Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Said, J. W.
Right arrow Articles by Berenson, J. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Said, J. W.
Right arrow Articles by Berenson, J. R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 90 No. 11 (December 1), 1997: pp. 4278-4282

RAPID COMMUNICATION

Localization of Kaposi's Sarcoma-Associated Herpesvirus in Bone Marrow Biopsy Samples From Patients With Multiple Myeloma

By Jonathan W. Said, Matthew R. Rettig, Karen Heppner, Robert A. Vescio, Gary Schiller, Hong J. Ma, Daniel Belson, Alison Savage, I. Peter Shintaku, H. Phillip Koeffler, Hiroya Asou, Geraldine Pinkus, Jack Pinkus, Matthew Schrage, Eric Green, and James R. Berenson

From the Departments of Pathology and Medicine, the Division of Hematology/Oncology, UCLA School of Medicine, Veterans Affairs West Los Angeles Medical Center; Cedars Sinai Medical Center, Los Angeles, CA; and Brigham and Woman's Hospital, Harvard Medical School, Boston, MA.


    ABSTRACT
Abstract
Introduction
Methods
Results
Discussion
References

We have recently demonstrated the presence of Kaposi's sarcoma-associated herpesvirus (KSHV) in cultured bone marrow (BM) stromal dendritic cells from all patients with myeloma studied. To show that these findings were not an artifact of tissue culture, we performed in situ hybridization (ISH) and polymerase chain reaction (PCR) to detect KSHV in BM core biopsies. Using ISH to open reading frame-72 (ORF 72), we localized KSHV to BM dendritic cells in 17 of 20 patients with myeloma, 2 patients with plasmacytosis associated with the acquired immunodeficiency syndrome, and 1 case of aplastic anemia. In contrast, BM from normal subjects (n = 4) and patients with lymphoma and leukemia (n = 21) did not contain KSHV. PCR amplification with KSHV primers demonstrated product in fresh BM biopsy samples from 6 of 7 myeloma patients, whereas three normal marrows contained no amplified product. These findings suggest that KSHV, possibly through alterations in the BM microenvironment and production of viral interleukin-6 (vIL-6), may stimulate and maintain abnormal plasma cell proliferation in myeloma and related disorders.

    INTRODUCTION
Abstract
Introduction
Methods
Results
Discussion
References

SINCE THE DISCOVERY of Kaposi's sarcoma-associated herpesvirus (KSHV),1 this virus has been shown to be associated with human disease including Kaposi's sarcoma, systemic Castleman's disease, and primary effusion lymphoma (PEL).2-11 In Kaposi's sarcoma and PEL, KSHV has been localized to the malignant cells.8,11,12 The exact role the virus plays in these diseases, as well as the range of cells infected with the virus, remains to be elucidated. However, a causative role for KSHV is suggested by serologic data, which showed that seroconversion to positivity for antibodies against KSHV-related nuclear antigens occurs before the clinical appearance of Kaposi's sarcoma.13

The cytokine interleukin-6 (IL-6) is an important growth factor for myeloma, and a biologically active homolog to human IL-6 termed vIL-6 has been identified in the KSHV genome.14 Bone marrow (BM) stromal cells contribute to the BM microenvironment by direct cell contact, and these cells produce cytokines including IL-6 which play a major role in the paracrine stimulation of tumor cell growth in patients with myeloma.15-19 We previously have detected KSHV DNA as well as vIL-6 RNA transcripts in cultured BM dendritic cells from all myeloma patients studied.20 In that report, the dendritic cells were purified by tissue culture techniques. The possibility exists that the identification of KSHV in BM dendritic cells of myeloma patients was an artifact of cell culture. In addition, the frequency of virally infected cells in fresh BM could not be determined on these cultured cells. Thus, we used ISH and PCR to determine the frequency of patients with myeloma and plasmacytosis associated with the acquired immunodeficiency syndrome containing KSHV-infected BM cells in fresh core biopsies.

    MATERIALS AND METHODS
Abstract
Introduction
Methods
Results
Discussion
References

BM biopsy samples from 20 cases of multiple myeloma were obtained from the Hematopathology Division of UCLA Center for the Health Sciences. The frequency of plasma cells in the marrow samples varied from less than 5% in 9 patients in remission, to 100%. In addition, BM biopsy samples from 2 patients with acquired immunodeficiency syndrome (AIDS) and plasmacytosis, 4 cases of aplastic anemia, and 21 patients with lymphoma and leukemia were studied. The patients studied with lymphoma and leukemia included 6 individuals with large cell lymphoma, 5 with small cleaved cell lymphoma, 1 with immunoblastic lymphoma, 1 with lymphoblastic lymphoma, 1 with Burkitt's lymphoma, 3 with marginal zone lymphoma, 1 with small lymphocytic lymphoma/leukemia, 2 with Hodgkin's disease, and 1 with acute myelogenous leukemia. Seven normal BMs from patients without neoplastic disease were also studied. Samples were obtained after informed consent and in compliance with the Human Subjects Protection Committee.

Preparation of probes. Biotinylated probes to ORF-72 were prepared with the following sequences: Sense probe to open reading frame-72 (ORF 72) 5' to 3' GAGAACCTGACAGAGCACCC; anti-sense probe to ORF 72 CGCCCTAAACAAAATCACAA. Positive control probe to determine suitability of fixed samples for ISH consisted of a commercial biotinylated probe to total genomic DNA of cultured human cells (DAKO Corp, Carpinteria, CA). Two negative control probes (plasmid DNA) were prepared from the plasmid vector pUC18 (DAKO) and PCR 2.1 (Invitrogen, San Diego, CA). Additional probes made against sequences of human papillomavirus E6-S DNA were also used as negative controls (primers TAGAATGTGTGTACTGCAAG and TGATTACAGCTGGGTTTCTC).

ISH for KSHV. BM biopsy samples were fixed in formalin or B5, deparaffinized, and immersed in 3% hydrogen peroxide in methanol for 10 minutes. ISH was performed using modifications of methods previously described.20,21 Proteinase K solution (5 µg/mL) (GIBCO, Grand Island, NY) was applied to each section, and sections were incubated in a 37°C water bath humidity chamber for 10 minutes and washed with distilled water. KSHV probe (50 µg/µL) was diluted to 1:300, and 60 µL was applied to each slide and covered with a coverslip. Slides were placed on a metal plate in a water bath (surface temperature of the plate 95°C) for 5 minutes and then in 37°C water bath humidity chamber overnight (approximately 16 hours). The slides were then washed in 0.05 mol/L Tris-buffered saline (TBS), pH 7.4, followed by 0.2% sodium dodecyl sulfate (SDS). The DNA following hybridization wash was exposed to a 20-minute incubation at 37°C in 50% (vol/vol) deionized formamide (Sigma, St Louis, MO), containing 2X standard saline citrate (SSC). Slides were washed in TBS and rinsed with TBS-Tween (20 µL Tween-20 per liter of TBS) (TBST) for 3 minutes. To detect the ISH signal, we used tryamide signal amplification indirect for ISH (TSA-indirect kit; NEN Life Sciences, Boston, MA). Blocking step consisted of incubation of slides with TNB blocking buffer for 30 minutes. Slides were then incubated with streptavidin-conjugated horseradish peroxidase (streptavidin-HRP) 1:100 for 30 minutes followed by biotinyl tyramide solution 1:50 for 10 minutes, and secondary incubation with streptavidin-HRP 1:100 for 30 minutes. Reaction product was localized with the diaminobenzidine reaction and counterstained with Mayer's hematoxylin (DAKO). The probe was diluted in 10% (vol/vol) 20× SSC, 10% (vol/vol) Denhardt's solution, 2.5% (vol/vol) salmon testes DNA (10 mg/mL) (Sigma D-9156), 5% (vol/vol) yeast tRNA (10 mg/mL) (Sigma R-8508), and 50% (vol/vol) deioinized formamide (Sigma), 22.5% sterile water, with 10% (wt/vol) dextran sulfate (Sigma). Positive controls consisted of KS-1 cells productively infected with KSHV which showed strong nuclear and cytoplasmic localization of the ORF 72 probe.8,20 Negative controls consisted of cultured HL60 cells that did not contain virus. Both positive and negative control cultures were fixed in 10% neutral buffered formalin and embedded in paraffin. Slides were interpreted by two of the investigators (J.W.S. and K.H.) without knowledge of the histologic diagnosis or treatment status of the patients.

 
View this table:
[in this window] [in a new window]
 
Table 1. ISH for KSHV


View larger version (104K):
[in this window]
[in a new window]
 
Fig 1. BM biopsy sample from patient with myeloma with in situ hybridization for KSHV ORF 72. Biotin-labeled probe is localized to BM stromal cells (arrowheads, brown) (left). Immunohistochemical stain for fascin (red) shows a similar distribution of BM dendritic cells within the stroma (right). Hematoxylin counterstain; original magnification × 400.

Polymerase chain reaction (PCR) of BM biopsy specimens. For PCR studies, fresh BM core biopsy samples were available from 7 patients with myeloma (5 also studied by ISH) and 3 normal subjects. A mortar and pestle were autoclaved and then treated with DNA Away (Molecular Bio-Products, San Diego, CA) to remove any contaminating DNA or deoxyribonuclease. The BM core biopsy specimens were macerated, and DNA was extracted using the Easy DNA kit (Invitrogen) per the manufacturer's instructions. PCR on DNA from BM core biopsy samples was then performed with KS 330233-specific primers as previously described.20

Immunohistochemical staining for fascin. Immunohistochemical staining for fascin, a dendritic cell marker, was performed using a five-step alkaline phosphatase anti-alkaline phosphatase technique as previously described.22

    RESULTS
Abstract
Introduction
Methods
Results
Discussion
References

ISH for KSHV ORF 72. ISH was performed on BM from 20 patients with multiple myeloma and 17 demonstrated viral positive cells by ISH (Table 1). All 5 patients studied at diagnosis demonstrated viral positive cells. In the 6 patients analyzed while on conventional therapy, 5 showed the presence of virus and these same patients were either in relapse or showed no response to chemotherapy. The patient without KSHV was in nearly a complete remission after VAD chemotherapy. Seven of 10 patients studied after undergoing myeloablative chemotherapy with autologous stem cell support (1 month to 24 months after transplant) showed the presence of KSHV. One transplanted patient who showed virus in his BM at diagnosis did not demonstrate virus after transplant. Two other patients (12 and 24 months posttransplant) were also viral negative by ISH. Two patients with acquired immunodeficiency syndrome (AIDS)-associated plasmacytosis were also positive for KSHV in a similar distribution to patients with myeloma. One case of aplastic anemia also showed rare cells containing KSHV. Signal was detected in nuclei and cytoplasm of stromal-type cells which comprised approximately 2% to 10% of the nucleated cells in the BM (Fig 1). Other marrow elements including myeloid cells, erythroid cells, lymphoid cells, megakaryocytes, and plasma cells did not show the presence of virus. By contrast, BM samples from 4 normal subjects and 21 samples from patients with leukemia and lymphoma did not contain any viral staining. In all samples strong staining was present in nuclei of BM cells using control probe to human DNA. Negative control probes revealed no staining in all cases.


View larger version (21K):
[in this window]
[in a new window]
 
Fig 2. Agarose gel of representative PCR results on fresh BM core biopsy samples. KS330233 is amplified from the DNA from patients with myeloma (lanes 1, 3, 5, and 7), but not from normal individuals (lanes 9, 11, and 13). Even-numbered lanes represent the beta -actin controls (650 bp product) for each of the preceding odd-numbered lanes, respectively. Placental DNA is the negative control (lane 15), and DNA from the KSHV-infected cell line KS-1 is the positive control (lane 16). M, 123-bp molecular-weight marker.

In previous studies, our laboratory determined that the cells infected with KSHV after long-term culture of BM from myeloma patients expressed dendritic cell markers (CD83 and fascin).20 To characterize the cells positive by ISH for KSHV in fresh BM biopsy samples, parallel sections were stained with antibodies to fascin, an antigen highly restricted to dendritic cells.22 On serial sections, the distribution of KSHV+ cells by ISH corresponded to the distribution of fascin+ cells, a finding which suggested that KSHV was contained in the dendritic cells (Fig 1). Moreover, these dendritic cells also showed long foot processes allowing each one to directly contact many cells in the BM compartment. Our attempts at double immunostaining for fascin and KSHV on the same sections resulted in loss of fascin staining, probably because the fascin reaction product was unstable through the ISH procedure.

PCR for KSHV. PCR-amplified product was detectable using the KS330233 primers in 6 of 7 fresh bone marrow biopsy specimens from patients with myeloma (Fig 2), with the exception of 1 patient in remission 2 years after autologous stem cell transplant. In 5 of these samples, marrow was also available for ISH studies. The 4 samples showing amplified PCR product were also positive by ISH whereas the sample from the transplanted patient without amplified KSHV product did not show viral staining by ISH. Using PCR, 3 normal marrows were also negative for KSHV.

    DISCUSSION
Abstract
Introduction
Methods
Results
Discussion
References

Using cultured BM stromal cells from patients with multiple myeloma, we have previously shown the presence of KSHV 330233 and vIL-6 RNA transcripts in cultured dendritic cells, suggesting that the KSHV virus may play a role in supporting plasma cell proliferation in the BM and/or neoplastic transformation in these diseases.20 Since these findings were based on results from an artificial system of in vitro stromal cell cultures, the present study demonstrating the presence of KSHV in fresh BM biopsy cores from myeloma patients and AIDS patients with plasmacytosis provides further evidence relating this virus to abnormal plasma cell proliferation.

Using biotinylated probes to sense and antisense KSHV ORF 72, we selectively localized KSHV to the BM stromal cells from patients with myeloma and patients with plasmacytosis associated with the acquired immunodeficiency syndrome. One patient with aplastic anemia showed a few positive cells, while normal BMs and patients with other lymphoid proliferations and acute myelogenous leukemia were negative. Fresh BM biopsy samples from patients with myeloma were also KSHV+ by PCR, whereas normal BM specimens contained no virus. The BM stromal cell distribution of the KSHV signal by ISH corresponded to the distribution of fascin-staining cells on serial sections, suggesting that KSHV infects dendritic cells in the BM. Recent studies have shown the critical role of dendritic cells in the growth and maturation of terminally differentiated B cells.23 Thus, the presence of KSHV with its viral proteins in dendritic cells may enhance their ability to stimulate growth and possible transformation of monoclonal plasma cells. However, we cannot unequivocally prove localization in dendritic cells because attempts at dual ISH/fascin immunohistochemistry on the same sections were unsuccessful.

Although KSHV was present in all untreated myeloma patients, it was not present in BM from four treated cases by ISH. One BM biopsy specimen from a patient with myeloma was negative also by PCR, and this patient was in remission after myeloablative chemotherapy with autologous peripheral blood progenitor cell transplantation. Interestingly, another patient who was KSHV+ at diagnosis became viral negative by ISH after autologous stem cell transplant. The two other cases without virus were from a patient 1 year after autologous transplant and another patient in nearly a complete remission after VAD chemotherapy. Moreover, in the patients who were either in relapse or showed no response to conventional chemotherapy, all showed the presence of KSHV. Thus, these preliminary results suggest a correlation between the presence of KSHV in the BM of myeloma patients and clinical outcome. Larger studies will need to be performed to show this association. Importantly, staining for fascin showed that similar numbers of dendritic cells were present in the posttransplantation marrows, even though the ISH for KSHV was negative. Thus, the absence of virus did not simply result from the absence of dendritic cells in patients' BMs after myeloablative chemotherapy.

Pathogenesis of multiple myeloma appears to be a multistep process.19 IL-6 has been shown to be essential for the survival and growth of myeloma cells which also express IL-6 receptors.17 In addition to acting as a growth factor for myeloma cells, IL-6 promotes survival by preventing apoptosis.18 IL-6 has also been shown to promote bone resorption in myeloma patients.24 Murine monoclonal antibody to IL-6 has been effectively used as a therapeutic agent in the treatment of patients with plasma cell leukemia.25 Some myeloma cell lines are dependent on exogenous IL-6 for growth, and this is thought to be the most important cytokine responsible for myeloma cell proliferation in vivo.16 There is increasing evidence that IL-6 is produced by cells in the microenvironment of the BM, with this cytokine mainly produced by the adherent cells rather than the malignant plasma cells.15 Because a biologically active vIL-6 is encoded by the KSHV genome,14 and we have previously shown vIL-6 RNA transcripts in cultured infected BM dendritic cells,20 it is possible that KSHV-infected BM stromal cells may play a major role in producing paracrine stimulation of plasma cell growth in patients with myeloma.

About 15% of patients with AIDS have monoclonal gammopathy, and BM plasmacytosis and multiple myeloma may also be increased in patients with AIDS.26 The finding of KSHV-infected stromal cells by ISH in patients with AIDS and BM plasmacytosis suggests that KSHV may also be implicated in this condition. Greater numbers of BM samples from patients with AIDS-associated plasma cell dyscrasias need to be studied to confirm these observations. The presence of KSHV in rare cells from the single case of aplastic anemia is interesting and requires further investigation. Although viral etiologies have been demonstrated for some cases of aplastic anemia,27,28 this is the first time KSHV has been found in this disease.

Multiple myeloma is the second most common hematologic malignancy and accounts for about 1% of all cancer-related mortality in the West, yet its epidemiology pattern remains obscure and the etiology is unknown.19 Demonstration of KSHV by PCR and ISH in uncultured BM biopsy specimens is in concordance with previous findings of KSHV in cultured BM stromal cells from patients with myeloma, and suggests that KSHV may play an important role in the development of this B-cell malignancy. Implications include strategies for using antiviral agents and vaccines in the management of patients with myeloma.

    FOOTNOTES

   Submitted July 30, 1997; accepted September 2, 1997.
   Supported in part by Grant No. UO1 CA 66533-02 from the National Institutes of Health and the National Cancer Institute Tissue and Biological Fluids Bank of HIV-Related Malignancies, and funds from the Jonnson Comprehensive Cancer Center at UCLA.
   Address reprint requests to James R. Berenson, MD, Division of Hematology and Oncology, Veteran Affairs West Los Angeles Medical Center, 11301 Wilshire Blvd 111-H, Los Angeles, CA 90073.

   The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hearly marked ``advertisment'' in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

    ACKNOWLEDGMENT

The authors are grateful to Gary Schiller, Matthew Rettig, and Francisco Conde, who donated bone marrow for the study.

    REFERENCES
Abstract
Introduction
Methods
Results
Discussion
References

1. Moore PS, Chang Y: Detection of herpesvirus-like DNA sequences in Kaposi's sarcoma in patients with and those without HIV infection. N Engl J Med 332:1186, 1995[Abstract/Free Full Text]

2. Cesarman E, Chang Y, Moore PS, Said JW, Knowles DM: Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas. N Engl J Med 332:1186, 1995

3. Cesarman E, Moore PS, Rao PH, Inghirami G, Knowles DM, Chang Y: In vitro establishment and characterization of two acquired immunodeficiency syndrome-related lymphoma cell lines (BC-1 and BC-2) containing Kaposi's sarcoma-associated herpesvirus-like (KSHV) DNA sequences. Blood 86:2708, 1995[Abstract/Free Full Text]

4. Cesarman E, Knowles DM: Herpes-like DNA sequences, AIDS-related tumors, and Castleman's disease. N Engl J Med 333:799, 1995[Free Full Text]

5. Cesarman E, Nador R, Knowles DM: Body-cavity-based lymphoma in an HIV-seronegative patient without Kaposi's sarcoma-associated herpesvirus-like DNA sequences. N Engl J Med 334:272, 1996[Free Full Text]

6. Cesarman E, Nador RG, Aozasa K, Delsol G, Said JW, Knowles DM: Kaposi's Sarcoma-associated herpesvirus in non-AIDS-related lymphomas occurring in body cavities. Am J Pathol 149:53, 1996[Abstract]

7. Moore PS, Gao S-J, Dominguez G, Cesarman E, Lungu O, Knowles DM, Garber R, Pellett PE, McGeoch DJ, Chang Y: Primary characterization of a herpesvirus agent associated with Kaposi's sarcoma. J Virol 70:549, 1996[Abstract]

8. Said JW, Chien K, Tasaka T, Takeuchi S, Asou H, Cho SK, Cesarman E, Knowles DM, Koeffler HP: Kaposi's sarcoma associated herpesvirus (KSHV or HHV8) in primary effusion lymphoma: Ultrastructural demonstration of herpesvirus in lymphoma cell lines. Blood 87:4937, 1996[Abstract/Free Full Text]

9. Said JW: Body cavity-based primary effusion lymphoma: A new lymphoma subtype associated with Kaposi's sarcoma herpesvirus (human herpesvirus 8). Adv Anat Pathol 3:254, 1996

10. Said JW, Tasaka T, Takeuchi S, Asou H, de Vos S, Cesarman E, Knowles DM, Koeffler HP: Primary effusion lymphoma in women: Report of two cases of KSHV-associated primary effusion lymphoma in HIV-negative women. Blood 88:3124, 1996[Abstract/Free Full Text]

11. Said JW, Chien K, Tasaka T, Koeffler HP: Ultrastructural characterization of human herpesvirus 8 (Kaposi's sarcoma-associated Herpesvirus) in Kaposi's sarcoma lesions: Electron microscopy permits distinction from cytomegalovirus (CMV). J Pathol 182:273, 1997[Medline] [Order article via Infotrieve]

12. Boshoff C, Schultz TF, Kennedy MM, Graham AK, Fisher C, Thomas A, McGee J O'D, Weiss RA, O'Leary JJ: Kaposi's sarcoma-associated herpesvirus infects endothelial and spindle cells. Nature Med 1:1274, 1995[Medline] [Order article via Infotrieve]

13. Gao S-J, Kingsley L, Li M, Zheng W, Parravicini C, Ziegler J, Newton R, Rinaldo CR, Saah A, Phair J, Detels R, Changa Y, Moore PS: KSHV antibodies among Americans, Italians, and Ugandans with and without Kaposi's sarcoma. Nature Med 2:925, 1996[Medline] [Order article via Infotrieve]

14. Moore PS, Boshoff C, Weiss R, Chang Y: Molecular mimicry of human cytokine and cytokine response pathway genes by KSHV. Science 274:1739, 1996[Abstract/Free Full Text]

15. Klein B, Zhang XG, Jourdan M, Content J, Houssiau F, Aarden L, Piechaczyk M, Bataille R: Paracrine rather than autocrine regulation of myeloma-cell growth and differentiation by interleukin-6. Blood 73:517, 1989[Abstract/Free Full Text]

16. Klein B, Zhang XG, Jourdan M, Boiron JM, Portier M, Lu Lu ZY, Wijdenes J, Brochier J, Bataille R: Interleukin-6 is the central tumor growth factor in vitro and in vivo in multiple myeloma. Eur Cytokine Network 1:193, 1990[Medline] [Order article via Infotrieve]

17. Kawano M, Hirano T, Matsuda T, Taga T, Horii Y, Iwato K, Asaoku H, Tang B, Tanabe O, Tanaka H: Autocrine generation and requirement of BSF-2/IL-6 for human multiple myelomas. Nature 332:83, 1988[Medline] [Order article via Infotrieve]

18. Hardin J, MacLeod S, Grigorieva I, Chang R, Barlogie B, Xiao H, Epstein J: Interleukin-6 prevents dexamethasone-induced myeloma cell death. Blood 84:3063, 1994[Abstract/Free Full Text]

19. Bataille R, Harousseau J-L: Multiple myeloma. New Engl J Med 336:1657, 1997[Free Full Text]

20. Rettig MB, Ma M, Pold M, Schiller G, Belson D, Savage A, Nishikubo C, Fraser J, Said JW, Barenson JR: KSHV infection of multiple myeloma bone marrow stroma. Science 276:1851, 1997[Abstract/Free Full Text]

21. McQuaid S, Gordon AM: Detection protocols for biotinylated probes: Optimization using multistep techniques. J Histochem Cytochem 40:569, 1992[Abstract]

22. Pinkus GS, Pinkus JL, Langhoff E, Matsumura F, Yamashiro-Matsumura S, Mosialos G, Said JW: Fascin: A sensitive new marker for Reed-Sternberg cells of Hodgkin's Disease --- Evidence for a dendritic or B-cell derivation? Am J Pathol 150:543, 1997[Abstract]

23. Dubois B, Vanbervliet B, Fayette J, Massacrier C, Van Kooten C, Briere F, Banchereau J, Caux C: Dendritic cells enhance growth and differentiation of CD40-activated B lymphocytes. J Exp Med 185:941, 1997[Abstract/Free Full Text]

24. Bataille R, Manolagas SC, Berenson JR: Pathogenesis and management of bone lesions in multiple myeloma. Hematol Oncol Clin North Am 11:349, 1997[Medline] [Order article via Infotrieve]

25. Klein B, Wijdenes J, Zhang XG, Jourdan M, Boiron JM, Brochier J, Liautard J, Merlin M, Clement C, Morel-Fournier B: Murine anti-interleukin-6 monoclonal antibody therapy for a patient with plasma cell leukemia. Blood 78:1198, 1991[Abstract/Free Full Text]

26. Gold JE, Schwam L, Castella A, Pike SB, Opfell R, Zalusky R: Malignant plasma cell tumors in human immunodeficiency virus-infected patients. Cancer 66:363, 1990[Medline] [Order article via Infotrieve]

27. Baranski B, Armstrong G, Truman JT, Quinnan GV Jr, Straus SE, Young NS: Epstein-Barr virus in the bone marrow of patients with aplastic anemia. Ann Intern Med 109:695, 1988

28. Hibbs JR, Frickhofen N, Rosenfeld SJ, Feinstone SM, Kojima S, Bacigalupo A, Locasciulli A, Tzakis AG, Alter HJ, Young NS: Aplastic anemia and viral hepatitis. Non-A, non-B, non-C? JAMA 267:2051, 1992[Abstract/Free Full Text]


© 1997 by The American Society of Hematology.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
BloodHome page
A. Kukreja, S. Radfar, B.-H. Sun, K. Insogna, and M. V. Dhodapkar
Dominant role of CD47-thrombospondin-1 interactions in myeloma-induced fusion of human dendritic cells: implications for bone disease
Blood, October 15, 2009; 114(16): 3413 - 3421.
[Abstract] [Full Text] [PDF]


Home page
Am J Clin PatholHome page
W. Chen, Q. Huang, C. W. Zuppan, E. H. Rowsell, J. D. Cao, L. M. Weiss, and J. Wang
Complete Absence of KSHV/HHV-8 in Posttransplant Lymphoproliferative Disorders: An Immunohistochemical and Molecular Study of 52 Cases
Am J Clin Pathol, May 1, 2009; 131(5): 632 - 639.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. M. Dhodapkar, S. Barbuto, P. Matthews, A. Kukreja, A. Mazumder, D. Vesole, S. Jagannath, and M. V. Dhodapkar
Dendritic cells mediate the induction of polyfunctional human IL17-producing cells (Th17-1 cells) enriched in the bone marrow of patients with myeloma
Blood, October 1, 2008; 112(7): 2878 - 2885.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. J. Bahlis, A. M. King, D. Kolonias, L. M. Carlson, H. Y. Liu, M. A. Hussein, H. R. Terebelo, G. E. Byrne Jr, B. L. Levine, L. H. Boise, et al.
CD28-mediated regulation of multiple myeloma cell proliferation and survival
Blood, June 1, 2007; 109(11): 5002 - 5010.
[Abstract] [Full Text] [PDF]


Home page
haematolHome page
T. Wolf, V. Rickerts, S. Staszewski, S. Kriener, B. Wassmann, G. Bug, M. Bickel, P. Gute, H.R. Brodt, and H. Martin
First case of successful allogeneic stem cell transplantation in an HIV-patient who acquired severe Aplastic Anemia
Haematologica, April 1, 2007; 92(4): e56 - e58.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. Kukreja, A. Hutchinson, K. Dhodapkar, A. Mazumder, D. Vesole, R. Angitapalli, S. Jagannath, and M. V. Dhodapkar
Enhancement of clonogenicity of human multiple myeloma by dendritic cells
J. Exp. Med., August 7, 2006; 203(8): 1859 - 1865.
[Abstract] [Full Text] [PDF]


Home page
Clin. Microbiol. Rev.Home page
D. V. Ablashi, L. G. Chatlynne, J. E. Whitman Jr., and E. Cesarman
Spectrum of Kaposi's Sarcoma-Associated Herpesvirus, or Human Herpesvirus 8, Diseases
Clin. Microbiol. Rev., July 1, 2002; 15(3): 439 - 464.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C.-J. Chiou, L. J. Poole, P. S. Kim, D. M. Ciufo, J. S. Cannon, C. M. ap Rhys, D. J. Alcendor, J.-C. Zong, R. F. Ambinder, and G. S. Hayward
Patterns of Gene Expression and a Transactivation Function Exhibited by the vGCR (ORF74) Chemokine Receptor Protein of Kaposi's Sarcoma-Associated Herpesvirus
J. Virol., March 7, 2002; 76(7): 3421 - 3439.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
L. Pan, L. Milligan, J. Michaeli, E. Cesarman, and D. M. Knowles
Polymerase Chain Reaction Detection of Kaposi's Sarcoma-Associated Herpesvirus-Optimized Protocols and Their Application to Myeloma
J. Mol. Diagn., February 1, 2001; 3(1): 32 - 38.
[Abstract] [Full Text]


Home page
J. Mol. Diagn.Home page
D. A. Arber
Molecular Diagnostic Approach to Non-Hodgkin's Lymphoma
J. Mol. Diagn., November 1, 2000; 2(4): 178 - 190.
[Full Text]


Home page
Clin. Cancer Res.Home page
H. J. Ma, N. N. Sjak-Shie, R. A. Vescio, M. Kaminsky, A. Mikail, M. Pold, K. Parker, M. Beksac, D. Belson, T. J. Moss, et al.
Human Herpesvirus 8 Open Reading Frame 26 and Open Reading Frame 65 Sequences from Multiple Myeloma Patients: A Shared Pattern Not Found in Kaposi's Sarcoma or Primary Effusion Lymphoma
Clin. Cancer Res., November 1, 2000; 6(11): 4226 - 4233.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. V. Ablashi, L. Chatlynne, D. Thomas, D. Bourboulia, M. B. Rettig, R. A. Vescio, D. Viza, P. Gill, R. A. Kyle, J. R. Berenson, et al.
Lack of serologic association of human herpesvirus-8 (KSHV) in patients with monoclonal gammopathy of undetermined significance with and without progression to multiple myeloma
Blood, September 15, 2000; 96(6): 2304 - 2306.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
Y.-J. Zhang, J.-H. Deng, C. Rabkin, and S.-J. Gao
Hot-spot variations of Kaposi's sarcoma-associated herpesvirus latent nuclear antigen and application in genotyping by PCR-RFLP
J. Gen. Virol., August 1, 2000; 81(8): 2049 - 2058.
[Abstract] [Full Text]


Home page
Clin. Cancer Res.Home page
T. Hideshima, D. Chauhan, G. Teoh, N. Raje, S. P. Treon, Y.-T. Tai, Y. Shima, and K. C. Anderson
Characterization of Signaling Cascades Triggered by Human Interleukin-6 versus Kaposi's Sarcoma-associated Herpes Virus-encoded Viral Interleukin 6
Clin. Cancer Res., March 1, 2000; 6(3): 1180 - 1189.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Teitell, M. A. Damore, G. G. Sulur, D. E. Turner, M.-H. Stern, J. W. Said, C. T. Denny, and R. Wall
TCL1 oncogene expression in AIDS-related lymphomas and lymphoid tissues
PNAS, August 17, 1999; 96(17): 9809 - 9814.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. R. Berenson and R. A. Vescio
HHV-8 Is Present in Multiple Myeloma Patients
Blood, May 15, 1999; 93(10): 3157 - 3159.
[Full Text] [PDF]


Home page
BloodHome page
K. Tarte, Y. Chang, and B. Klein
Kaposi's Sarcoma-Associated Herpesvirus and Multiple Myeloma: Lack of Criteria for Causality
Blood, May 15, 1999; 93(10): 3159 - 3163.
[Full Text] [PDF]


Home page
BloodHome page
Rebuttal to Tarte, Chang, and Klein
Blood, May 15, 1999; 93(10): 3163 - 3164.
[Full Text] [PDF]


Home page
BloodHome page
Rebuttal to Berenson and Vescio
Blood, May 15, 1999; 93(10): 3164 - 3166.
[Full Text] [PDF]


Home page
BloodHome page
D. Chauhan, A. Bharti, N. Raje, E. Gustafson, G. S. Pinkus, J. L. Pinkus, G. Teoh, T. Hideshima, S. P. Treon, J. D. Fingeroth, et al.
Detection of Kaposi's Sarcoma Herpesvirus DNA Sequences in Multiple Myeloma Bone Marrow Stromal Cells
Blood, March 1, 1999; 93(5): 1482 - 1486.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. Raje, J. Gong, D. Chauhan, G. Teoh, D. Avigan, Z. Wu, D. Chen, S. P. Treon, I. J. Webb, D. W. Kufe, et al.
Bone Marrow and Peripheral Blood Dendritic Cells From Patients With Multiple Myeloma Are Phenotypically and Functionally Normal Despite the Detection of Kaposi's Sarcoma Herpesvirus Gene Sequences
Blood, March 1, 1999; 93(5): 1487 - 1495.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Corbellino, M. Pizzuto, G. Bestetti, L. Corsico, M. Piazza, B. Pigozzi, M. Galli, L. Baldini, A. Neri, and C. Parravicini
Absence of Kaposi's Sarcoma-Associated Herpesvirus DNA Sequences in Multiple Myeloma
Blood, February 1, 1999; 93(3): 1110 - 1112.
[Full Text] [PDF]


Home page
BloodHome page
G. Schonrich, M. Raftery, P. Schnitzler, U. Rohr, and H. Goldschmidt
Absence of a Correlation Between Kaposi's Sarcoma-Associated Herpesvirus (KSHV/HHV-8) and Multiple Myeloma
Blood, November 1, 1998; 92(9): 3474 - 3475.
[Full Text] [PDF]


Home page
BloodHome page
A. Jaccard, M. Touati, C. Sol, D. Bordessoule, J.P. Couty, S. Rogez, and F. Trimoreau
Human Herpesvirus-8 and Relatives of Patients With Plasmocytic Diseases
Blood, November 1, 1998; 92(9): 3488 - 3489.
[Full Text] [PDF]


Home page
BloodHome page
J. F. Tisdale, A. K. Stewart, B. Dickstein, R. F. Little, I. Dube, D. Cappe, C. E. Dunbar, and K. E. Brown
Molecular and Serological Examination of the Relationship of Human Herpesvirus 8 to Multiple Myeloma: orf 26 Sequences in Bone Marrow Stroma Are Not Restricted to Myeloma Patients and Other Regions of the Genome Are Not Detected
Blood, October 15, 1998; 92(8): 2681 - 2687.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Yaccoby, B. Barlogie, and J. Epstein
Primary Myeloma Cells Growing in SCID-hu Mice: A Model for Studying the Biology and Treatment of Myeloma and Its Manifestations
Blood, October 15, 1998; 92(8): 2908 - 2913.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Tarte, S. J. Olsen, J.-F. Rossi, E. Legouffe, Z.-Y. Lu, M. Jourdan, Y. Chang, and B. Klein
Kaposi's Sarcoma-Associated Herpesvirus Is Not Detected With Immunosuppression in Multiple Myeloma
Blood, September 15, 1998; 92(6): 2186 - 2188.
[Full Text] [PDF]


Home page
BloodHome page
Q. Yi, M. Ekman, D. Anton, S. Bergenbrant, A. Osterborg, P. Georgii-Hemming, G. Holm, K. Nilsson, and P. Biberfeld
Blood Dendritic Cells From Myeloma Patients Are Not Infected With Kaposi's Sarcoma-Associated Herpesvirus (KSHV/HHV-8)
Blood, July 15, 1998; 92(2): 402 - 404.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K. Lin, C. Y. Dai, and R. P. Ricciardi
Cloning and Functional Analysis of Kaposi's Sarcoma-Associated Herpesvirus DNA Polymerase and Its Processivity Factor
J. Virol., July 1, 1998; 72(7): 6228 - 6232.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Renne, D. Blackbourn, D. Whitby, J. Levy, and D. Ganem
Limited Transmission of Kaposi's Sarcoma-Associated Herpesvirus in Cultured Cells
J. Virol., June 1, 1998; 72(6): 5182 - 5188.
[Abstract] [Full Text] [PDF]


Home page
Arch DermatolHome page
C. Lebbe
Human Herpesvirus 8 as the Infectious Cause of Kaposi Sarcoma: Evidence and Involvement of Cofactors
Arch Dermatol, June 1, 1998; 134(6): 736 - 738.
[Full Text] [PDF]


Home page
BloodHome page
G. Cathomas, A. Stalder, M. O. Kurrer, N. Regamey, P. Erb, H. I. Joller-Jemelka;, J. W. Said, K. Heppner, I. Peter Shintaku, M. Schrage, et al.
Multiple Myeloma and HHV8 Infection
Blood, June 1, 1998; 91(11): 4391 - 4393.
[Full Text] [PDF]


Home page
BloodHome page
F. Agbalika, X. Mariette, J.-P. Marolleau, J.-P. Fermand, and J.-C. Brouet
Detection of Human Herpesvirus-8 DNA in Bone Marrow Biopsies From Patients With Multiple Myeloma and Waldenstrom's Macroglobulinemia
Blood, June 1, 1998; 91(11): 4393 - 4394.
[Full Text] [PDF]


Home page
BloodHome page
H. Asou, J. W. Said, R. Yang, R. Munker, D. J. Park, N. Kamada, and H. P. Koeffler
Mechanisms of Growth Control of Kaposi's Sarcoma-Associated Herpes Virus-Associated Primary Effusion Lymphoma Cells
Blood, April 1, 1998; 91(7): 2475 - 2481.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Said, J. W.
Right arrow Articles by Berenson, J. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Said, J. W.
Right arrow Articles by Berenson, J. R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1997 by American Society of Hematology         Online ISSN: 1528-0020