. Cancer Res., July 1, 2003; 1(9): 631 - 642.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Fujio, T. Nosaka, T. Kojima, T. Kawashima, T. Yahata, N. G. Copeland, D. J. Gilbert, N. A. Jenkins, K. Yamamoto, T. Nishimura, et al.
Molecular cloning of a novel type 1 cytokine receptor similar to the common gamma chain
Blood, April 1, 2000; 95(7): 2204 - 2210.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. A. Qureshi, R. M. Kim, Z. Konteatis, D. E. Biazzo, H. Motamedi, R. Rodrigues, J. A. Boice, J. R. Calaycay, M. A. Bednarek, P. Griffin, et al.
Mimicry of erythropoietin by a nonpeptide molecule
PNAS, October 12, 1999; 96(21): 12156 - 12161.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. Chida, O. Miura, A. Yoshimura, and A. Miyajima
Role of Cytokine Signaling Molecules in Erythroid Differentiation of Mouse Fetal Liver Hematopoietic Cells: Functional Analysis of Signaling Molecules by Retrovirus-Mediated Expression
Blood, March 1, 1999; 93(5): 1567 - 1578.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. Stoffel, S. Ziegler, N. Ghilardi, B. Ledermann, F. J. de Sauvage, and R. C. Skoda
Permissive role of thrombopoietin and granulocyte colony-stimulating factor receptors in hematopoietic cell fate decisions in vivo
PNAS, January 19, 1999; 96(2): 698 - 702.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. W. Harris, X.-J. Hu, S. Schultz, M. O. Arcasoy, B. G. Forget, and N. Clare
The Distal Cytoplasmic Domain of the Erythropoietin Receptor Induces Granulocytic Differentiation in 32D Cells
Blood, August 15, 1998; 92(4): 1219 - 1224.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Matsuguchi, M. B. Lilly, and A. S. Kraft
Cytoplasmic Domains of the Human Granulocyte-Macrophage Colony-stimulating Factor (GM-CSF) Receptor beta  Chain (hbeta c) Responsible for Human GM-CSF-induced Myeloid Cell Differentiation
J. Biol. Chem., July 31, 1998; 273(31): 19411 - 19418.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. A. Goldsmith, A. Mikami, Y. You, K. D. Liu, L. Thomas, P. Pharr, and G. D. Longmore
Absence of cytokine receptor-dependent specificity in red blood cell differentiation in vivo
PNAS, June 9, 1998; 95(12): 7006 - 7011.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. A. Callus and B. Mathey-Prevot
Interleukin-3-Induced Activation of the JAK/STAT Pathway Is Prolonged by Proteasome Inhibitors
Blood, May 1, 1998; 91(9): 3182 - 3192.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pless, M.
Right arrow Articles by Mathey-Prevot, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pless, M.
Right arrow Articles by Mathey-Prevot, B.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1997 by American Society of Hematology         Online ISSN: 1528-0020