| |
|
|
|
|
|
|
|||
|
By
From the Department of Medicine and Clinical Science, and the Department of Pharmacology, Kyoto University Graduate School of Medicine, College of Medical Technology, Kyoto University, Kyoto; and the Department of Immuno-Hematology, Kobe City General Hospital, Kobe, Japan.
Prostacyclin (prostaglandin I2, PGI2) is a potent vasodilator and inhibitor of platelet aggregation. Although it is well known that the specific receptor for prostacyclin (PGI2-R) is abundantly expressed on platelets, PGI2-R expression in megakaryocytes is poorly understood. In this study, we examined its expression in leukemic or normal megakaryocytes. PGI2-R mRNA was expressed in human leukemic cell lines of megakaryocytic nature as evaluated by Northern blot analysis. Phorbol 12-myristate 13-acetate (PMA), interleukin-1 (IL-1), IL-3, IL-6, granulocyte-macrophage colony-stimulating factor (GM-CSF ), thrombopoietin (TPO), and tumor necrosis factor-
PROSTANOIDS ARE cyclooxygenase metabolites of arachidonic acid and are one of the regulatory factors maintaining homeostasis in the body such as vitamins and hormones. Prostanoids, synthesized in various organs, act locally and are immediately degenerated in situ or inactivated during one passage through the lung. Prostacyclin (prostaglandin I2, PGI2) and thromboxane A2 (TxA2) are the major prostanoids regulating the homeostasis of the blood-vessel system. They mostly counteract each other and are also opposite each other in their blood concentrations in ischemic heart disease; while the blood level of prostacyclin decreases, that of TxA2 increases.1-3 Prostacyclin is a potent vasodilator and inhibitor of platelet aggregation. The major source of which is arterial endothelial cells.4 With these biological activities, prostacyclin and its analogues have been clinically used to improve pulmonary hypertension5 or vaso-occlusive disorders such as collagen disease-associated Raynaud's syndrome.6 Prostacyclin exhibits its activities via binding to its specific membrane receptor, PGI2-R which exists widely in the heart, aorta, kidney, and platelets.7-10 It is well known that PGI2-R is abundantly expressed on platelets. The number of PGI2-R on platelets decreases in the active phase of spontaneous angina pectoris11 and in acute myocardial infarction,12 while that of TxA2 receptor increases in patients with acute myocardial infarction.13 In contrast to well documented PGI2-R expression on platelets, expression on megakaryocytes, the precursor of platelets, is poorly understood. To our knowledge, studies concerning PGI2-R expression on megakaryocytes have been performed only by two groups; they showed binding of prostanoids to human leukemic cell lines with megakaryocytic features (HEL or MEG-01).14,15 However, there has been no study examining the PGI2-R expression at the transcriptional level.
Recently, we and others cloned human and rat PGI2-R cDNAs.8-10,16 In this study, we examined the expression of PGI2-R in leukemic or normal megakaryocytes using human PGI2-R cDNA.
Cell Lines and Culture
Recombinant Human Cytokines and Chemical Reagents
Northern Blot Analysis
Cyclic (c)AMP Assay Cells were first preincubated with PMA or cytokines (IL-3, IL-6, GM-CSF, TPO, IL-1 , TNF ) for 24 hours, then incubated in a 24-well microplate (Corning, NY) (1 × 105 cells/well) in 500 µL of RPMI1640 containing 0.5 mmol/L 3-isobutyl-1-methylxanthine (Sigma) and 0.1 % bovine serum albumin (BSA) (Sigma) at 37°C for 10 minutes then iloprost (Amersham, Buckinghamshire, UK), an agonist of prostacyclin (final concentration: 100 nmol/L), or forskolin (Sigma; 1 µmol/L) was added to each well. Incubation was continued for another 30 minutes. Because of the high instability of prostacyclin, we used the agonist. The reaction was terminated by the addition of 500 µL of 12% trichloroacetic acid. The cAMP level was measured in triplicate using an 125I cAMP assay kit (Yamasa Shoyu, Chiba, Japan).
Binding Assay HEL and NS-Meg cells were precultured for 48 hours with or without (control) either PMA or TPO, then harvested and washed twice with RPMI 1640 medium, then suspended (1 × 106 cells/tube) in 20 mmol/L Tris-HCl pH 7.4. Binding assay was performed with 50 nmol/L of [3H]iloprost (Amersham). After incubation at 30°C for 1 hour, the reaction was terminated by an addition of 5 mL of ice-cold 10 mmol/L Tris-HCl pH 7.4 buffer. This mixture was rapidly filtered through a Whatman GF/C filter (Whatman International, Maidstone, UK). The filter was washed four times with 5 mL of the same buffer and the radioactivity was measured in 5 mL of Cleasol scintillation cocktail (Nacalai Tesque, Kyoto, Japan). Nonspecific binding was determined by the addition of 500-fold excess of unlabeled iloprost to the incubation mixture. The specific binding was calculated by subtraction of the nonspecific binding from the total binding.Separation of Human CD34-Positive Cells and Megakaryocytic Colony Formation Cord blood was obtained with informed consent from patients who underwent Caesarian section. Mononuclear cells were separated by centrifugation (400g, 30 minutes) over 60% Percoll (Pharmacia Fine Chemicals, Uppsala, Sweden), then suspended in RPMI 1640 with 10% FCS and incubated for 2 hours in 60 × 15 mm plastic culture dishes (Becton Dickinson, Lincoln Park, NJ) at 37°C in humidified 5% CO2 in air. The plastic nonadherent cells were adjusted to 2 × 108 cells/mL in phosphate-buffered saline without Ca2+ and Mg2+ (PBS[-]) with 2% BSA and mixed with mouse antihuman CD34 antibody-coated magnetic beads (M-450; Dynal, Oslo, Norway) at a ratio of 1 bead per cell. The mixture was then incubated under gentle rotation for 30 minutes at 4°C. Thereafter, cells that attached to the beads were separated from nonattached cells with a magnetic particle concentrator (MPC-6; Dynal) for 2 minutes and this procedure was repeated four to five times. Positively selected cells were then resuspended in 100 µL of PBS(-) with 2% BSA plus 100 µL of DETACHaBEADS (Dynal). After a 45-minute incubation under gentle rotation at room temperature, beads were released from cells by consecutive separation with a magnetic particle concentrator. Isolated cells were counted with a hemocytometer and cell viability was determined by trypan blue dye exclusion. The proportions of CD34+ cells in the isolated fraction were 78% to 85% as determined by the fluorescent microscopy (Olympus, Tokyo, Japan). Megakaryocytic colony formation was performed according to the method described previously32 with some modifications. Briefly, CD34+ cells (5 × 104/mL) were mixed with Iscove's modified Dulbecco's MEM (IMDM) (Life Technologies), 30% human plasma, 50 ng/mL TPO, 50 mmol/L 2-mercaptoethanol (Sigma), and 0.9% methylcellulose (Dow Chemicals, Quebec, Canada). A total of 1-mL aliquots of this mixture was cultured in 35 × 10 mm plastic dishes (Nunc, Naperville, IL) at 37°C in humidified 5% CO2 in air.RT-PCR of Megakaryocytic Colonies Megakaryocytic colonies consisting of more than 50 cells were plucked at days 6, 9, and 14 of culture under an inverted microscope (Olympus). Two hundred colonies were collected on each day and total RNA was extracted using TRIzol. RT-PCR high kit (Toyobo, Osaka, Japan) was used for RT-PCR. Briefly, 1 µg of RNA was reverse transcribed in 20 µL of 1× RTase Buffer, 1 mmol/L dNTPs, 1.25 mmol/L oligo(dT), 10 U RNase Inhibitor, 20 U M-MLV Reverse Transcriptase (RNaseH-). RT was performed at 30°C for 10 minutes, 42°C for 60 minutes, and 99°C for 5 minutes. The reverse transcribed cDNA pool was amplified by PCR with specific primers for PGI2-R, PF4, and a housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (G3PDH) gene as an internal control. The PGI2-R primers were TGCTCCCTGCCTCTCACGAT, sense primer and TGGCTTCTGCTTTGGACGAC, antisense primer. The PF4 primers were TTCCCATCGCACTGAGCACTG, sense primer and GCAGCTAGTAGCTAACTCTCCAAAAG, antisense primer. The G3PDH primers were ACCACAGTCCATGCCATCAC, sense primer and TCCACCACCCTGTTGCTGTA, antisense primer. PCR reaction mixture contained 5 µL of cDNA pool, 2.5 µL of Plus Buffer from the RT-PCR high kit, 0.4 µmol/L each specific primers, 0.5 U of rTaq DNA polymerase in a total volume of 25 µL. PCR for PGI2-R was performed on the GeneAmp PCR System 2400 (Perkin Elmer, Norwalk, CT) for 35 cycles (a cycle of 94°C for 30 seconds, 58°C for 30 seconds, 72°C for 1 minute) and PCR for PF4 and G3PDH, for 30 cycles (a cycle of 94°C for 30 seconds, 60°C for 30 seconds, 72°C for 1 minute).
Statistical Analysis The differences in the values obtained were analyzed by the analysis of variance (ANOVA).
Expression of PGI2-R mRNA in Hematopoietic Cell Lines To determine whether PGI2-R expression is cell lineage-specific, we examined 13 hematopoietic cell lines by Northern blot analysis. As shown in Fig 1, abundant expression was noted in KU812, HEL, NS-Meg, CMK11-5, and CMK cells, and to a lesser amount in MEG-01 and JK-1 cells, while we found no detectable band in MOLT4, MM-S1, U266, THP-1, HL60, and K562 cells. PGI2-R mRNA, therefore, was expressed in all megakaryocytic (CMK11-5, CMK, MEG-01) and megakaryocytic/erythroid (HEL, NS-Meg) cells examined, except for K562 cells.Effect of PMA on the Expression of PGI2-R, PF4, and GPIIb mRNA in Megakaryocytic Cells HEL, NS-Meg, CMK11-5, and CMK cells were challenged with 10 nmol/L PMA and the expression of PGI2-R was determined by Northern blot analysis. We noted time-dependent increases of PGI2-R expression by PMA treatment in all of these cell lines (HEL, NS-Meg, CMK11-5, Fig 2) (CMK, data not shown). Maximum expression was observed at 48 hours in HEL cells (threefold, compared with control culture without any stimulus), 48 hours in NS-Meg cells (fivefold), 72 hours in CMK11-5 cells (eightfold), and 24 hours in CMK cells (threefold) from the initiation of culture. Expression of mRNA for GPIIb was also increased time-dependently by PMA in all of these cell lines, while PF4 was enhanced only in HEL cells.
Effect of Cytokines on the Expression of PGI2-R, PF4, and GPIIb HEL and NS-Meg cells were challenged with various cytokines as indicated in Fig 3A and B. IL-3, IL-6, GM-CSF, TPO, IL-1 , and TNF- upregulated the expression of PGI2-R, although intensity of the maximum expression induced and the time course by these stimuli differed depending on cytokines used and cell lines examined. The effect of IL-1 was similar to IL-1 . G-CSF and EPO did not induce significant increases in PGI2-R expression (data not shown). The results obtained by densitometry are summarized in Fig 4. In HEL cells, both PF4 and GPIIb expression were enhanced by TPO, while in NS-Meg cells, which lack PF4, TPO intensified only GPIIb expression (Fig 3B). All cytokines, except TPO, did not significantly increase the expression of PF4 or GPIIb mRNA in these cells (data not shown).
Induction of cAMP Synthesis by Iloprost and the Effect of PMA or Cytokines on cAMP Synthesis We examined whether iloprost could induce postreceptor signal transduction through its specific receptor (ie, PGI2-R) coupled with Gs type guanosine triphosphate (GTP) binding protein.7 Addition of iloprost to the cultures of HEL and NS-Meg cells, which were shown to express PGI2-R, induced significant increases of cAMP (Fig 5A). Next we examined whether cAMP synthesis was increased following upregulation of PGI2-R. PMA pretreatment increased iloprost-induced cAMP synthesis 4.2-fold in HEL cells and 5.0-fold in NS-Meg cells when compared with nontreated cells. Pretreatment either with IL-3, IL-6, GM-CSF, TPO, IL-1 , or TNF- also elevated iloprost-induced cAMP synthesis in HEL cells. All of the pretreatments (without iloprost) yielded no significant increase of cAMP in the cells from each cell line when compared with nontreated cells (Fig 5A and B). cAMP levels were not changed by the difference in incubation time with iloprost from 15 to 60 minutes, and forskolin increased cAMP synthesis without significant difference between PMA- or cytokine-pretreated cells and nontreated ones (Fig 5C).
Effect of PMA or TPO on Binding Capacity of Iloprost to HEL and NS-Meg Cells Specific [3H]iloprost binding was observed in nontreated HEL (mean ± standard error [SE]: 1.3 × 105 ± 5.3 × 103 dpm/1 × 106 cells) and NS-Meg cells (4.2 × 104 ± 3.9 × 103). Preincubation with PMA or TPO for 48 hours increased the binding capacity of the ligand up to sixfold and threefold in HEL cells and fivefold and twofold in NS-Meg cells, respectively, when compared with control values (nontreated cells) (Fig 6).
Normal Human Megakaryocytic Colonies In methylcellulose semisolid cultures of cord blood CD34+ cells stimulated by TPO, we noted a number of megakaryocytic colonies consisting of more than 50 megakaryocytes, as early as 6 days after culture. The megakaryocytic nature of the colonies was confirmed by immunocytochemistry with anti-CD41a antibodies, as previously reported.32 In accordance with the report by Nishihira et al,33 we detected no other types of hemopoietic colonies until after 15 days of culture. On days 6, 9, and 14 of culture, more than 200 megakaryocytic colonies were plucked and pooled, respectively. Cytospin preparations were made from a part of each cell suspension and the diameter of individual cells was determined with a micrometer. The size of cells increased as the culture advanced; day 6, 16.74 ± 4.33 µm (mean ± standard deviation [SD]) (n = 205), day 9, 19.43 ± 4.85 µm (n = 218), and day 14, 22.43 ± 4.62 µm (n = 242). The cytoplasm of cells plucked on days 9, 11, and 14 had fine azulophilic granules. In contrast, the cytoplasm of cells on day 6 was mostly basophilic without granules. Proplatelet formation32 was observed in situ after 11 days of culture.Semiquantitative RT-PCR for PGI2-R Expression in Megakaryocytic Colonies We next extracted total RNA from each cell suspension. Evaluation of PGI2-R gene expression was performed by semiquantitative RT-PCR. We also assayed PF4 transcripts to compare with the kinetics of PGI2-R transcriptional levels. PGI2-R expression peaked on day 9, then declined toward day 14. In contrast, expression of PF4 increased towards day 14 (Fig 7).
Prostacyclin synthesized mainly by arterial endothelial cells is the most potent inhibitor of platelet aggregation. This action is mediated through the specific receptor for prostacyclin. Because platelets possess only a small amount of remnant RNA transcribed from the nucleus of the megakaryocytes, supply of new receptors on platelet membranes is trivial. Eventually, the expressed receptor on platelets must have originated from the megakaryocyte. In this study, we examined the expression of PGI2-R in megakaryocytes. As for leukemic cell lines, all megakaryocytic and megakaryocytic/erythroid cells expressed PGI2-R mRNA except K562 cells. Furthermore, normal megakaryocytic colonies were shown to express the receptor. Thus, the expression of PGI2-R was first demonstrated at the transcriptional level either in leukemic or normal megakaryocytes.
Submitted November 18, 1996;
accepted March 25, 1997.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hearly marked ``advertisment'' in accordance with 18 U.S.C. section 1734 solely to indicate this fact.
We are grateful to Kyoko Tanaka and Dr Hayato Shimada of the Department of Immuno-Hematology and Gynecology, Kobe City General Hospital, Kobe, Japan, for preparing cord blood.
1.
Tada M,
Kuzuya T,
Inoue M,
Kodama K,
Mishima M,
Yamada M:
Elevation of thromboxane B2 levels in patients with classic and variant angina pectoris.
Circulation
64:1107,
1981 2. Neri Serni GG, Gensini GF, Abbate R, Mugnaini C, Favilla S, Brunelli C, Chierchia S, Parodi O: Increased fibrinopeptide A formation and thromboxane A2 production in patients with ischemic heart disease: Relationships to coronary pathoanatomy, risk factors, and clinical manifestations. Am Heart J 101:185, 1981[Medline] [Order article via Infotrieve] 3. Neri Serni GG, Masotti G, Poggesi L, Galanti G, Morettini A, Scarti L: Reduced prostacyclin production in patients with different manifestations of ischemic heart disease. Am J Cardiol 49:1146, 1982[Medline] [Order article via Infotrieve] 4. Samuelsson B, Goldyne M, Granström E, Hamberg M, Hammarström S, Malmsten C: Prostaglandins and thromboxanes. Annu Rev Biochem, 47:997, 1987 5. Belch JJ, Newman P, Drury JK, McKenzie F, Capell H, Leiberman P, Forbes CD, Prentice CR: Intermittent epoprostenol (prostacyclin) infusion in patients with Raynaud's syndrome. A double-blind controlled trial. Lancet 1:313, 1983[Medline] [Order article via Infotrieve]
6.
Barst RJ,
Rubin LJ,
McGoon MD,
Caldwell EJ,
Long WA,
Levy PS:
Survival in primary pulmonary hypertension with long-term continuous intravenous prostacyclin.
Ann Intern Med
121:409,
1994 7. Halushka PV, Mais DD, Mayeux PR, Morinelli TA: Thromboxane, prostaglandin and leukotriene receptors. Annu Rev Pharmacol Toxicol 10:213, 1989
8.
Nakagawa O,
Tanaka I,
Usui T,
Harada M,
Sasaki Y,
Itoh H,
Yoshimasa T,
Namba T,
Narumiya S,
Nakao K:
Molecular cloning of human prostacyclin receptor cDNA and its gene expression in cardiovascular system.
Circulation
90:1643,
1994 9. Katsuyama M, Sugimoto Y, Namba T, Irie A, Negishi M, Narumiya S, Ichikawa A: Cloning and expression of a cDNA for the human prostacyclin receptor. FEBS Lett 344:74, 1994[Medline] [Order article via Infotrieve]
10.
Boie Y,
Rushmore TH,
Darmon-Goodwin A,
Grygorczyk R,
Slipetz DM,
Metters KM,
Abramovitz M:
Cloning and expression of a cDNA for the human prostanoid IP receptor.
J Biol Chem
269:12173,
1994 11. Neri Serni GG, Modesti PA, Fortini A, Abbate R, Lombardi A, Gensini GF: Reduction in prostacyclin platelet receptors in acute spontaneous angina. Lancet 2:838, 1984[Medline] [Order article via Infotrieve] 12. Jaschonek K, Karsch KR, Weisenberger H, Tidow S, Faul C, Renn W: Platelet prostacyclin binding in coronary artery disease. J Am Coll Cardiol 8:259, 1986[Abstract]
13.
Dorn II GW,
Liel N,
Trask JL,
Mais DE,
Assey ME,
Halushka PV:
Increased platelet thromboxane A2/prostaglandin H2 receptors in patients with acute myocardial infarction.
Circulation
81:212,
1990 14. Murray R, Furci L, FitzGerald GA: Induction of prostacyclin receptor expression in human erythroleukemia cells. FEBS Lett 255:172, 1989[Medline] [Order article via Infotrieve]
15.
Watanabe T,
Yatomi Y,
Sunaga S,
Miki I,
Ishii A,
Nakao A,
Higashihara M,
Seyama Y,
Ogura M,
Saito H,
Kurokawa K,
Shimizu T:
Characterization of prostaglandin and thromboxane receptors expressed on a megakaryoblastic leukemia cell line, MEG-01s.
Blood
78:2328,
1991 16. Sasaki Y, Usui T, Tanaka I, Nakagawa O, Sando T, Takahashi T, Namba T, Narumiya S, Nakao K: Cloning and expression of a cDNA for rat prostacyclin receptor. Biochim Biophys Acta 1224:601, 1994[Medline] [Order article via Infotrieve]
17.
Martin P,
Papayannopoulou T:
HEL cells: A new human erythroleukemia cell line with spontaneous and induced globin expression.
Science
216:1233,
1982 18. Sato T, Fuse A, Eguchi M, Hayashi Y, Ryo R, Adachi M, Kishimoto Y, Teramura M, Mizoguchi H, Shima Y, Komori I, Sunami S, Okimoto Y, Nakajima H: Establishment of human leukaemic cell line (CMK) with megakaryocytic characteristics from a Down's syndrome patient with acute megakaryoblastic leukaemia. Br J Haematol 72:184, 1989[Medline] [Order article via Infotrieve] 19. Adachi M, Ryo R, Sato T, Yamaguchi N: Platelet factor 4 gene expression in a human megakaryocytic leukemia cell line (CMK) and its differentiated subclone (CMK11-5). Exp Hematol 19:923, 1991[Medline] [Order article via Infotrieve] 20. Tsuyuoka R, Takahashi T, Suzuki A, Sasaki Y, Nakamura K, Fukumoto M, Ohmori K, Ohno Y, Nakao K: A newly established megakaryoblastic/erythroid cell line that differentiates to red cells in the presence of erythropoietin and produces platelet-like particles. Stem Cells 13:54, 1995[Medline] [Order article via Infotrieve]
21.
Ogura M,
Morishita Y,
Ohno R,
Kato Y,
Hirabayashi N,
Nagura H,
Saito H:
Establishment of a novel human megakaryoblastic leukemia cell line, MEG-01, with positive Philadelphia chromosome.
Blood
66:1384,
1985 22. Kenji K: A new leukemia cell line with Philadelphia chromosome characterized as basophil precursors. Leuk Res 9:381, 1985[Medline] [Order article via Infotrieve] 23. Okuno Y, Suzuki A, Ichiba S, Takahashi T, Nakamura K, Hitomi K, Sasaki R, Tada K, Imura H: Establishment of an erythroid cell line (JK-1) that spontaneously differentiates to red cells. Cancer 66:1544, 1990[Medline] [Order article via Infotrieve]
24.
Lozzio CB,
Lozzio BB:
Human chronic myelogenous leukemia cell line with positive Philadelphia chromosome.
Blood
45:321,
1975
25.
Gallagher R,
Collins S,
Trujillo J,
McCredie K,
Ahearn M,
Tsai S,
Metzgar R,
Aulakh G,
Ting R,
Ruscetti F,
Gallo R:
Characterization of the continuous, differentiating myeloid cell line (HL-60) from a patient with acute promyelocytic leukemia.
Blood
54:713,
1979 26. Tsuchiya S, Yamabe M, Yamaguchi Y, Kobayashi Y, Konno T, Tada K: Establishment and characterization of a human acute monocytic leukemia cell line (THP-1). Int J Cancer 26:171, 1980[Medline] [Order article via Infotrieve] 27. Minowada J, Ohnuma T, Moore GE: Rosette-forming human lymphoid cell lines. I. Establishment and evidence for origin of thymus-derived lymphocytes. J Natl Cancer Inst 49:891, 1972 28. Okuno Y, Takahashi T, Suzuki A, Ichiba S, Nakamura K, Fukumoto M, Okada T, Okada H, Imura H: Establishment and characterization of four myeloma cell lines which are responsive to interleukin-6 for their growth. Leukemia 5:585, 1991[Medline] [Order article via Infotrieve] 29. Kawano M, Hirano T, Matsuda T, Taga T, Horii Y, Iwato K, Asaoku H, Tang B, Tanabe O, Tanaka H, Kuramoto A, Kishimoto T: Autocrine generation and requirement of BSF-2/IL-6 for human multiple myelomas. Nature 332:83, 1988[Medline] [Order article via Infotrieve]
30.
Eisman R,
Surrey S,
Ramachandran B,
Schwartz E,
Poncz M:
Structural and functional comparison of the genes for human platelet factor 4 and PF4alt.
Blood
76:336,
1990 31. Heidenreich R, Eisman R, Surrey S, Delgrosso K, Bennett JS, Schwartz E, Poncz M: Organization of the gene for platelet glycoprotein IIb. Biochemistry 29:1232, 1990[Medline] [Order article via Infotrieve] 32. Takahashi T, Tsuyuoka R, Ueda Y, Suzuki A, Ichiba S, Okuno Y, Nakamura K, Imura H: Megakaryocyte potentiating activity of IL-1, IL-6 and GM-CSF as evaluated by their action on in vitro human megakaryocytic colonies. Br J Haematol 78:480, 1991[Medline] [Order article via Infotrieve] 33. Nishihira H, Toyoda Y, Miyazaki H, Kigasawa H, Ohsaki E: Growth of macroscopic human megakaryocyte colonies from cord blood in culture with recombinant human thrombopoietin (c-mpl ligand) and the effects of gestational age on frequency of colonies. Br J Haematol 92:23, 1996[Medline] [Order article via Infotrieve]
34.
Bevilacqua MP,
Pober JS,
Majeau GR,
Fiers W,
Cotran RS,
Gimbrone MA:
Recombinant tumor necrosis factor induces procoagulant activity in cultured human vascular endothelium: Characterization and comparison with the action of interleukin 1.
Proc Natl Acad Sci USA
83:4533,
1986
35.
Nachman RL,
Hajjar KA,
Silverstein RL,
Dinarello CA:
Interleukin 1 induces endothelial cell synthesis of plasminogen activator inhibitor.
J Exp Med
163:1595,
1986
36.
Seeger W,
Neuhof H,
Hall J,
Roka L:
Pulmonary vasoconstrictor response to soluble fibrin in isolated lungs: Possible role of thromboxane generation.
Circ Res
62:651,
1988 37. Klosterhalfen B, Hörstmann-Jungemann K, Vogel P, Flohé S, Offner F, Kirkpatrick CJ, Heinrich PC: The course of various inflammatory mediators during recurrent endotoxemia. Biochem Pharmacol 43:2103, 1992[Medline] [Order article via Infotrieve] © 1997 by The American Society of Hematology.This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 1997 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||