Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Eischen, C. M.
Right arrow Articles by Kaufmann, S. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Eischen, C. M.
Right arrow Articles by Kaufmann, S. H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 90 No. 3 (August 1), 1997: pp. 935-943

RAPID COMMUNICATION

Comparison of Apoptosis in Wild-Type and Fas-Resistant Cells: Chemotherapy-Induced Apoptosis Is Not Dependent on Fas/Fas Ligand Interactions

By Christine M. Eischen, Timothy J. Kottke, Luis M. Martins, Guriqbal S. Basi, Jay S. Tung, William C. Earnshaw, Paul J. Leibson, and Scott H. Kaufmann

From the Departments of Immunology and Oncology, Mayo Clinic,, Rochester, MN; Institute of Cell & Molecular Biology, University of Edinburgh, Edinburgh, Scotland, UK; and Athena Neurosciences, Inc, S San Francisco, CA.


    ABSTRACT
Abstract
Introduction
Methods
Results
Discussion
References

The Fas/Fas ligand (FasL) pathway is widely involved in apoptotic cell death in lymphoid and nonlymphoid cells. It has recently been postulated that many chemotherapeutic agents also induce cell death by activating the Fas/FasL pathway. In the present study we compared apoptotic pathways induced by anti-Fas or chemotherapeutic agents in the Jurkat human T-cell leukemia line. Immunoblotting showed that treatment of wild-type Jurkat cells with anti-Fas or the topoisomerase II-directed agent etoposide resulted in proteolytic cleavage of precursors for the cysteine-dependent aspartate-directed proteases caspase-3 and caspase-7 and degradation of the caspase substrates poly(ADP-ribose) polymerase (PARP) and lamin B1 . Likewise, affinity labeling with N-(Nalpha -benzyloxycarbonylglutamyl-Nepsilon -biotinyllysyl)aspartic acid [(2,6-dimethyl-benzoyl)oxy]methyl ketone [Z-EK (bio)D-amok] labeled the same five active caspase species after each treatment, suggesting that the same downstream apoptotic pathways have been activated by anti-Fas and etoposide. Treatment with ZB4, an antibody that inhibits Fas-mediated cell death, failed to block etoposide-induced apoptosis, raising the possibility that etoposide does not initiate apoptosis through Fas/FasL interactions. To further explore the relationship between Fas- and chemotherapy-induced apoptosis, Fas-resistant Jurkat cells were treated with various chemotherapeutic agents. Multiple independently derived Fas-resistant Jurkat lines underwent apoptosis that was indistinguishable from that of the Fas-sensitive parental cells after treatment with etoposide, doxorubicin, topotecan, cisplatin, methotrexate, staurosporine, or gamma -irradiation. These results indicate that antineoplastic treatments induce apoptosis through a Fas-independent pathway even though Fas- and chemotherapy-induced pathways converge on common downstream apoptotic effector molecules.

    INTRODUCTION
Abstract
Introduction
Methods
Results
Discussion
References

RECENT STUDIES from a number of laboratories indicate that widely used chemotherapeutic agents induce apoptosis in susceptible cells.1-3 For example, treatment with the topoisomerase II poison etoposide results in morphological and biochemical evidence of apoptosis in a variety of cell types.4-7 The events occurring between stabilization of topoisomerase II-DNA complexes and initiation of apoptosis are unclear, but subsequent events in all of these cell types include cleavage of DNA4,6,7 and activation of cysteine-dependent aspartate-directed proteases8-11 called caspases.12 Although some mammalian cells have been shown to encode mRNA for at least 10 caspases, recent studies indicate that etoposide treatment results in selective activation of certain family members,11 including caspase-3, which cleaves PARP and DNA-protein kinase at DEVD-X bonds,13,14 and caspase-6, which recognizes the sequence VEID-N and cleaves the nuclear lamins.15,16 In contrast, other caspases, including caspases-1 and -2, do not appear to be activated during etoposide-induced apoptosis in human leukemia cells.11

In a similar fashion, multiple caspases are activated during apoptosis triggered by Fas (CD95/APO-1) ligation.17-19 Fas-mediated apoptosis has been shown to be involved in the development of immune tolerance, regulation of immune responses, and killing of virally infected cells and tumor targets.18,20,21 Current evidence suggests that ligation of Fas leads to the binding of an adaptor protein FADD/MORT1, which in turn binds caspase-8 via its FADD death effector domain(s).17,19 In addition to caspase-8, caspase-10 has also been shown to contain FADD death effector domains, suggesting that the two proteases might associate with FADD.22 It is postulated that, upon binding to FADD, caspase-8 and possibly caspase-10 are activated by currently unidentified proteases and then become available for initiating a cascade of caspases.17,19

The exact relationship between the pathways of chemotherapy-induced apoptosis and Fas/FasL-triggered apoptosis has been unclear. A number of studies using various inhibitors have raised the possibility that different apoptosis-inducing stimuli might activate pathways involving different proteases.23-26 In particular, the observation that Bcl-2 inhibits etoposide-induced apoptosis27,28 but not Fas-induced apoptosis16 is consistent with the claim that Fas- and chemotherapy-induced apoptosis proceed through distinct pathways.29 On the other hand, it has also been observed that Fas ligation and chemotherapeutic agents activate common downstream components of the apoptotic machinery. For example, treatment of Fas-expressing cells with anti-Fas or staurosporine results in proteolytic cleavage of procaspase-3, procaspase-6, and PARP.16,29 Likewise, sterol-regulatory element binding protein-2, a substrate for caspases-3 and -7, is cleaved after anti-Fas, staurosporine, or etoposide treatment.30 These observations suggest considerable overlap between the apoptotic pathways activated by chemotherapeutic agents and Fas ligation.

Friesen et al31 recently reported that treatment of CEM human T-cell leukemia cells with the anthracycline doxorubicin resulted in the induction of FasL expression followed by Fas/FasL-dependent apoptosis. Significantly, a Fas-resistant CEM subline was insensitive to apoptosis induced by doxorubicin. These results not only suggested that certain chemotherapeutic agents might initiate apoptosis by activating the Fas-dependent cell death pathway, but also led the investigators to propose that broad spectrum resistance to chemotherapeutic agents might be related to defects in the Fas pathway.31 The recent demonstration that FasL can be expressed in melanoma, hepatoma, and lung cancer cells32-34 raises the possibility that this molecule can be regulated in nonlymphoid cells and lends plausibility to the hypothesis that antineoplastic agents might induce cell death through the Fas/FasL pathway. Accordingly, the proposal that defects in the Fas pathway contribute to an important and previously unrecognized mechanism of chemotherapy resistance has wide-ranging implications for future studies of drug resistance in lymphoid and nonlymphoid malignancies.

In the present study, flow cytometry and a novel affinity-labeling procedure that detects active caspases were used to compare apoptotic pathways activated by anti-Fas and etoposide in human Jurkat T-leukemia cells. Multiple independently derived Fas-resistant Jurkat cell lines were studied to examine the possibility that etoposide, doxorubicin, topotecan, cisplatin, staurosporine, methotrexate, and gamma -irradiation trigger cell death through the Fas/FasL pathway. Results of these experiments indicate that (1) the downstream effectors of the programmed cell death process induced by etoposide and anti-Fas are indistinguishable, and (2) the triggering of apoptosis by a broad array of chemotherapeutic agents occurs in an Fas/FasL-independent fashion.

    MATERIALS AND METHODS
Abstract
Introduction
Methods
Results
Discussion
References

Materials. Purchased reagents included etoposide, ICR 191, ethyl mercurithiosalicylate (EMS), doxorubicin, cisplatin, methotrexate, staurosporine, RNase A, 7-amino-4-trifluoromethylcoumarin (AFC), and propidium iodide from Sigma (St Louis, MO); saponin from CalBiochem (La Jolla, CA); DEVD-AFC and YVAD-AFC from Enzyme Systems Products (Dublin, CA); fluorescein-conjugated anti-Fas monoclonal antibody (MoAb) UB2 and ZB4 IgG1 blocking anti-Fas MoAb from Immunotech (Westbrook, ME); rabbit anticaspase-1 from Oncogene Research (Cambridge, MA); and monoclonal anti-caspase-2 and anti-caspase-3 from Transduction Labs (Lexington, KY). Topotecan was generously provided by SmithKline Beecham Pharmaceuticals (King of Prussia, PA). The monoclonal anti-Fas antibody 7C11 (IgM) and polyclonal anti-caspase-7 were kind gifts from Michael J. Robertson (Dana-Farber Cancer Institute, Boston, MA) and Vishva Dixit (University of Michigan Medical School, Ann Arbor), respectively. All other reagents were obtained or synthesized as previous described.4,11

Tissue culture. Jurkat human T-cell leukemia cells obtained from the American Type Culture Collection (Rockville, MD) were cultured in RPMI 1640 medium containing 10% bovine serum, 100 µg/mL gentamicin, and 2 mmol/L glutamine. The Fas-resistant Jurkat clones JM3A5, JM14A5, JM18A1, and JM19A6 were generated by incubating wild-type Jurkat cells with 5 µg/mL ICR 191, a frameshift mutagen, for 5 hours on one to five separate occasions. The Fas-resistant clone JM5A5 was generated by incubating wild-type Jurkat cells with 400 µg/mL EMS for 24 hours. Each of the Fas-resistant cell lines was independently derived from a separate wild-type Jurkat cell pool. Anti-Fas (7C11; 0.5 µg/mL) was added to the mutagenized cells 1 week after the last mutagenesis, followed by cloning by limiting dilution in the presence of anti-Fas (7C11; 0.5 µg/mL). The surface expression of Fas was measured using a fluorescein-conjugated anti-Fas MoAb, UB2, followed by flow cytometry as previously described.35 For induction of apoptosis, cells were treated with the indicated concentrations of etoposide, doxorubicin, topotecan, cisplatin, methotrexate, or staurosporine (added from 1000X stocks in dimethyl sulfoxide [DMSO]) as indicated in the individual figure legends.

Enzyme assays. After treatment, cytosol was prepared at 4°C and assayed for activity as previously described.11 In brief, cells were sedimented at 200g for 10 minutes, washed twice in serum-free RPMI 1640, and incubated for 20 minutes in buffer A (25 mmol/L HEPES [pH 7.5 at 4°C], 5 mmol/L MgCl2 , 1 mmol/L EGTA supplemented immediately before use with 1 mmol/L alpha -phenylmethylsulfonyl fluoride [PMSF], 10 µg/mL pepstatin A, and 10 µg/mL leupeptin) and lysed with 20 to 30 strokes in a tight-fitting Dounce homogenizer. After removal of nuclei by sedimentation at 16,000 g for 3 minutes, the supernatant was supplemented with 0.5 mmol/L EDTA and sedimented at 280,000gmax for 60 minutes in a Beckman TL-100 ultracentrifuge (Palo Alto, CA). After addition of dithiothreitol (DTT) to a final concentration of 2 mmol/L, the supernatant (cytosol) was frozen in 50-µL aliquots at -70°C. Experiments showed that DEVD-AFC cleavage activity was stable for at least 3 months. All experiments described in the present study were performed within 2 weeks of extract preparation.

To assay for caspases, aliquots containing 50 µg of cytosolic protein (estimated by the bicinchoninic acid method36 ) in 50 µL buffer A were diluted with 225 µL of freshly prepared buffer B (25 mmol/L HEPES [pH 7.5], 0.1% [wt/vol] CHAPS, 10 mmol/L DTT, 100 U/mL aprotinin, 1 mmol/L PMSF) containing 100 µmol/L substrate and incubated for 2 hours (DEVD-AFC, VEID-AFC) or 4 hours (YVAD-AFC) at 37°C. Reactions were terminated by addition of 1.225 mL ice-cold buffer B. Fluorescence was measured in a Sequoia-Turner fluorometer (Mountain View, CA) using an excitation wavelength of 360 nm and emission wavelength of 475 nm. Reagent blanks containing 50 µL of buffer A and 225 µL of buffer B were incubated at 37°C for 2 hours, then diluted with 1.225 mL ice-cold buffer B. Standards containing 0-1500 pmol of AFC were used to determine the amount of fluorochrome released.

Affinity labeling. The affinity label Z-EK(bio)D-amok was synthesized as previously described.11 Aliquots containing 50 µg of HL-60 cytosolic protein or 75 µg of Jurkat cytosolic protein were incubated for 1 hour at 20-22°C with 1 µmol/L Z-EK(bio)D-aomk (added from a 25 µmol/L stock in DMSO). At the completion of the incubation, extracts were diluted with 1/2 volume of 3X concentrated SDS sample buffer, heated to 95°C for 3 minutes, subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on 16% (wt/vol) acrylamide gels, transferred to nitrocellulose, probed with peroxidase-labeled streptavidin, and visualized by enhanced chemiluminescence. Control experiments revealed that P20 subunits of all active recombinant caspases tested, including caspases-1, -2, -3, -4, and -6, reacted with Z-EK(bio)D-amok.11 Additional experiments indicated that as little as 1 ng of purified caspase-1 could be detected.

Immunoblotting. After incubation with apoptosis-inducing stimuli for the indicated length of time, cells were sedimented at 200 g for 10 minutes at 4°C, washed once with ice-cold RPMI containing 10 mmol/L HEPES (pH 7.4 at 4°C), and solubilized in lysis buffer consisting of 6 mol/L guanidine hydrochloride, 250 mmol/L Tris-HCl (pH 8.5 at 21°C), 10 mmol/L EDTA, 150 mmol/L beta -mercaptoethanol, and 1 mmol/L freshly added PMSF. After sonication, treatment with iodoacetamide to block free sulfhydryl groups, dialysis into 0.1% (wt/vol) SDS, and lyophilization as described,37 samples containing 50 µg protein in SDS sample buffer consisting of 4 mol/L deionized urea, 2% (wt/vol) SDS, 62.5 mmol/L Tris-HCl (pH 6.8 at 21°C), and 1 mmol/L EDTA were heated to 65°C for 20 minutes; subjected to SDS-PAGE on gels with 5% to 15% (wt/vol) acrylamide gradients; and transferred to nitrocellulose. Blots were probed as previously described4,11 using an MoAb that recognizes PARP, chicken polyclonal antiserum raised against rat lamin B1 , and antibodies to caspases -2, -3, and -7 described above.

Flow cytometry. Propidium iodide staining was performed as previously described.38 Briefly, after the indicated treatments, cells were washed with phosphate-buffered saline (PBS); resuspended in 20 mmol/L HEPES (pH 7.4) containing 120 mmol/L NaCl, 60 µg/mL saponin, 50 µg/mL RNase A, and 20 µg/mL propidium iodide; incubated at 37°C for 1 hour; and analyzed (20,000 events/sample) on a Becton Dickinson FACScan (Mountain View, CA). Hypodiploid cells were quantitated in each sample.

Reverse transcription-polymerase chain reaction (RT-PCR). RT-PCR for procaspase transcripts was performed as described previously11 except that primers for procaspase-7 (Accession no. U37449) were (forward primer) TCAAGTGCTTCCGAAGCCTGG and (reverse primer) TGACCCATTGCTTCTCAGCTAGAATGTAC. Control PCR reactions included (1) HL-60 cDNA template and human beta -actin primers (forward-GTGGGGCGCCCCAGGCACCA, reverse-CTCCTTATGTCACGCACGATTTC) to validate the cDNA, and (2) 0.05 µg HL-60 poly(A+) RNA template to confirm that the products observed were derived from cDNA rather than contaminating genomic DNA. After amplification, 10% of each PCR reaction was applied to a 3.5% composite agarose gel (2.5% NuSieve, 1% Seakem-GTG; FMC Bioproducts, Rockland, ME) containing 0.5 µg/mL ethidium bromide in 1x TBE buffer. After electrophoresis for 160 volt-hours, reaction products were visualized on a UV transilluminator (256 nm) and photographed.

    RESULTS
Abstract
Introduction
Methods
Results
Discussion
References

Comparison of anti-Fas- and etoposide-induced apoptosis in wild-type Jurkat T-cell leukemia cells. To investigate the possible relationship between chemotherapy- and Fas-induced apoptosis, we initially compared the effects of the topoisomerase II-directed agent etoposide and the anti-Fas MoAb 7C11 on wild-type Jurkat cells. Treatment with 100 ng/mL anti-Fas resulted in the appearance of cells with subdiploid DNA content within 3 hours (Fig 1A). Similarly, incubation with 68 µmol/L etoposide induced DNA fragmentation within 6 hours (Fig 1A). Examination of anti-Fas- and etoposide-treated cells by electron microscopy confirmed that these cells displayed the characteristic morphological features of apoptosis, including cytoplasmic blebbing, chromatin condensation, and nuclear fragmentation (data not shown).


View larger version (14K):
[in this window]
[in a new window]
 


View larger version (50K):
[in this window]
[in a new window]
 


View larger version (94K):
[in this window]
[in a new window]
 


View larger version (10K):
[in this window]
[in a new window]
 


View larger version (60K):
[in this window]
[in a new window]
 
Fig 1. Anti-Fas- and etoposide-induced apoptosis proceed through a common downstream pathway. (A) Wild-type Jurkat cells were incubated with 100 ng/mL 7C11 anti-Fas ( --- ) or 68 µmol/L etoposide (- - - -) for the indicated times at 37°C. After DNA was stained with propidium iodide, hypodiploid cells were detected by flow cytometry. In additional experiments, appearance of Jurkat cells with subdiploid DNA content was observed after 6 hours of etoposide treatment at concentrations as low as 6.8 µmol/L (Fig 4B). (B) RT-PCR analysis of caspase expression in untreated Jurkat cells. Each lane contains one-tenth volume from the PCR reaction for the target mRNA indicated above the respective lane. Except caspases-1 and -5, which were amplified for 35 cycles, all reactions were amplified for 30 cycles. The lane marked beta -actin (-RT) is a control PCR reaction using poly A+ RNA as template. The lack of a product in this lane confirms that the products observed in the other lanes are not derived from genomic DNA. (C through E) Cells were incubated with 100 ng/mL 7C11 anti-Fas or 68 µmol/L etoposide for the indicated times at 37°C. (C) Total cellular protein was subjected to SDS-PAGE, transferred to nitrocellulose, and probed with antibodies that recognize PARP, laminB1 , and procaspase-2, -3, and -7. Arrowheads indicate specific cleavage products.

(D) Cytosolic extracts were assayed for DEVD-AFC, VEID-AFC, and YVAD-AFC cleavage activities. Control experiments indicated that YVAD-AFC cleavage activity could be readily detected in cytosol from THP.1 cells. (E) Cytosolic extracts were incubated with 1 µmol/L Z-EK (bio)D-amok, subjected to SDS-PAGE, transferred to nitrocellulose, and probed with peroxidase-conjugated streptavidin. Lane 1, cytosol from etoposide-treated HL-60 cells showing the previously described IRPs that label with Z-EK(bio)D-amok.11

RT-PCR showed that untreated Jurkat cells constitutively expressed multiple different caspases (Fig 1B). The identity of the observed PCR products was confirmed by sequencing. This sequence analysis also revealed that the multiple products observed from primers for caspases-8 and -10 were derived from alternatively spliced transcripts as described in Boldin et al.39 In further experiments, Northern blotting showed that full-length message was detectable for procaspases-2, -3, -6, -7, -8, and -10. In contrast, levels of mRNA for procaspases-1, -4, and -5 were below the limit detected by Northern blotting (data not shown).

Immunoblotting showed that PARP and lamin B1 , two caspase substrates,4,8,40 were cleaved upon treatment with anti-Fas or etoposide (Fig 1C). Anti-Fas treatment led to the cleavage of PARP within 1.5 hours and lamin B1 within 2 hours, whereas etoposide treatment resulted in cleavage of PARP and lamin B1 within 3 hours. In addition, levels of procaspases-3 and -7 decreased within 2 hours after the addition of anti-Fas and 4 hours after the addition of etoposide (Fig 1C). In contrast, no cleavage of procaspase-2 was seen 3 hours after anti-Fas or 5 hours after etoposide was added to the wild-type Jurkat cells (Fig 1C). These observations suggested that etoposide and anti-Fas treatments resulted in activation of similar apoptotic proteases.

Enzyme assays using the fluorogenic substrates DEVD-AFC, VEID-AFC, and YVAD-AFC likewise suggested that Fas- and etoposide-stimulated apoptotic pathways were similar. The loss of procaspase-3 from immunoblots (Fig 1C) was reflected in a >100-fold increase in cytosolic DEVD-AFC cleavage activity and a >20-fold increase in cytosolic VEID-AFC cleavage activity (Fig 1D) upon treatment with anti-Fas or etoposide. With both stimuli, kinetics of appearance and magnitude of maximal activity were similar when activity was assayed in whole cell extracts rather than cytosol (data not shown). No YVAD-AFC cleavage activity was detected throughout the entire period of incubation with either anti-Fas or etoposide (Fig 1D) even though the same assay readily detected ICE activity in cytosol from THP.1 monocytic leukemia cells.11

Affinity labeling with Z-EK(bio)D-amok, which selectively modifies the large subunits of active caspases,11 provided further support for the similarity of the Fas- and etoposide-induced apoptotic pathways. Examination of Z-EK(bio)D-aomk-labeled cytosolic (Fig 1E) or whole cell extracts (data not shown) by unidimensional SDS-PAGE followed by blotting with peroxidase-labeled biotin showed that five bands were specifically labeled beginning 1 hour after anti-Fas treatment. The same five bands were detected 3 hours after etoposide was added to the cells (Fig 1E). Further experiments involving recombinant caspases and two-dimensional electrophoresis showed that the major labeled polypeptides migrating at the positions of IRP1 and IRP3 correspond to two different molecular-weight forms of active caspase-6, whereas the major polypeptides migrating at the positions of IRP2 and IRP4 correspond to two different molecular-weight forms of caspase-3.11 The identities of the additional minor bands (not labeled in Fig 1E) remain to be determined.

Aside from the kinetics, etoposide-induced apoptosis in Jurkat cells was indistinguishable from Fas-induced apoptosis by all criteria examined.

Anti-Fas blocking antibody does not inhibit chemotherapy-induced apoptosis. To examine the potential role of Fas/FasL interactions in initiating etoposide-induced apoptosis, Jurkat cells were preincubated with ZB4, a monoclonal anti-Fas antibody that blocks Fas-mediated killing.41 Results of these experiments are shown in Fig 2. Control experiments confirmed that ZB4 inhibited apoptosis induced by ligation of the T-cell receptor with anti-CD3, a treatment that initiates cell death by upregulating FasL expression.38,42 ZB4 also inhibited apoptosis induced by the anti-Fas antibody 7C11. In contrast, ZB4 had no effect on apoptosis induced by various concentrations of etoposide. Likewise, induction of apoptosis by the anthracycline doxorubicin was unaffected by ZB4. These results suggested that etoposide and doxorubicin do not require Fas/FasL interactions to produce apoptotic cell death.


View larger version (20K):
[in this window]
[in a new window]
 
Fig 2. Anti-Fas antibody ZB4 inhibits Fas-mediated apoptosis but not etoposide- or doxorubicin-induced apoptosis. Wild-type Jurkat cells were incubated with 1 µg/mL ZB4 for 30 minutes before addition of 100 ng/mL 7C11 anti-Fas antibody, the indicated concentration of etoposide or doxorubicin, or incubation on a plate coated with anti-CD3 as described.38 After incubation for 3 hours (7C11 anti-Fas antibody), 6 hours (etoposide), or 24 hours (anti-CD3 or doxorubicin), cells were stained with propidium iodide and analyzed by flow cytometry. The percentage of hypodiploid cells is graphed. (black-square), without ZB4; (square ), with ZB4.

Chemotherapy-induced apoptosis in Fas-resistant JM3A5 cells. To further explore the relationship between the Fas/FasL pathway and chemotherapy-induced apoptosis, multiple Fas-resistant Jurkat cell lines were generated by mutagenesis followed by selection in medium containing 7C11 monoclonal anti-Fas antibody. Results in one cell line (designated JM3A5) are presented in detail in Fig 3. In contrast to parental Jurkat cells, JM3A5 cells displayed no evidence of DNA fragmentation after treatment with 100 ng/mL anti-Fas antibody (Fig 3A). Likewise, there was no cleavage of PARP, lamin B1 , procaspase-3, or procaspase-7 after anti-Fas treatment of JM3A5 cells (Fig 3B). Consistent with these results, anti-Fas treatment did not result in activation of caspases capable of cleaving the fluorogenic substrate DEVD-AFC (Fig 3C). Electron microscopy (not shown) revealed that anti-Fas-treated JM3A5 cells were indistinguishable from untreated cells, confirming that JM3A5 cells did not undergo apoptosis after Fas ligation.


View larger version (16K):
[in this window]
[in a new window]
 


View larger version (34K):
[in this window]
[in a new window]
 
Fig 3. Etoposide induces apoptosis in Fas-resistant JM3A5 cells. The Fas-resistant Jurkat subline JM3A5 was treated with 100 ng/mL 7C11 anti-Fas ( --- ) or 68 µmol/L etoposide (- - - -) for the indicated times at 37°C. (A) Cells were examined by flow cytometry to detect subdiploid cells as described in Fig 1A. (B) Whole cell lysates were subjected to SDS-PAGE and immunoblotting using the antibodies described in Fig 1C. Arrowheads indicate locations of specific cleavage products. (C) DEVD-AFC and YVAD-AFC cleavage activities in cytosolic extracts were assayed as described in Materials and Methods.

Treatment of the same JM3A5 cell line with etoposide produced all of the hallmark changes of apoptosis (Fig 3). In particular, DNA fragmentation was first evident 3 hours after the addition of etoposide and increased thereafter as assessed by flow cytometry (Fig 3A). Likewise, apoptotic proteases in the JM3A5 cells were also activated by etoposide treatment as indicated by cleavage of PARP, lamin B1 , procaspase-3, and procaspase-7 (Fig 3B) and the appearance of DEVD-AFC cleavage activity in cytosol (Fig 3C). Electron microscopy confirmed that etoposide treatment was accompanied by chromatin condensation and nuclear fragmentation in the JM3A5 cells (data not shown). All of these changes occurred in a time course that could not be distinguished from etoposide-treated parental Jurkat cells (Fig 1). These observations provide additional evidence that etoposide-induced apoptosis does not depend on a functional Fas/FasL pathway.

These results were not limited to etoposide-induced apoptosis. When JM3A5 cells were treated with doxorubicin (0.5 µmol/L, 24 hours), topotecan (0.1 µmol/L, 24 hours), cisplatin (1 µmol/L, 48 hours), methotrexate (100 nmol/L, 24 hours), staurosporine (1 µmol/L, 6 hours), or gamma -irradiation (1,200 cGy followed by a 24-hour incubation), apoptosis was comparable to that observed in parental Jurkat cells (Fig 4A). Dose-response curves performed with etoposide and doxorubicin indicated that JM3A5 cells were at least as sensitive as parental Jurkat cells to the induction of apoptosis by these treatments (Fig 4B and C). These results indicated that Fas-resistant JM3A5 cells remain sensitive to a wide variety of chemotherapeutic agents.


View larger version (16K):
[in this window]
[in a new window]
 
Fig 4. JM3A5 cells are sensitive to a variety of chemotherapeutic agents. (A) Fas-resistant JM3A5 cells (square ) or wild-type Jurkat cells (black-square) were incubated with 7C11 anti-Fas (100 ng/mL, 3 hours), etoposide (34 µmol/L, 6 hours), doxorubicin (0.5 µmol/L, 24 hours), topotecan (0.1 µmol/L, 24 hours), cisplatin (1 µmol/L, 48 hours), methotrexate (100 nmol/L, 24 hours), staurosporine (1 µmol/L, 6 hours), or gamma -irradiation (1,200 cGy, followed by a 24-hour incubation) at 37°C. After treatment, cells were stained with propidium iodide and analyzed by flow cytometry. The percentage of hypodiploid cells is graphed. (B and C) JM3A5 cells (open circle ) and wild-type Jurkat cells (bullet ) were treated with 0 to 68 µmol/L (0 to 40 µg/mL) etoposide for 6 hours (B) or 0 to 500 nmol/L (0 to 300 ng/mL) doxorubicin for 24 hours (C) at 37°C before propidium iodide staining and flow cytometry as described above.

Multiple Fas-resistant lines remain sensitive to chemotherapy-induced apoptosis. These results were not unique to the JM3A5 cell line. Results obtained with four additional Fas-resistant Jurkat lines (JM5A5, JM14A5, JM18A1, and JM19A6) are summarized in Fig 5. JM3A5, JM5A5, JM18A1, and JM19A6 express wild-type levels of Fas, whereas Fas is undetectable on the surface of JM14A5 cells (data not shown). All of these cell lines were resistant to anti-Fas-induced apoptosis (Fig 5). Like the JM3A5 cells, however, the JM5A5, JM14A5, and JM18A1 Fas-resistant lines displayed DNA fragmentation after all of the other treatments used in this study (Fig 5 and data not shown). These results confirm and extend the observations made with the JM3A5 cell line.


View larger version (37K):
[in this window]
[in a new window]
 
Fig 5. Multiple Fas-resistant Jurkat sublines are sensitive to a variety of chemotherapeutic agents. The indicated cell lines were treated with 7C11 anti-Fas (100 ng/mL, 3 hours), etoposide (34 µmol/L, 6 hours), doxorubicin (0.5 µmol/L, 24 hours), topotecan (0.1 µmol/L, 24 hours), or cisplatin (1 µmol/L, 48 hours) at 37°C. DNA content was then determined by flow cytometry after propidium iodide staining. The percentage of hypodiploid cells (mean ± SD) observed in three independent experiments is graphed. (black-square), wt Jurkat; (square ), JM5A5; (), JM14A5; (), JM18A1; (), JM19A6.

Interestingly, one Fas-resistant cell line, JM19A6, was less sensitive to several chemotherapeutic agents (Fig 5). This line nonetheless retained its ability to undergo apoptosis after treatment with topotecan, indicating that the resistance observed in this cell line was drug-specific rather than a common feature of all chemotherapeutic agents.

    DISCUSSION
Abstract
Introduction
Methods
Results
Discussion
References

In the present report we have shown that (1) chemotherapeutic agents and Fas ligation trigger apoptotic pathways that converge on the same effector proteases17 and (2) induction of apoptosis by chemotherapeutic agents is not dependent on Fas/FasL interactions. These results have important implications for current understanding of apoptotic pathways and of drug resistance.

The conclusion that the downstream pathways activated by chemotherapeutic agents and Fas ligation converge is based on multiple types of experiments. Immunoblotting experiments (Fig 1C) demonstrated that etoposide and anti-Fas both lead to selective cleavage of certain procaspases (eg, procaspases-3 and -7) but not others (eg, procaspase-2), a result that agrees with recent reports that procaspases-3, -6, and/or -7 are cleaved after treatment with anti-Fas or various chemotherapeutic agents.9,16,23,29,30 In experiments that extend these studies, DEVD-AFC and VEID-AFC cleavage assays showed that multiple distinct caspase activities11 become detectable after treatment with either anti-Fas or etoposide (Fig 1D). Moreover, affinity labeling of caspase active sites showed that etoposide and anti-Fas result in activation of the same spectrum of downstream caspases (Fig 1E). Collectively, all of these results suggest that the late stages of apoptosis after treatment with anti-Fas or etoposide proceed through a common caspase pathway in Jurkat cells.

Although anti-Fas and etoposide activate common downstream effectors, two lines of experimentation provide evidence that chemotherapeutic agents do not depend on Fas/FasL interactions to trigger apoptosis. In an initial series of experiments, parental Jurkat cells were treated with etoposide or doxorubicin in the presence of ZB4 MoAb. This antibody inhibited apoptosis induced by anti-CD3, which upregulates FasL, as well as anti-Fas-induced apoptosis (Fig 2). Nonetheless, this antibody did not inhibit etoposide- or doxorubicin-induced apoptosis (Fig 2), suggesting that etoposide and doxorubicin trigger apoptosis in a Fas/FasL-independent manner. In a second series of experiments, five independently derived Fas-resistant Jurkat lines were examined for their ability to undergo apoptosis after treatment with multiple chemotherapeutic agents. Four of the five lines characterized were as sensitive to doxorubicin-induced apoptosis as the parental Jurkat cells from which they were derived (Figs 4 and 5). These four doxorubicin-sensitive lines included at least one line, JM14A5, in which resistance to anti-Fas was associated with a lack of Fas expression, as well as three lines in which normal levels of immunoreactive Fas were expressed. The same four Fas-resistant lines also underwent apoptosis after treatment with etoposide, topotecan, cisplatin, methotrexate, staurosporine, or gamma -irradiation (Fig 5 and data not shown). These results again indicate that a functional Fas/FasL pathway is not required for chemotherapy-induced apoptosis.

One of the five Fas-resistant cell lines, JM19A6, was cross-resistant to the induction of apoptosis by etoposide and cisplatin (Fig 5). This cell line retained the ability to undergo apoptosis after treatment with topotecan, again indicating that an intact Fas/FasL pathway is not required for drug-induced apoptosis. The phenotype displayed by this cell line suggests that one or more mutations affecting drug-specific pathways might have been acquired during the process of mutagenesis and selection.

Our observation that chemotherapy-induced apoptosis can occur in the absence of Fas/FasL interactions differs from that of Friesen et al.31 This disparity might reflect differences between cell lines used in the two studies. However, additional experiments performed in our laboratories have indicated that the Fas/FasL-independent induction of apoptosis by chemotherapeutic agents is not limited to Jurkat cells. For example, we have observed that HL-60 cells, which undergo apoptosis after exposure to a wide range of chemotherapeutic agents,4 fail to express Fas and fail to undergo apoptosis after treatment with anti-Fas antibodies (C.M.E. and T.J.K., unpublished observations, July 1996).

Although the present observations indicate that chemotherapeutic agents initiate apoptosis through a pathway separate from the Fas receptor, at some point downstream of Fas both pathways apparently converge. Because the molecules essential for either Fas-induced or etoposide-induced apoptosis have not been fully elucidated, it is unknown how far upstream from caspases-3, -6, and -7 or how far downstream from Fas the two pathways converge. The Fas-resistant Jurkat mutants described in the present work should provide unique reagents that will be helpful in determining which transducers of the apoptotic signal are unique to the Fas/FasL pathway, which are unique to the chemotherapy-activated pathway, and which are features of the common downstream pathway.

    FOOTNOTES

   Submitted March 19, 1997; accepted April 30, 1997.
   Supported in part by Public Health Service Grant No. CA69008 (S.H.K. and W.C.E) and a grant from the Wellcome Trust (W.C.E). L.L.M. received a predoctoral fellowship from the Programa Gulbenkian de Doutoramento em Biologia e Medicina. W.C.E. is a Principal Fellow of the Wellcome Trust. S.H.K. is a Leukemia Society of America Scholar.
   Address reprint request to Scott H. Kaufmann, MD, PhD, Division of Oncology Research, Guggenheim 1342C, Mayo Clinic, 200 First St, SW, Rochester, MN 55901.

   The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hearly marked ``advertisment'' in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

    ACKNOWLEDGMENT

We thank Ivan Lieberburg for making this collaboration possible, Daniel J. McCormick for synthesizing VEID-AFC, Robert T. Abraham for helpful conversations, Keith Bible for advice regarding electron microscopy, and Deb Strauss for secretarial assistance.

    REFERENCES
Abstract
Introduction
Methods
Results
Discussion
References

1. Sen S, D'Incalci M: Apoptosis. Biochemical events and relevance to cancer chemotherapy. FEBS Lett 307:122, 1992[Medline] [Order article via Infotrieve]

2. Dive C, Evans CA, Whetton AD: Induction of apoptosis --- New targets for cancer chemotherapy. Semin Cancer Biol 3:417, 1992[Medline] [Order article via Infotrieve]

3. Mesner P, Budihardjo I, Kaufmann SH: Chemotherapy-induced apoptosis. Adv Pharmacol 41:461, 1997

4. Kaufmann SH: Induction of endonucleolytic DNA cleavage in human acute myelogenous leukemia cells by etoposide, camptothecin, and other cytotoxic anticancer drugs: A cautionary note. Cancer Res 49:5870, 1989[Abstract/Free Full Text]

5. Barry MA, Behnke CA, Eastman A: Activation of programmed cell death (apoptosis) by cisplatin, other anticancer drugs, toxins and hyperthermia. Biochem Pharmacol 40:2353, 1990[Medline] [Order article via Infotrieve]

6. Bertrand R, Sarang M, Jenkin J, Kerrigan D, Pommier Y: Differential induction of secondary DNA fragmentation by topoisomerase II inhibitors in human tumor cell lines with amplified c-myc expression. Cancer Res 51:6280, 1991[Abstract/Free Full Text]

7. Rubin E, Kharbanda S, Gunji H, Kufe D: Activation of the c-Jun protooncogene in human myeloid leukemia cells treated with etoposide. Mol Pharmacol 39:697, 1991[Abstract]

8. Lazebnik YA, Kaufmann SH, Desnoyers S, Poirier GG, Earnshaw WC: Cleavage of poly(ADP-ribose)polymerase by a proteinase with properties like ICE. Nature 371:346, 1994[Medline] [Order article via Infotrieve]

9. Ibrado AM, Huang Y, Fang G, Liu L, Bhalla K: Overexpression of Bcl-2 or Bcl-xL inhibits ara-C-induced CPP32/Yama protease activity and apoptosis of human acute myelogenous leukemia HL-60 cells. Cancer Res 56:4743, 1996[Abstract/Free Full Text]

10. Datta R, Banach D, Kojima H, Talanian RV, Alnemri ES, Wong WW, Kufe DW: Activation of the CPP32 protease in apoptosis induced by 1-beta-D-arabinofuranosylcytosine and other DNA-damaging agents. Blood 88:1936, 1996[Abstract/Free Full Text]

11. Martins LM, Kottke TJ, Mesner P, Basi GS, Sinha S, Frigon N Jr., Tatar E, Tung JS, Bryant K, Takahashi A, Svingen PA, Madden BJ, McCormick DJ, Earnshaw WC, Kaufmann SH: Activation of multiple interleukin-1beta converting enzyme homologues in cytosol and nuclei of HL-60 human leukemia cell lines during etoposide-induced apoptosis. J Biol Chem 272:7421, 1997[Abstract/Free Full Text]

12. Alnemri ES, Livingston DJ, Nicholson DW, Salveson G, Thornberry NA, Wong WW, Yuan J: Human ICE/CED-3 protease nomenclature. Cell 87:171, 1996[Medline] [Order article via Infotrieve]

13. Nicholson DW: ICE/CED3-like proteases as therapeutic targets for the control of inappropriate apoptosis. Nature Biotech 14:297, 1996[Medline] [Order article via Infotrieve]

14. Kaufmann SH: Proteolytic cleavage during chemotherapy-induced apoptosis. Mol Med Today 2:269, 1996[Medline] [Order article via Infotrieve]

15. Takahashi A, Alnemri ES, Lazebnik YA, Fernandes-Alnemri T, Litwack G, Moir RD, Goldman RD, Poirier GG, Kaufmann SH, Earnshaw WC: Cleavage of lamin A by Mch2alpha but not CPP32: Multiple ICE-related proteases with distinct substrate recognition properties are active in apoptosis. Proc Natl Acad Sci USA 93:8395, 1996[Abstract/Free Full Text]

16. Orth K, Chinnaiyan AM, Garg M, Froelich CJ, Dixit VM: The CED-3/ICE-like protease Mch2 is activated during apoptosis and cleaves the death substrate lamin A. J Biol Chem 271:16443, 1996[Abstract/Free Full Text]

17. Fraser A, Evan G: A license to kill. Cell 85:781, 1996[Medline] [Order article via Infotrieve]

18. Eischen C, Leibson P: The Fas pathway in apoptosis. Adv Pharmacol 41:107, 1997

19. Nagata S: Apoptosis by death factor. Cell 88:355, 1997[Medline] [Order article via Infotrieve]

20. Krammer PH, Dhein J, Walczak H, Behrmann I, Mariani S, Matiba B, Fath M, Daniel PT, Knipping E, Westendorp MO: The role of APO-1-mediated apoptosis in the immune system. Immunol Rev 142:175, 1994[Medline] [Order article via Infotrieve]

21. Nagata S, Golstein P: The Fas death factor. Science 267:1449, 1995[Abstract/Free Full Text]

22. Fernandes-Alnemri T, Armstrong RC, Krebs J, Srinivasula SM, Wang L, Bullrich F, Fritz LC, Trapani JA, Tomaselli KJ, Litwack G, Alnemri ES: In vitro activation of CPP32 and Mch3 by Mch4, A Novel human apoptotic cysteine protease containing two FADD-like domains. Proc Natl Acad Sci USA 93:7464, 1996[Abstract/Free Full Text]

23. Dubrez L, Savoy I, Hamman A, Solary E: Pivotal role of a DEVD-sensitive step in etoposide-induced and Fas-mediated apoptotic pathways. EMBO J 15:5504, 1996[Medline] [Order article via Infotrieve]

24. Lotem J, Sachs L: Differential suppression by protease inhibitors and cytokines of apoptosis induced by wild-type p53 and cytotoxic agents. Proc Natl Acad Sci USA 93:12507, 1996[Abstract/Free Full Text]

25. Moreno MB, Memon SA, Zacharchuk CM: Apoptosis signaling pathways in normal T cells. J Immunol 157:3845, 1996[Abstract]

26. Ucker DS: Death and dying in the immune system. Adv Pharmacol 41:179, 1997

27. Kamesaki S, Kamesaki H, Jorgensen TJ, Tanizawa A, Pommier Y, Cossman J: Bcl-2 protein inhibits etoposide-induced apoptosis through its effects on events subsequent to topoisomerase II-induced DNA strand breaks and their repair. Cancer Res 53:4251, 1993[Abstract/Free Full Text]

28. Miyashita T, Reed JC: Bcl-2 oncoprotein blocks chemotherapy-induced apoptosis in a human leukemia cell line. Blood 81:151, 1993[Abstract/Free Full Text]

29. Chinnaiyan AM, Orth K, O'Rouke K, Duan H, Poirier GG, Dixit VM: Molecular ordering of the cell death pathway. J Biol Chem 271:4573, 1996[Abstract/Free Full Text]

30. Wang X, Zelenski NG, Yang J, Sakai J, Brown MS, Goldstein JL: Cleavage of sterol regulatory element binding proteins (SREBPs) by CPP32 during apoptosis. EMBO J 15:1012, 1996[Medline] [Order article via Infotrieve]

31. Friesen C, Herr I, Krammer PH, Debatin K-M: Involvement of the CD95 (APO-1/Fas) receptor/ligand system in drug-induced apoptosis in leukemia cells. Nature Med 2:574, 1996[Medline] [Order article via Infotrieve]

32. Hahne M, Rimoldi D, Schröter M, Romero P, Schreier M, French LE, Schneider P, Bornand T, Fontana A, Lienard D, Cerottini J-C, Tschopp J: Melanoma cell expression of Fas(Apo-1/CD95) ligand: Implications for tumor immune escape. Science 274:1363, 1996[Abstract/Free Full Text]

33. Müller M, Strand S, Hug H, Heinemann E-M, Walczak H, Hofmann WJ, Stremmel W, Krammer PH, Galle PR: Drug-induced apoptosis in hepatoma cells is mediated by the CD95 (APO-1-Fas) receptor/ligand system and involves activation of wild-type p53. J Clin Invest 99:403, 1997[Medline] [Order article via Infotrieve]

34. Niehans GA, Brunner T, Frizelle SP, Liston JC, Salerno CR, Knapp DJ, Green DR, Kratzke RA: Human lung carcinomas express Fas ligand. Cancer Res 57:1007, 1997[Abstract/Free Full Text]

35. Eischen CM, Dick CJ, Leibson PJ: Tyrosine kinase activation provides an early and requisite signal for Fas-induced apoptosis. J Immunol 153:1947, 1994[Abstract]

36. Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner FH, Provenzano MD, Fujimoto EK, Goeke NM, Olson BJ, Klenk DC: Measurement of protein using bicinchoninic acid. Anal Biochem 150:76, 1985[Medline] [Order article via Infotrieve]

37. Kaufmann SH, McLaughlin SJ, Kastan M, Liu LF, Karp JE, Burke PJ: Topoisomerase II levels during granulocytic maturation in vitro and in vivo. Cancer Res 51:3534, 1991[Abstract/Free Full Text]

38. Eischen CM, Williams BL, Zhang W, Samelson WE, Lynch DH, Abraham RT, Leibson PJ: Zap70 tyrosine kinase is required for the up-regulation of Fas ligand in activation-induced T cell apoptosis. J Immunol 1997 (in press)

39. Boldin MP, Goncharov TM, Goltsev YV, Wallach D: Involvement of MACH, a novel MORT1/FADD-interacting protease, in Fas/APO-1 and TNF receptor-induced cell death. Cell 85:803, 1996[Medline] [Order article via Infotrieve]

40. Lazebnik YA, Takahaski A, Moir R, Goldman R, Poirier GG, Kaufmann SH, Earnshaw WC: Studies of the lamin proteinase reveal multiple parallel biochemical pathways during apoptotic execution. Proc Natl Acad Sci USA 92:9042, 1995[Abstract/Free Full Text]

41. Yonehara S, Nishimura Y, Kishil S, Yonehara M, Takazawa K, Tamatani T, Ishii A: Involvement of apoptosis antigen Fas in cloncal deletion of human thymocytes. Int Immunol 6:1849, 1994[Abstract/Free Full Text]

42. Dhein JH, Walczak H, Baumler C, Debatin KM, Krammer PH: Autocrine T-cell suicide mediated by APO-1/(Fas/DC95). Nature 373:438, 1995[Medline] [Order article via Infotrieve]


© 1997 by The American Society of Hematology.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
BloodHome page
J. E. Karp, K. Flatten, E. J. Feldman, J. M. Greer, D. A. Loegering, R. M. Ricklis, L. E. Morris, E. Ritchie, B. D. Smith, V. Ironside, et al.
Active oral regimen for elderly adults with newly diagnosed acute myelogenous leukemia: a preclinical and phase 1 trial of the farnesyltransferase inhibitor tipifarnib (R115777, Zarnestra) combined with etoposide
Blood, May 14, 2009; 113(20): 4841 - 4852.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Yang, P. K. Epling-Burnette, J. S. Painter, J. Zou, F. Bai, S. Wei, and T. P. Loughran Jr
Antigen activation and impaired Fas-induced death-inducing signaling complex formation in T-large-granular lymphocyte leukemia
Blood, February 1, 2008; 111(3): 1610 - 1616.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. J. Tang and I. T. Tai
A Novel Interaction between Procaspase 8 and SPARC Enhances Apoptosis and Potentiates Chemotherapy Sensitivity in Colorectal Cancers
J. Biol. Chem., November 23, 2007; 282(47): 34457 - 34467.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
M. S. Razzaque
Cisplatin nephropathy: is cytotoxicity avoidable?
Nephrol. Dial. Transplant., August 1, 2007; 22(8): 2112 - 2116.
[Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. B. Wallach-Dayan, G. Izbicki, P. Y. Cohen, R. Gerstl-Golan, A. Fine, and R. Breuer
Bleomycin initiates apoptosis of lung epithelial cells by ROS but not by Fas/FasL pathway
Am J Physiol Lung Cell Mol Physiol, April 1, 2006; 290(4): L790 - L796.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
N. Setterblad, V. Blancheteau, A. Delaguillaumie, F. Michel, S. Becart, G. Lombardi, O. Acuto, D. Charron, and N. Mooney
Cognate MHC-TCR interaction leads to apoptosis of antigen-presenting cells
J. Leukoc. Biol., June 1, 2004; 75(6): 1036 - 1044.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Holleman, M. L. d. Boer, K. M. Kazemier, G. E. Janka-Schaub, and R. Pieters
Resistance to different classes of drugs is associated with impaired apoptosis in childhood acute lymphoblastic leukemia
Blood, December 15, 2003; 102(13): 4541 - 4546.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. W. Meng, J. Chandra, D. Loegering, K. Van Becelaere, T. J. Kottke, S. D. Gore, J. E. Karp, J. Sebolt-Leopold, and S. H. Kaufmann
Central Role of Fas-associated Death Domain Protein in Apoptosis Induction by the Mitogen-activated Protein Kinase Kinase Inhibitor CI-1040 (PD184352) in Acute Lymphocytic Leukemia Cells in Vitro
J. Biol. Chem., November 21, 2003; 278(47): 47326 - 47339.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
N. Hoti, J. Ma, S. Tabassum, Y. Wang, and M. Wu
Triphenyl Tin Benzimidazolethiol, a Novel Antitumor Agent, Induces Mitochondrial-Mediated Apoptosis in Human Cervical Cancer Cells via Suppression of HPV-18 Encoded E6
J. Biochem., October 1, 2003; 134(4): 521 - 528.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. K. Reddy, C. Mao, P. Baumeister, R. C. Austin, R. J. Kaufman, and A. S. Lee
Endoplasmic Reticulum Chaperone Protein GRP78 Protects Cells from Apoptosis Induced by Topoisomerase Inhibitors: ROLE OF ATP BINDING SITE IN SUPPRESSION OF CASPASE-7 ACTIVATION
J. Biol. Chem., May 30, 2003; 278(23): 20915 - 20924.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
M. S. Park, M. De Leon, and P. Devarajan
Cisplatin Induces Apoptosis in LLC-PK1 Cells via Activation of Mitochondrial Pathways
J. Am. Soc. Nephrol., April 1, 2002; 13(4): 858 - 865.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
J. G. Crowston, L. H. Chang, P. H. Constable, J. T. Daniels, A. N. Akbar, and P. T. Khaw
Apoptosis Gene Expression and Death Receptor Signaling in Mitomycin-C-Treated Human Tenon Capsule Fibroblasts
Invest. Ophthalmol. Vis. Sci., March 1, 2002; 43(3): 692 - 699.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. W. Meng, M. P. Heldebrant, and S. H. Kaufmann
Phorbol 12-myristate 13-Acetate Inhibits Death Receptor-mediated Apoptosis in Jurkat Cells by Disrupting Recruitment of Fas-associated Polypeptide with Death Domain
J. Biol. Chem., January 25, 2002; 277(5): 3776 - 3783.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. D. Schimmer, D. W. Hedley, L. Z. Penn, and M. D. Minden
Receptor- and mitochondrial-mediated apoptosis in acute leukemia: a translational view
Blood, December 15, 2001; 98(13): 3541 - 3553.
[Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
K. H. Shain and W. S. Dalton
Cell Adhesion Is a Key Determinant in de Novo Multidrug Resistance (MDR): New Targets for the Prevention of Acquired MDR
Mol. Cancer Ther., November 1, 2001; 1(1): 69 - 78.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. T. Jones, K. Ganeshaguru, A. E. Virchis, N. I. Folarin, M. W. Lowdell, A. B. Mehta, H. G. Prentice, A. V. Hoffbrand, and R. G. Wickremasinghe
Caspase 8 activation independent of Fas (CD95/APO-1) signaling may mediate killing of B-chronic lymphocytic leukemia cells by cytotoxic drugs or gamma radiation
Blood, November 1, 2001; 98(9): 2800 - 2807.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. Laurent and J.-P. Jaffrezou
Signaling pathways activated by daunorubicin
Blood, August 15, 2001; 98(4): 913 - 924.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y.-j. Lee and E. Shacter
Fas Aggregation Does Not Correlate with Fas-Mediated Apoptosis
J. Immunol., July 1, 2001; 167(1): 82 - 89.
[Abstract] [Full Text] [PDF]


Home page
Cell Growth Differ.Home page
C.-Y. Chen, P. Juo, J. S. Liou, C.-Q. Li, Q. Yu, J. Blenis, and D. V. Faller
The Recruitment of Fas-associated Death Domain/Caspase-8 in Ras-induced Apoptosis
Cell Growth Differ., June 1, 2001; 12(6): 297 - 306.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Dorrie, H. Gerauer, Y. Wachter, and S. J. Zunino
Resveratrol Induces Extensive Apoptosis by Depolarizing Mitochondrial Membranes and Activating Caspase-9 in Acute Lymphoblastic Leukemia Cells
Cancer Res., June 1, 2001; 61(12): 4731 - 4739.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J.-H. Lai, L.-J. Ho, K.-C. Lu, D.-M. Chang, M.-F. Shaio, and S.-H. Han
Western and Chinese Antirheumatic Drug-Induced T Cell Apoptotic DNA Damage Uses Different Caspase Cascades and Is Independent of Fas/Fas Ligand Interaction
J. Immunol., June 1, 2001; 166(11): 6914 - 6924.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
D. Bellarosa, A. Ciucci, A. Bullo, F. Nardelli, S. Manzini, C. A. Maggi, and C. Goso
Apoptotic Events in a Human Ovarian Cancer Cell Line Exposed to Anthracyclines
J. Pharmacol. Exp. Ther., April 13, 2001; 296(2): 276 - 283.
[Abstract] [Full Text]


Home page
Am. J. Pathol.Home page
I. Meinhold-Heerlein, F. Stenner-Liewen, H. Liewen, S. Kitada, M. Krajewska, S. Krajewski, J. M. Zapata, A. Monks, D. A. Scudiero, T. Bauknecht, et al.
Expression and Potential Role of Fas-Associated Phosphatase-1 in Ovarian Cancer
Am. J. Pathol., April 1, 2001; 158(4): 1335 - 1344.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Wieder, F. Essmann, A. Prokop, K. Schmelz, K. Schulze-Osthoff, R. Beyaert, B. Dorken, and P. T. Daniel
Activation of caspase-8 in drug-induced apoptosis of B-lymphoid cells is independent of CD95/Fas receptor-ligand interaction and occurs downstream of caspase-3
Blood, March 1, 2001; 97(5): 1378 - 1387.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
X.-H. Yang, T. L. Sladek, X. Liu, B. R. Butler, C. J. Froelich, and A. D. Thor
Reconstitution of Caspase 3 Sensitizes MCF-7 Breast Cancer Cells to Doxorubicin- and Etoposide-induced Apoptosis
Cancer Res., January 1, 2001; 61(1): 348 - 354.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
C. G. Ferreira, S. W. Span, G. J. Peters, F. A. E. Kruyt, and G. Giaccone
Chemotherapy Triggers Apoptosis in a Caspase-8-dependent and Mitochondria-controlled Manner in the Non-Small Cell Lung Cancer Cell Line NCI-H460
Cancer Res., December 1, 2000; 60(24): 7133 - 7141.
[Abstract] [Full Text]


Home page
BloodHome page
J. Wen, N. Ramadevi, D. Nguyen, C. Perkins, E. Worthington, and K. Bhalla
Antileukemic drugs increase death receptor 5 levels and enhance Apo-2L-induced apoptosis of human acute leukemia cells
Blood, December 1, 2000; 96(12): 3900 - 3906.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
B. Gong and A. Almasan
Apo2 Ligand/TNF-related Apoptosis-inducing Ligand and Death Receptor 5 Mediate the Apoptotic Signaling Induced by Ionizing Radiation in Leukemic Cells
Cancer Res., October 1, 2000; 60(20): 5754 - 5760.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
R. T. Costello, F. Mallet, B. Gaugler, D. Sainty, C. Arnoulet, J.-A. Gastaut, and D. Olive
Human Acute Myeloid Leukemia CD34+/CD38- Progenitor Cells Have Decreased Sensitivity to Chemotherapy and Fas-induced Apoptosis, Reduced Immunogenicity, and Impaired Dendritic Cell Transformation Capacities
Cancer Res., August 1, 2000; 60(16): 4403 - 4411.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
I. Petak, D. M. Tillman, F. G. Harwood, R. Mihalik, and J. A. Houghton
Fas-dependent and -independent Mechanisms of Cell Death following DNA Damage in Human Colon Carcinoma Cells
Cancer Res., May 1, 2000; 60(10): 2643 - 2650.
[Abstract] [Full Text]


Home page
J. Thorac. Cardiovasc. Surg.Home page
T. L. Weigel, M. T. Lotze, P. K. Kim, A. A. Amoscato, J. D. Luketich, and C. Odoux
PACLITAXEL-INDUCED APOPTOSIS IN NON-SMALL CELL LUNG CANCER CELL LINES IS ASSOCIATED WITH INCREASED CASPASE-3 ACTIVITY
J. Thorac. Cardiovasc. Surg., April 1, 2000; 119(4): 795 - 803.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Ferraro, L. Quemeneur, A.-F. Prigent, C. Taverne, J.-P. Revillard, and N. Bonnefoy-Berard
Anthracyclines Trigger Apoptosis of Both G0-G1 and Cycling Peripheral Blood Lymphocytes and Induce Massive Deletion of Mature T and B Cells
Cancer Res., April 1, 2000; 60(7): 1901 - 1907.
[Abstract] [Full Text]


Home page
BloodHome page
A. A. Ruefli, M. J. Smyth, and R. W. Johnstone
HMBA induces activation of a caspase-independent cell death pathway to overcome P-glycoprotein-mediated multidrug resistance
Blood, April 1, 2000; 95(7): 2378 - 2385.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Schuler, E. Bossy-Wetzel, J. C. Goldstein, P. Fitzgerald, and D. R. Green
p53 Induces Apoptosis by Caspase Activation through Mitochondrial Cytochrome c Release
J. Biol. Chem., March 15, 2000; 275(10): 7337 - 7342.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
K. Newton and A. Strasser
Ionizing Radiation and Chemotherapeutic Drugs Induce Apoptosis in Lymphocytes in the Absence of Fas or FADD/MORT1 Signaling: Implications for Cancer Therapy
J. Exp. Med., January 3, 2000; 191(1): 195 - 200.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. G. Ferreira, C. Tolis, S. W. Span, G. J. Peters, T. van Lopik, A. J. Kummer, H. M. Pinedo, and G. Giaccone
Drug-induced Apoptosis in Lung Cancer Cells Is Not Mediated by the Fas/FasL (CD95/APO1) Signaling Pathway
Clin. Cancer Res., January 1, 2000; 6(1): 203 - 212.
[Abstract] [Full Text]


Home page
Clin. Cancer Res.Home page
P. A. Svingen, A. Tefferi, T. J. Kottke, G. Kaur, V. L. Narayanan, E. A. Sausville, and S. H. Kaufmann
Effects of the bcr/abl Kinase Inhibitors AG957 and NSC 680410 on Chronic Myelogenous Leukemia Cells in Vitro
Clin. Cancer Res., January 1, 2000; 6(1): 237 - 249.
[Abstract] [Full Text]


Home page
BloodHome page
S. Fulda, G. Strauss, E. Meyer, and K.-M. Debatin
Functional CD95 ligand and CD95 death-inducing signaling complex in activation-induced cell death and doxorubicin-induced apoptosis in leukemic T cells
Blood, January 1, 2000; 95(1): 301 - 308.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
R. Liu, C. Page, D. R. Beidler, M. S. Wicha, and G. Nunez
Overexpression of Bcl-xL Promotes Chemotherapy Resistance of Mammary Tumors in a Syngeneic Mouse Model
Am. J. Pathol., December 1, 1999; 155(6): 1861 - 1867.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
J. C. Reed
Dysregulation of Apoptosis in Cancer
J. Clin. Oncol., September 1, 1999; 17(9): 2941 - 2941.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. W. Mesner Jr., K. C. Bible, L. M. Martins, T. J. Kottke, S. M. Srinivasula, P. A. Svingen, T. J. Chilcote, G. S. Basi, J. S. Tung, S. Krajewski, et al.
Characterization of Caspase Processing and Activation in HL-60 Cell Cytosol Under Cell-free Conditions. NUCLEOTIDE REQUIREMENT AND INHIBITOR PROFILE
J. Biol. Chem., August 6, 1999; 274(32): 22635 - 22645.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. H. Landowski, K. H. Shain, M. M. Oshiro, I. Buyuksal, J. S. Painter, and W. S. Dalton
Myeloma Cells Selected for Resistance to CD95-Mediated Apoptosis Are Not Cross-Resistant to Cytotoxic Drugs: Evidence for Independent Mechanisms of Caspase Activation
Blood, July 1, 1999; 94(1): 265 - 274.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Pervaiz, M. A. Seyed, J. L. Hirpara, M.-V. Clement, and K. W. Loh
Purified Photoproducts of Merocyanine 540 Trigger Cytochrome C Release and Caspase 8-Dependent Apoptosis in Human Leukemia and Melanoma Cells
Blood, June 15, 1999; 93(12): 4096 - 4108.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. J. Kottke, A. L. Blajeski, L. M. Martins, P. W. Mesner Jr., N. E. Davidson, W. C. Earnshaw, D. K. Armstrong, and S. H. Kaufmann
Comparison of Paclitaxel-, 5-Fluoro-2'-deoxyuridine-, and Epidermal Growth Factor (EGF)-induced Apoptosis. EVIDENCE FOR EGF-INDUCED ANOIKIS
J. Biol. Chem., May 28, 1999; 274(22): 15927 - 15936.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. G. R. Boesen-de Cock, A. D. Tepper, E. de Vries, W. J. van Blitterswijk, and J. Borst
Common Regulation of Apoptosis Signaling Induced by CD95 and the DNA-damaging Stimuli Etoposide and gamma -Radiation Downstream from Caspase-8 Activation
J. Biol. Chem., May 14, 1999; 274(20): 14255 - 14261.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Wesselborg, I. H. Engels, E. Rossmann, M. Los, and K. Schulze-Osthoff
Anticancer Drugs Induce Caspase-8/FLICE Activation and Apoptosis in the Absence of CD95 Receptor/Ligand Interaction
Blood, May 1, 1999; 93(9): 3053 - 3063.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
O. Micheau, E. Solary, A. Hammann, and M.-T. Dimanche-Boitrel
Fas Ligand-independent, FADD-mediated Activation of the Fas Death Pathway by Anticancer Drugs
J. Biol. Chem., March 19, 1999; 274(12): 7987 - 7992.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Samejima, P. A. Svingen, G. S. Basi, T. Kottke, P. W. Mesner Jr., L. Stewart, F. Durrieu, G. G. Poirier, E. S. Alnemri, J. J. Champoux, et al.
Caspase-mediated Cleavage of DNA Topoisomerase I at Unconventional Sites during Apoptosis
J. Biol. Chem., February 12, 1999; 274(7): 4335 - 4340.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
Y.-Y. Mo and W. T. Beck
DNA Damage Signals Induction of Fas Ligand in Tumor Cells
Mol. Pharmacol., February 1, 1999; 55(2): 216 - 222.
[Abstract] [Full Text]


Home page
BloodHome page
R. W. Johnstone, E. Cretney, and M. J. Smyth
P-Glycoprotein Protects Leukemia Cells Against Caspase-Dependent, but not Caspase-Independent, Cell Death
Blood, February 1, 1999; 93(3): 1075 - 1085.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. Fadeel, A. Ahlin, J.-I. Henter, S. Orrenius, and M. B. Hampton
Involvement of Caspases in Neutrophil Apoptosis: Regulation by Reactive Oxygen Species
Blood, December 15, 1998; 92(12): 4808 - 4818.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Kataoka, M. Schroter, M. Hahne, P. Schneider, M. Irmler, M. Thome, C. J. Froelich, and J. Tschopp
FLIP Prevents Apoptosis Induced by Death Receptors But Not by Perforin/Granzyme B, Chemotherapeutic Drugs, and Gamma Irradiation
J. Immunol., October 15, 1998; 161(8): 3936 - 3942.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
D. Ferrari, A. Stepczynska, M. Los, S. Wesselborg, and K. Schulze-Osthoff
Differential Regulation and ATP Requirement for Caspase-8 and Caspase-3 Activation during CD95- and Anticancer Drug-induced Apoptosis
J. Exp. Med., September 7, 1998; 188(5): 979 - 984.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. J. Smyth, E. Krasovskis, V. R. Sutton, and R. W. Johnstone
The drug efflux protein, P-glycoprotein, additionally protects drug-resistant tumor cells from multiple forms of caspase-dependent apoptosis
PNAS, June 9, 1998; 95(12): 7024 - 7029.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Tamiya, K.-i. Etoh, H. Suzushima, K. Takatsuki, and M. Matsuoka
Mutation of CD95 (Fas/Apo-1) Gene in Adult T-Cell Leukemia Cells
Blood, May 15, 1998; 91(10): 3935 - 3942.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Beltinger, E. Kurz, T. Bohler, M. Schrappe, W.-D. Ludwig, and K.-M. Debatin
CD95 (APO-1/Fas) Mutations in Childhood T-Lineage Acute Lymphoblastic Leukemia
Blood, May 15, 1998; 91(10): 3943 - 3951.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. D. Pettersen, G. Gaudernack, M. K. Olafsen, S. O. Lie, and K. Hestdal
The TCR-Binding Region of the HLA Class I {alpha}2 Domain Signals Rapid Fas-Independent Cell Death: A Direct Pathway for T Cell-Mediated Killing of Target Cells?
J. Immunol., May 1, 1998; 160(9): 4343 - 4352.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
O. Cuvillier, L. Edsall, and S. Spiegel
Involvement of Sphingosine in Mitochondria-dependent Fas-induced Apoptosis of Type II Jurkat T Cells
J. Biol. Chem., May 19, 2000; 275(21): 15691 - 15700.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Chen and M.-Z. Lai
c-Jun NH2-terminal Kinase Activation Leads to a FADD-dependent but Fas Ligand-independent Cell Death in Jurkat T Cells
J. Biol. Chem., March 9, 2001; 276(11): 8350 - 8357.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Leo, Q. L. Deveraux, C. Buchholtz, K. Welsh, S.-i. Matsuzawa, H. R. Stennicke, G. S. Salvesen, and J. C. Reed
TRAF1 Is a Substrate of Caspases Activated during Tumor Necrosis Factor Receptor-alpha -induced Apoptosis
J. Biol. Chem., March 9, 2001; 276(11): 8087 - 8093.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
G. V. Putcha, C. A. Harris, K. L. Moulder, R. M. Easton, C. B. Thompson, and E. M. Johnson Jr.
Intrinsic and extrinsic pathway signaling during neuronal apoptosis: lessons from the analysis of mutant mice
J. Cell Biol., April 29, 2002; 157(3): 441 - 453.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
F. R. Zhang and M. A. Schwarz
Pro-EMAP II is not primarily cleaved by caspase-3 and -7
Am J Physiol Lung Cell Mol Physiol, June 1, 2002; 282(6): L1239 - L1244.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Eischen, C. M.
Right arrow Articles by Kaufmann, S. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Eischen, C. M.
Right arrow Articles by Kaufmann, S. H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1997 by American Society of Hematology         Online ISSN: 1528-0020