Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jubinsky, P. T.
Right arrow Articles by Sieff, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jubinsky, P. T.
Right arrow Articles by Sieff, C. A.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 90 No. 5 (September 1), 1997: pp. 1867-1873

The beta Chain of the Interleukin-3 Receptor Functionally Associates With the Erythropoietin Receptor

By Paul T. Jubinsky, Oleg I. Krijanovski, David G. Nathan, Jan Tavernier, and Colin A. Sieff

From the Divisions of Pediatric Hematology and Oncology, Dana-Farber Cancer Institute and Children's Hospital, Boston, MA; the Department of Pediatrics and Immunology, Harvard Medical School, Boston, MA; and the Department of Medical Protein Chemistry, University of Ghent, Ghent, Belgium.


    ABSTRACT
Abstract
Introduction
Methods
Results
Discussion
References

Interleukin-3 (IL-3) and granulocyte-macrophage colony-stimulating factor (GM-CSF ) receptors share a common beta chain (beta c), and both cytokines enhance erythropoietin (Epo)-dependent in vitro erythropoiesis by primary hematopoietic progenitors and factor-dependent cells. These data suggest that the Epo receptor and beta c may functionally interact. To determine whether such interactions can be documented, we studied a murine factor-dependent cell line (Ba/F3), which endogenously expresses IL-3R. First, Ba/F3 cells were transfected with murine EpoR, making them responsive to both IL-3 and Epo. Next, the EpoR expressing cells were transfected with murine beta c. This resulted in an enhanced sensitivity of these cells to Epo, which was especially pronounced at low Epo concentrations. Ba/F3-EpoR were then treated with antisense oligodeoxynucleotides to the murine beta . Control sense and nonsense had no effect on Epo-dependent growth, but the antisense markedly and specifically inhibited Epo-dependent growth. In contrast, the antisense did not affect beta -globin message levels (another Epo-responsive effect in these cells) detectable by Northern blot. Finally, Western blot analysis of proteins immunoprecipitated from cells expressing both receptors with antibody against beta and blotted with antibody against EpoR, or immunoprecipitated with antibody against EpoR and blotted with antibody against beta , showed that EpoR and beta coimmunoprecipitate. These data show that the beta chain functionally and physically associates with the EpoR. This suggests that these cytokine receptors exist as a large supercomplex and offers the first molecular explanation for the synergistic effects of IL-3 and GM-CSF with Epo during erythropoiesis.

    INTRODUCTION
Abstract
Introduction
Methods
Results
Discussion
References

SEVERAL HEMATOPOIETIC growth factors are known to be important in the differentiation of stem cells into mature erythrocytes. During the early phases of their growth in vitro, erythroid progenitors require Steel Factor and interleukin-3 (IL-3) or granulocyte-macrophage colony-stimulating factor (GM-CSF ), while at later stages erythropoietin (Epo) becomes necessary for their proliferation and maturation into hemoglobin-containing cells.1-3 The Epo requirement of cells of the erythroid lineage correlates with the expression of Epo receptors on the cell surface.4

The GM-CSF, IL-3, and IL-5 receptors are all comprised of unique alpha chains5-8 that bind their specific ligands with low-affinity and a shared beta chain (beta c ) that alone does not bind ligand, but is essential for high-affinity binding.9 The cytoplasmic portion of beta is believed to contain most of the domains responsible for ligand-induced proliferation.10,11 Additionally, in murine cells, a highly related protein (beta IL-3 ) can form a functional receptor with the IL-3alpha subunit.12 Ligand binding is believed to activate the receptor by inducing the formation of a heterodimer. Unlike the IL-3 and GM-CSF receptors, the Epo receptor is believed to be composed of a single subunit that is activated on ligand-induced homodimerization.13-15 The cytoplasmic region of EpoR has significant amino acid homology to the intracellular portion of beta c .16,17 Because IL-3 and GM-CSF are known to cooperate with Epo in erythropoiesis in vitro2,18,19 and both receptors activate common signal transduction pathways,20 we determined whether the beta subunit is involved in Epo signaling. The results of that inquiry are presented here.

    MATERIALS AND METHODS
Abstract
Introduction
Methods
Results
Discussion
References

Cell lines and cultures. Ba/F3 wild-type cells (Ba/F3 wt) and cDNA encoding the murine erythropoietin receptor (mEpoR) were obtained from A. D'Andrea (Dana-Farber Cancer Institute, Boston, MA).21 Ba/F3 cells were respectively electroporated with the mEpoR and murine beta c (mbeta c) in the pDNA3 or pREP-4 vectors (Invitrogen, San Diego, CA); the latter carries the hygromycin resistance gene. The murine cell line is IL-3-dependent and was grown in serum-free and protein-free hybridoma medium supplemented with glutamine and 10% fetal calf serum (FCS) (Sigma, St Louis, MO). This medium was supplemented with purified recombinant mIL-3 (kindly provided by Immunex, Seattle, WA) for the Ba/F3 wt or 3 U/mL purified recombinant human Epo (Amgen, Thousand Oaks, CA) for Ba/F3-EpoR and Ba/F3-EpoR+ beta c. In addition, the cells transfected with beta c were maintained in 800 µg/mL hygromycin (Calbiochem, La Jolla, CA).

Thymidine incorporation. Ba/F3, Ba/F3-EpoR and Ba/F3-EpoR+ beta c cell lines were washed three times and plated at 2 to 3 × 104 cells/well in triplicate in 160 µL of media containing 10% serum with the appropriate HGFs for 72 hours at 37°C. Three hours and 15 minutes before harvesting, 1 µCi of 3H thymidine (New England Nuclear, Boston, MA) was added to each well. Cells were harvested on filter paper by an automated harvester (Skatron, Tranby, Norway) and counted in a beta counter (Wallac, Gaithersburg, MD).

Binding analysis. Human recombinant Epo was radio-iodinated to a specific activity of 8.6 × 104 cpm/ng (2.92 × 1018 dpm/mol) by the iodine monochloride method.22 A total of 3 to 5 × 106 cells was incubated with graded concentrations of 125I-Epo in RPMI/2% bovine serum albumin/20 mmol/L HEPES/0.2% Na azide for 90 minutes at room temperature to obtain equilibrium binding. Ligand-bound cells were separated by centrifugation through a 3:2 mixture of dibutyl phthalate (Sigma Chemical Co):bis phthalate (Eastman Kodak, Rochester, NY) oil, and cell-associated radioactivity of the pellets was counted in a gamma counter (Cobra Autogamma 5000; Packard Instrument Co, Meriden, CT). Specific binding was obtained by subtracting the radioactivity bound to transfected cells incubated in a 100-fold excess of unlabeled ligand (nonspecific binding) from the radioactivity bound to the transfectants (total binding). The binding data were subjected to Scatchard analysis and the affinity constants confirmed using the LIGAND program.23

Antisense. Ba/F3 and Ba/F3-EpoR cells were grown in media containg 1% albumin, lipids (GIBCO-BRL, Gaithersberg, MD), insulin, transferrin, selenium (all from Boehringer-Mannheim, Indianapolis, IN) with 20 mmol/L deprotected synthetic oligodeoxynucleotide (ODN) (Molecular Biology Core Facility, DFCI, or the Oligonucleotide Synthesis Facility, Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, MA), and the indicated concentrations of IL-3 or Epo. The ODN were designed from the coding sequence of the murine beta c beginning at the first ATG initiation site. The ODN sequences were: antisense --- GAGTGCCATTTGCTGGTCCAT; sense --- ATGGACCAGCAAATGGCACTC; nonsense TGTCGAGTCACTTGCAGTGTC; positive control- polyT-21mer. An additional set of ODNs designed to start at the first internal ATG initiation site was also used. The cells were cultured for 5 days with the ODN, at which time RNA was extracted or cell proliferation measured by thymidine incorporation or direct counting.

Northern hybridization. RNA was prepared by the guanidinium/CsCl method.24 A total of 10 µg per lane was loaded on a 1% agarose-formaldehyde gel, and RNA was separated by electrophoresis at 150 V for 3 hours. RNA was transferred by capillary transfer overnight using 20× SSC to Duralon (Stratagene, La Jolla, CA) nylon membrane. RNA was cross-linked by UV light using a Stratalinker (Stratagene, La Jolla, CA) according to the manufacturer's instructions. The beta -globin DNA probes25 (obtained from Martin Carroll, Brigham and Women's Hospital, Boston, MA) were labeled with 32P using random primed labeling (Boehringer-Mannheim). Blots were prehybridized for 30 minutes at 68°C in a hybridization oven using a commercial hybridization solution (Quik-hyb, Stratagene). Hybridization was done for 2 hours at 68°C. Blots were washed in 2× SSC/0.1% sodium dodecyl sulfate (SDS) at room temperature followed by 0.1× SSC/0.1% SDS at 60°C, and exposed to film.

Immunoprecipitation. Parental Ba/F3 wild-type (wt) and transfected cells were placed on ice and incubated in media containing 2% bovine serum albumin and Epo (100 U/mL) for 1 hour. For Epo stimulation experiments, the cells were washed three times in phosphate-buffered saline (PBS), starved in RPMI/10% FCS for 12 hours, and then incubated for 15 minutes in Epo (50 U/mL). The cells were washed once with PBS, and the pellet solubilized in lysis buffer that contained 1% Triton X100 (Sigma), 150 mmol/L NaCl, 50 mmol/L Tris pH 8.2, with protease and phosphatase inhibitors (10 µg/mL leupeptin, 0.2 U/mL aprotinin, 10 µg/mL leupeptin, 2 mmol/L phenylmethylsulfonyl fluoride, 2 mmol/L Na fluoride, and 1 mmol/L Na orthovanadate). After centrifugation (168,000g for 15 minutes at 4°C), the supernatants were precleared with preimmune rabbit serum and sepharose beads for 1 hour and incubated with antibodies that react with either the n-terminus of the mEpoR26 (gift of A. D'Andrea and D. Barber), the murine beta c and beta IL-3 chain (antibody 21F2),27 or preimmune rabbit serum (Sigma) for 8 hours at 4°C. Protein A sepharose or protein G-plus agarose beads were then added (25 µL packed volume), and after 1.5 hours, the beads were washed three times with 1 mL lysis buffer at 4°C. The bound proteins were eluted from the beads by boiling in Laemmli sample buffer containing 5% beta -mercaptoethanol and were subjected to SDS-polyacrylamide gel electrophoresis (PAGE) (7% to 15% acrylamide gradient). The separated proteins were then transferred to nylon membrane (Hoefer, San Francisco, CA) and immunoblotted with a 1:50 dilution of rabbit polyclonal antibodies26 to the c-terminus of EpoR or a 1:100 dilution of a mixture of n- and c- terminus antibodies, or rabbit polyclonal antimouse IL-3/IL-5/GM-CSFR beta c antibody (#K-17 Santa Cruz Biotechnology, Santa Cruz, CA). The membrane was washed and the bound antibodies detected with horseradish peroxidase secondary antibodies and enhanced chemiluminescence, as described by the manufacturers (ECL Western Blotting; Amersham, Arlington Heights, IL).

    RESULTS
Abstract
Introduction
Methods
Results
Discussion
References

beta c potentiates erythropoietin-dependent growth. To determine if the beta c chain of the IL-3 receptor could functionally interact with EpoR in mediating a proliferative response, Ba/F3 cells that stably expressed the EpoR were transfected with a plasmid containing the hygromycin resistance gene with or without the cDNA of beta c . After selecting the cells in hygromycin, the cells were cultured in the various concentrations of IL-3 or Epo and their growth was measured by thymidine incorporation. Figure 1A shows the effect that the transfection of beta c has on the response of the cells to Epo. Figure 1B is the same plot normalized as a ratio of maximum proliferation to allow better comparision of the proliferative response to growth factor. Both Ba/F3-EpoR and Ba/F3-EpoR+ beta c required Epo for survival and responded to Epo in a dose-dependent manner. However, the Ba/F3-EpoR+ beta c had a greater sensitivity to Epo than Ba/F3-EpoR. The difference was most pronounced at the lowest Epo concentrations. In contrast, both cell lines had an identical proliferative response to IL-3 (Fig 1C and D), showing that the beta c transfection did not effect the Epo dose response by nonspecifically enhancing the sensitivity of the cells to all growth factors. These results were obtained using nonclonal cells from three independent electroporation experiments.


View larger version (27K):
[in this window]
[in a new window]
 
Fig 1. Effect of beta c on the proliferative response of Ba/F3-EpoR to Epo. Tritiated thymidine incorporation assay of Ba/F3-EpoR+ beta c (bullet ) or Ba/F3-EpoR (open circle ) grown in various concentrations of Epo (A and B) or mIL-3 (C and D). (B and D), respectively, represent the data in (A and C) normalized to maximal proliferation. The upper panels show that cells transfected with beta c (bullet ) have a greater sensitivity to Epo than cells that were not (open circle ). The lower panels show that the dose response of the same cells to IL-3 was not affected.

To test the possibility that a significant difference in receptor number or ligand binding affinity could be responsible for the different Epo dose response seen in the Ba/F3-EpoR and EpoR+ beta c cells, equilibrium binding assays using 125I Epo were performed. The results of these assays showed that EpoR expression and affinity in Ba/F3-EpoR (Kd = 374 pmol/L, 350 sites per cell) and Ba/F3-EpoR+ beta c (Kd = 365 pmol/L, 200 to 500 sites per cell), were similar (data not shown).

Antisense to beta mRNA inhibits erythropoietin-dependent growth. Because Ba/F3-EpoR+ beta c appeared to be more sensitive to Epo than Ba/F3-EpoR, we needed to confirm the functional interaction between the two receptors by an independent method. Therefore, we decided to test whether antisense ODN to beta could inhibit the Epo-dependent proliferation of Ba/F3 cells. Ba/F3-EpoR were cultured in media containing 20 mmol/L ODN and varying concentrations of Epo or IL-3. After 5 days in culture, tritiated thymidine incorporation was measured as shown in Fig 2 (data are representative of four experiments). Addition of beta antisense ODN to the samples significantly inhibited the growth of Ba/F3-EpoR cultured in Epo (Fig 2A). Compared with either sense or nonsense, the samples with antisense ODN had approximately one half the number of cpm. This inhibitory effect was observed over the entire range of Epo concentrations tested and was even maintained at saturation levels of Epo. However, despite the significant reduction in the level of thymidine incorporation compared with the controls, the antisense ODN were not as inhibitory as equimolar concentrations of the positive control ODN, polyT. These results were independently confirmed by counting the cells after incubation in the different ODN (data not shown). Each of the individual ODN had similar effects when the cells were cultured in IL-3 (Fig 2B). The addition of antisense reduced IL-3-dependent growth at all concentrations of IL-3. An identical response was noted when another antisense oligonucleotide designed to hybridize with the beta RNA beginning at the first internal ATG start site was tested under both conditions (data not shown). Despite its effect on Ba/F3-EpoR, beta antisense oligonucleotide was unable to inhibit Ba/F3-EpoR+ beta c at any concentration of IL-3 (data not shown).


View larger version (20K):
[in this window]
[in a new window]
 
Fig 2. Effect of oligodeoxynucleotides to beta mRNA on the proliferation of Ba/F3-EpoR cells. Cells were cultured serum-free in the presence of 20 mmol/L antisense (bullet ), sense (black-square), nonsense (square ) or positive control (open circle ) oligonucleotides in the presence of Epo (A) or mIL-3 (B), and thymidine incorporation was measured on day 5. The results show that antisense oligonucleotides significantly reduces the growth of the cells compared with either sense or nonsense oligonucleotides.

Antisense to beta mRNA does not affect beta globin expression. Having established that antisense to beta mRNA specifically inhibits Epo-dependent proliferation of Ba/F3-EpoR, we wanted to determine if antisense to beta could also influence the ability of Epo to increase the level of beta -globin message found in the cells (Fig 3). Ba/F3-EpoR cells were treated with the oligonucleotides identically to the method used in the proliferation experiment except that on day 5, instead of adding thymidine, total cellular RNA was extracted and then analyzed by Northern blot. Cells that were cultured in mIL-3 expressed low levels of beta -globin mRNA (Fig 3, lane 1). Incubating the cells in Epo (Fig 3, lanes 2 to 4) instead of IL-3 significantly enhanced the amount of beta -globin message detected in these cells, as has been previously reported.25,28,29 However, in contrast to the significant effect that the antisense oligonucleotide had on Epo-dependent cell proliferation, the level of beta -globin message in the presence of beta antisense (Fig 3, lane 2) was similar to the level observed with both the sense (Fig 3, lane 3), and nonsense (Fig 3, lane 4) oligonucleotide controls. These findings were unchanged when the experiment was done at higher concentrations of Epo or if the mRNA was extracted on day 7. The upper part of Fig 3 shows the amount of ribosomal RNA present in each lane and shows that the total amount of RNA loaded in each lane is similar. This experiment was performed three times.


View larger version (36K):
[in this window]
[in a new window]
 
Fig 3. Effect of oligonucleotides to beta mRNA on beta -globin mRNA levels. Ba/F3-EpoR cells were cultured in IL-3 (lane 1) or with 20 mmol/L antisense (lane 2), sense (lane 3), or nonsense (lane 4) in the presence of Epo, and beta -globin message levels were determined by northern blot analysis. The increased levels of beta -globin mRNA induced by Epo were identical in each of the samples containing oligodeoxynucleotides.

EpoR physically associates with beta . The EpoR and beta are proteins that bind ligand at the cell surface. Thus, it is possible that the two receptors associate to mediate their cooperative effects on proliferation. To investigate whether the proteins are physically associated, an immunoprecipitation experiment was performed (Fig 4). Ba/F3, or Ba/F3-EpoR+/-beta c were incubated at 4°C with Epo and then were solubilized with Triton X100. Antibody against either beta , the n-terminus of EpoR, or nonspecific control antibody was added to the soluble extract and this was followed by an incubation with protein G sepharose. The immunoprecipitated proteins were transferred to nitrocellulose after SDS-PAGE and were blotted with antibody reactive against the c-terminus of the Epo receptor. An autoradiograph of the results is shown in Fig 4A. As a positive control, the proteins of Ba/F3-EpoR cells were immunoprecipitated with antibody against the n-terminus of EpoR. A broad band corresponding to the EpoR was observed by Western blot (Fig 4A, lane 2). When the same cells were immunoprecipitated with monoclonal antibody against beta and again blotted with antibody against c-terminal EpoR, a less intense band with slightly higher average molecular weight was seen (Fig 4A, lane 1). In contrast, the EpoR band was not present when Ba/F3-EpoR was precipitated with preimmune serum (Fig 4A, lane 3) or when parental (nontransfected) Ba/F3 cells were precipitated with the anti-n-terminal EpoR antibody (Fig 4A, lane 4). To test if the association between EpoR and beta c correlated with the cooperative growth effects, the Ba/F3-EpoR+ beta c used in the proliferation assays was also immunoprecipitated with antibody against beta . A band identical in size to the one seen in Fig 4A, lane 1, but consistently more intense, was observed (Fig 4A, lane 5). These data are representative of four experiments.


View larger version (27K):
[in this window]
[in a new window]
 


View larger version (39K):
[in this window]
[in a new window]
 
Fig 4. (A) Coimmunoprecipitation of EpoR with beta . Ba/F3, Ba/F3-EpoR, and Ba/F3-EpoR+ beta c cells were incubated with Epo, and the solubilized proteins were immunoprecipitated with anti-EpoR (n-terminus), anti-beta , or control antibody. After gel electrophoresis the immunoprecipitated proteins were transferred to nitrocellulose and blotted with antibody against EpoR c-terminus. Ba/F3-EpoR immunoprecipitated with antibody against beta (lane 1), antibody against EpoR (lane 2), or control antibody (lane 3). Ba/F3 immunoprecipitated with anti-EpoR (lane 4). Ba/F3-EpoR+ beta c immunoprecipitated with antibody against beta (lane 5). Bands corresponding to EpoR were observed when EpoR expressing cells were immunoprecipitated with antibody against either EpoR or beta . (B) Coimmunoprecipitation of beta with EpoR. Ba/F3-EpoR+ beta c cells were cultured without growth factor for 8 hours and then incubated in medium alone (lanes 1, 2, and 4) or medium containing Epo (50 U/mL) for 15 minutes (lane 3). The solubilized proteins were immunoprecipitated with either antibodies to the n-terminus of the EpoR (lanes 1 to 3) or monoclonal antibody to beta (lane 4). After SDS-PAGE (7.5% acrylamide), the separated proteins were transferred to nylon membrane and immunoblotted with EpoR antibody (lane 1) or with polyclonal rabbit antibody against beta c (lanes 2, 3, and 4). Bands corresponding to beta were observed to similarly coimmunoprecipitate with EpoR in the presence or absence of Epo.

To confirm the physical association between EpoR and beta , the converse immunoprecipitation and Western blot analysis was performed (Fig 4B). In this experiment, Ba/F3-EpoR+ beta c cells were cultured without Epo for 8 hours and then incubated with or without Epo (15 minutes) to determine if the coimmunoprecipitation is affected by the presence or absense of Epo. The solubilized cell extracts were immunoprecipitated with antibodies to the n-terminus of EpoR, or with antibody against beta . After electrophoresis and transfer to nylon membrane, the immunoprecipitated proteins were blotted with antibodies to EpoR or beta c (this antibody reacts specifically with beta c). An appropriate sized band for the Epo receptor is seen when the Ba/F3-EpoR+ beta c cells are immunoprecipitated with anti-EpoR and blotted with antibody against EpoR (Fig 4B, lane 1). When the proteins immunoprecipitated with antibody against EpoR were blotted with antibodies against beta c (Fig 4B, lanes 2 and 3), 140 kD- sized bands corresponding to beta c are visible. No difference in band intensity was observed when the immunoprecipitation was done in the absence (Fig 4B, lane 2) or presence (Fig 4B, lane 3) of Epo. These data substantiate the specificity of the EpoR-beta association shown in Fig 4A and imply that the presence of Epo is not required for the interaction. The positive control, beta immunoprecipitation followed by beta c immunoblot (Fig 4B, lane 4), confirms the identity of beta c . This band is also much more prominent than the corresponding band in lanes 2 and 3 (Fig 4B). One interpretation is that only a small portion of the total amount of beta c found in cells is associated with the EpoR; another is that the immunoprecipitation is not efficient. Bands corresponding to EpoR or beta c were not detected by immunoblot when preimmune sera or control antibody was used for the immunoprecipitation step (data not shown). This figure is one of two independent experiments.

    DISCUSSION
Abstract
Introduction
Methods
Results
Discussion
References

Early studies showing that GM-CSF and IL-3 could enhance the effects of Epo on primary cells and cell lines first suggested the possibility that beta and EpoR might interact.2,30,31 In this report, we show that transfection of beta c into Ba/F3-EpoR cells significantly increases the growth sensitivity of the cells to Epo. The increase in proliferation is more pronounced at low Epo concentrations, suggesting that whatever the mechanism, the amount of beta may be limiting. Confirming this observation, we find that antisense to beta specifically inhibits Epo-stimulated cell proliferation. Antisense experiments have also suggested that the IL-3 receptor may interact with the thrombopoietin receptor (c-mpl).32 Thus, the most likely interpretation of these data is that beta functionally influences the EpoR proliferative signaling pathway. However, this does not infer that beta is required for Epo-induced cell growth. One possible explanation is that beta helps to stabilize or maintain an active receptor complex. It could do so by associating with the EpoR to form binding sites for accessory molecules such as JAK2,33,34 by inhibiting negative regulatory molecules such as phosphatases,35,36 or by increasing receptor half-life. Recently, Nicola et al37 showed that beta c is also an important component in the receptor transmodulation of the G-CSF and M-CSF receptors.

Despite inhibiting cell growth, beta antisense did not affect beta -globin mRNA levels. In an earlier study,38 we showed that human beta c augmented beta -globin message levels in cells that expressed a hybrid GM-CSF/EpoR receptor (GMER). We, therefore, expected that the antisense might reduce beta -globin mRNA levels. One explanation may be that strong EpoR-beta c heterodimers are more efficient than weak GMER dimers, but less efficient than strong EpoR homodimers in increasing beta -globin mRNA; another is that changes in beta -globin message levels may be less sensitive than growth to the contribution provided by beta c . Finally, any noticable decrease in beta -globin message could have been off-set by an increase in beta globin level that is known to correlate with decreased cell cycling in Ba/F3-EpoR cells.25 In addition to their functional interaction, we show by coimmunoprecipitation experiments that beta and EpoR also physically associate in an Epo-independent manner.

Other investigations have supported the possibility that these two proteins could functionally interact. Several groups have observed that the transfection of EpoR into IL-3-dependent cells permitted the cells to acquire Epo responsiveness, but the transfection of EpoR into cells that do not express endogenous beta c did not result in Epo responsiveness39,40; the latter result, obtained in the CTLL-2 cell line, is however controversial.41 Hanazono et al42 showed that Epo stimulates tyrosine phosphorylation of beta c in the UT-7 cell line. In contrast, IL-3 is not able to stimulate the phosphorylation of the EpoR.43 Analogously, Steel Factor has also been shown to induce serine/threonine phosphorylation of the IL-3R.44

Deletion of the beta subunit by homologous recombination could provide confirmatory evidence that the EpoR and beta interact. However, animals deficient in either beta c or beta IL-3 have not been reported to have impaired eythropoiesis,45,46 and recently similar results were reported for IL-3/beta c double mutant mice that lack IL-3, GM-CSF, and IL-5 function.47 It is possible that a more detailed analysis such as testing the sensitivity of erythroid precursors to Epo in these animals might show a more subtle defect. It should be noted that all of these knockout animals have one beta chain intact, and it is possible that Epo interacts with the nondisrupted beta chain in these animals, providing an explanation for the absence of anemia. Therefore, mice deficient in both beta c and beta IL-3 will need to be assessed, as these two chains have functional redundancy. Such mice would be more analogous to our studies, as the antisense oligodeoxynucleotide we used would affect mRNA of both of these proteins because of sequence identity. Interestingly, our data, together with experiments by Wu et al48 who reported that the c-kit receptor also interacts with the EpoR, provide evidence that EpoR receptors may exist as a large complex of associated proteins.

In conclusion, we show here that the beta has a role in the Epo-dependent proliferation of Ba/F3 cells that express EpoR, but has a more limited influence on beta -globin message expression, another function ascribed to Epo in these cells. We also provide evidence that the cooperative effects of the two receptors on cell growth may be mediated by a direct physical association between the two proteins. The data provide an explanation for the synergistic effects of IL-3/GM-CSF and erythropoietin during in vitro erythropoiesis.

    FOOTNOTES

   Submitted September 5, 1996; accepted May 7, 1997.
   Supported by U.S. Public Health Service Award GM 13452 (Bethesda, MD), RO1 CA45559 (National Institutes of Health), and the Charles H. Hood Foundation (Boston, MA). P.T.J. is the recipient of a Clinical Oncology Career Development Award from the American Cancer Society (Atlanta, GA).
   Address reprint requests to Paul T. Jubinsky, MD, PhD, Children's Hospital Medical Center, Hematology and Oncology, 3333 Burnet Ave, Cincinnati, OH 45229-3039.

   The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hearly marked ``advertisment'' in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

    REFERENCES
Abstract
Introduction
Methods
Results
Discussion
References

1. Sieff CA, Emerson SG, Donahue RE, Nathan DG, Wang EA, Wong GG, Clark SC: Human recombinant granulocyte-macrophage colony-stilating factor: A multilineage hematopoietin. Science 230:1171, 1985[Abstract/Free Full Text]

2. Sieff CA, Ekern SC, Nathan DG, Anderson JW: Combinations of recombinant colony stimulating factors are required for optimal hematopoietic differentiation in serum-deprived culture. Blood 73:688, 1989[Abstract/Free Full Text]

3. Lipton JM, Kudisch M, Nathan DG: Response of three classes of human erythroid progenitors to the absence of erythropoietin in vitro as a measure of progenitor maturity. Exp Hematol 9:1035, 1981[Medline] [Order article via Infotrieve]

4. Sawada KS, Krantz B, Dai C-H, Koury ST, Horn ST, Glick AD, Civin CI: Purification of human blood burst-forming units-erythroid and demonstration of the evolution of erythropoietin receptors. J Cell Physiol 142:219, 1990[Medline] [Order article via Infotrieve]

5. Gearing DP, King JA, Gough NM, Nicola NA: Expression cloning of a receptor for human granulocyte-macrophage colony-stimulating factor. EMBO J 8:3667, 1989[Medline] [Order article via Infotrieve]

6. Crosier KE, Wong GG, Mathey-Prevot B, Nathan DG, Sieff CA: A functional isoform of the human granulocyte-macrophage colony-stimulating factor receptor contains a unique cytoplasmic domain. Proc Natl Acad Sci USA 88:7744, 1991[Abstract/Free Full Text]

7. Kitara T, Sato N, Arai K, Miyajima A: Expression cloning of the human IL-3 receptor cDNA reveals a shared beta subunit for the human IL-3 and GM-CSF receptors. Cell 66:1165, 1991[Medline] [Order article via Infotrieve]

8. Tavernier J, Devos R, Cornelis S, Tuypens T, Van der Heyden J, Fiers W, Plaetinck G: A human high affinity interleukin-5 receptor (IL5R) is composed of an IL5-specific alpha chain and a beta chain shared with the receptor for GM-CSF. Cell 66:1175, 1991[Medline] [Order article via Infotrieve]

9. Hayashida K, Kitara T, Gorman DM, Arai K-1, Yokota T, Miyajima A: Molecular cloning of a second subunit of the receptor for human granulocyte-macrophage colony-stimulating factor (GM-CSF ): Reconstitution of a high-affinity GM-CSF receptor. Proc Natl Acad Sci USA 87:9655, 1990[Abstract/Free Full Text]

10. Sato N, Sakamaki K, Terada N, Arai K-1, Miyajima A: Signal transduction by the high-affinity GM-CSF receptor: Two distinct cytoplasmic regions of the common beta subunit responsible for different signaling. EMBO J 12:4181, 1993[Medline] [Order article via Infotrieve]

11. Weiss M, Yokoyama C, Shikama Y, Naugle C, Druker B, Sieff CA: Human granulocyte-macrophage colony-stimulating factor receptor signal transduction requires the proximal cytoplasmic domains of the alpha and beta subunits. Blood 82:3298, 1993[Abstract/Free Full Text]

12. Hara T, Miyajima A: Two distinct functional high affinity receptors for mouse interleukin-3 (IL-3). EMBO J 11:1875, 1992[Medline] [Order article via Infotrieve]

13. Watowich SS, Yoshira A, Longmore GD, Hilton DJ, Yoshira Y, Lodish HF: Homodimerization and constitutive activation of the erythropoietin receptor. Proc Natl Acad Sci USA 89:2140, 1992[Abstract/Free Full Text]

14. Watowich SS, Hilton DJ, Lodish HF: Activation and inhibition of erythropoietin receptor function: Role of receptor dimerization. Mol Cell Biol 14:3535, 1994[Abstract/Free Full Text]

15. Livnah O, Stura EA, Johnson DL, Middleton SA, Mulcahy LS, Wrighton NC, Dower WJ, Jolliffe LK, Wilson IA: Functional mimicry of a protein hormone by a peptide antagonist: The EPO receptor complex at 2.8A. Science 273:464, 1996[Abstract]

16. Bazan JF: Haemopoietic receptors and helical cytokines. Immunol Today 11:350, 1990[Medline] [Order article via Infotrieve]

17. D'Andrea AD: Hematopoietic growth factors and the regulation of differentiative decisions. [Review]. Curr Opin Cell Biol 6:804, 1994[Medline] [Order article via Infotrieve]

18. Goodman JW, Hall EA, Miller KL, Shinpock SG: Interleukin 3 promotes erythroid burst formation in "serum-free" cultures without detectable erythropoietin. Proc Natl Acad Sci USA 82:3291, 1985[Abstract/Free Full Text]

19. Monette FC, Sigounas G: Growth of murine multipotent stem cells in a simple "serum-free" culture system: Role of interleukin-3, erythropoietin, and hemin. Exp Hematol 16:250, 1988[Medline] [Order article via Infotrieve]

20. Pallard C, Gouilleux F, Charon M, Groner B, Gisselbrecht S: Interleukin-3, erythropoietin, and prolactin activate a STAT5-like factor in lymphoid cells. J Biol Chem 270:15942, 1995[Abstract/Free Full Text]

21. D'Andrea AD, Yoshira A, Youssoufian H, Zon LI, Koo J-W, Lodish H: The cytoplasmic region of the erythropoietin receptor contains nonoverlapping positive and negative growth-regulatory domains. Mol Cell Biol 11:1980, 1991[Abstract/Free Full Text]

22. Contreras MA, Bale WF, Spar IL: Iodine monochloride (ICl) iodination techniques. Methods Enzymol 92:277, 1983[Medline] [Order article via Infotrieve]

23. Munson PJ, Rodbard D: LIGAND: A versatile computerized approach for characterization of ligand-binding systems. Anal Biochem 107:220, 1980[Medline] [Order article via Infotrieve]

24. Chirgwin JM, Przybila AE, MacDonald RJ, Rutter WJ: Isolation of biological active ribonucleic acid from a source enriched in ribonuclease. Biochemistry 18:5294, 1979[Medline] [Order article via Infotrieve]

25. Carroll M, Zhu Y, D'Andrea AD: Erythropoietin-induced cellular differentiation requries prolongation of the G1 phase of the cell cycle. Proc Natl Acad Sci USA 92:2869, 1995[Abstract/Free Full Text]

26. Yoshira A, D'Andrea AD, Lodish HF: Friend spleen focus-forming virus glycoprotein gp55 interacts with the erythropoietin receptor in the endoplasmic reticulum and affects receptor metabolism. Proc Natl Acad Sci USA 87:4139, 1990[Abstract/Free Full Text]

27. Van der Heyden J, Devos R, Plaetinck G, Fache I, Fiers W, Tavernier J: Characterization of the murine IL-5 receptor complex with the use of a panel of monoclonal antibodies. J Immunol 147:3413, 1991[Abstract]

28. Liboi E, Carroll M, D'Andrea AD, Mathey-Prevot B: Erythropoietin receptor signals both proliferation and erythroid-specific differentiation. Proc Natl Acad Sci USA 90:11351, 1993[Abstract/Free Full Text]

29. Krosl J, Damen JE, Krystal G, Humphries RK: Erythropoietin and interluekin-3 induce distinct events in erythropoietin receptor-expressing BA/F3 cells. Blood 85:50, 1995[Abstract/Free Full Text]

30. Donahue RE, Emerson SG, Wang EA, Clark SC, Nathan DG: Demonstration of burst-promoting activity of recombinant human GM-CSF on circulating erythroid progenitors using an assay involving delayed addition of erythropoietin. Blood 66:1479, 1985[Abstract/Free Full Text]

31. Sonoda Y, Yang YC, Wong GG, Clark SC, Ogawa M: Erythroid burst-promoting activity of purified recombinant human GM-CSF and interleukin-3: Studies with anti-GM-CSF and anti-IL-3 sera and studies in serum-free cultures. Blood 72:1381, 1988[Abstract/Free Full Text]

32. Morella KK, Bruno E, Kumaki S, Lai CF, Fu J, Wang HM, Murray L, Hoffman R, Timour M, Benit L, Gisselbrecht S, Zhuang H, Wojchowski DM, Baumann H, Gearing DP: Signal transduction by the receptors for thrombopoietin (c-mpL) and interleukin-3 in hematopoietic and nonhematopoietic cells. Blood 86:557, 1995[Abstract/Free Full Text]

33. Witthuhn BA, Quelle FW, Silvennoinen O, Yi T, Tang B, Miura O, Ihle JN: JAK2 associates with the erythropoietin receptor and is tyrosine phosphorylated and activated following stimulation with erythropoietin. Cell 74:227, 1993[Medline] [Order article via Infotrieve]

34. Silvennoinen O, Witthuhn BA, Quelle FW, Cleveland JL, Yi T, Ihle JN: Structure of the murine JAK2 protein tyrosine kinase and its role in IL-3 signal transduction. Proc Natl Acad Sci USA 90:8429, 1993[Abstract/Free Full Text]

35. Yi T, Mui AL, Krystal G, Ihle JN: Hematopoietic cell phosphatase associates with the interleukin-3 (IL-3) receptor beta chain and down-regulates IL-3-induced tyrosine phosphorylation and mitogenesis. Mol Cell Biol 13:7577, 1993[Abstract/Free Full Text]

36. Yi T, Zhang J, Miura O, Ihle JN: Hematopoietic cell phosphatase associates with erythropoietin (Epo) receptor after Epo-induced receptor tyrosine phosphorylation: Identification of potential binding sites. Blood 85:87, 1995[Abstract/Free Full Text]

37. Nicola NA, Robb L, Metcalf D, Cary D, Drinkwater CD, Begley CG: Functional inactivation in mice of the gene for the interleukin-3 (IL-3)-specific receptor beta -chain: Implications for IL-3 function and the mechanism of receptor transmodulation in hematopoietic cells. Blood 87:2665, 1996[Abstract/Free Full Text]

38. Jubinsky PT, Shikama Y, Laurie A, Nathan DG, Carroll M, Sieff CA: The beta c component of the GM-CSF/IL-3/IL-5 receptor interacts with a hybrid GM-CSF/Epo receptor to influence proliferation and beta -globin mRNA expression. Mol Med 2:766, 1996[Medline] [Order article via Infotrieve]

39. Yamara Y, Kageyama Y, Matsuzaki T, Noda M, Ikawa Y: Distinct downstream signaling mechanism between erythropoietin receptor and interleukin-2 receptor. EMBO J 11:4909, 1992[Medline] [Order article via Infotrieve]

40. Ihle JN, Quelle FW, Miura O: Signal transduction through the receptor for erythropoietin. Semin Immunol 5:375, 1993[Medline] [Order article via Infotrieve]

41. Barber DL, D'Andrea AD: Erythropoietin and interleukin-2 activate distinct JAK kinase family members. Mol Cell Biol 14:6506, 1994[Abstract/Free Full Text]

42. Hanazono Y, Sasaki K, Hiroyuki N, Yazaki Y, Hirai H: Erythropoietin induces tyrosine phosphorylation of the beta chain of the GM-CSF receptor. Biochem Biophys Res Commun 208:1060, 1995[Medline] [Order article via Infotrieve]

43. Miura O, D'Andrea A, Kabat D, Ihle JN: Induction of tyrosine phosphorylation by the erythropoietin receptor correlates with mitogenesis. Mol Cell Biol 11:4895, 1991[Abstract/Free Full Text]

44. Liu L, Cutler RL, Mui AL, Krystal G: Steel factor stimulates the serine/threonine phosphorylation of the interleukin-3 receptor. J Biol Chem 269:16774, 1994[Abstract/Free Full Text]

45. Nishinakara R, Nakayama N, Hirabayashi Y, Inoue T, Aud D, McNeil T, Azuma S, Yoshida S, Toyoda Y, Arai K-I, Miyajima A, Murray R: Mice deficient for the IL-3/GM-CSF/IL-5 beta c receptor exhibit lung pathology and impaired immune response while beta IL3 receptor-deficient mice are normal. Immunity 2:211, 1995[Medline] [Order article via Infotrieve]

46. Stanley E, Lieschke GJ, Grail D, Metcalf D, Hodgson G, Gall JA, Maher DW, Cebon J, Sinickas V, Dunn AR: Granulocyte/macrophage colony-stimulating factor-deficient mice show no major perturbation of hematopoiesis but develop a characteristic pulmonary pathology. Proc Natl Acad Sci USA 91:5592, 1994[Abstract/Free Full Text]

47. Nishinakara R, Miyajima A, Mee PJ, Tybulewicz VLJ, Murray R: Hematopoiesis in mice lacking the entire granulocyte-macrophage colony-stimulating factor/interleukin-3/interleukin-5 functions. Blood 88:2458, 1996[Abstract/Free Full Text]

48. Wu H, Klingmüller U, Besmer P, Lodish HF: Interaction of the erythropoietin and stem-cell-factor receptors. Nature 377:242, 1995[Medline] [Order article via Infotrieve]


© 1997 by The American Society of Hematology.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
BloodHome page
L. Sautina, Y. Sautin, E. Beem, Z. Zhou, A. Schuler, J. Brennan, S. I. Zharikov, Y. Diao, J. Bungert, and M. S. Segal
Induction of nitric oxide by erythropoietin is mediated by the {beta} common receptor and requires interaction with VEGF receptor 2
Blood, January 28, 2010; 115(4): 896 - 905.
[Abstract] [Full Text] [PDF]


Home page
Therapeutic Advances in Neurological DisordersHome page
C. Bartels, K. Spate, H. Krampe, and H. Ehrenreich
Review: Recombinant human erythropoietin: novel strategies for neuroprotective/neuroregenerative treatment of multiple sclerosis
Therapeutic Advances in Neurological Disorders, November 1, 2008; 1(3): 193 - 206.
[Abstract] [PDF]


Home page
The OncologistHome page
F. Mannello and G. A. M. Tonti
Erythropoietin and Its Receptor in Breast Cancer: Putting Together the Pieces of the Puzzle
Oncologist, July 1, 2008; 13(7): 761 - 768.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. J. Welch, J. A. Watts, C. R. Vakoc, Y. Yao, H. Wang, R. C. Hardison, G. A. Blobel, L. A. Chodosh, and M. J. Weiss
Global regulation of erythroid gene expression by transcription factor GATA-1
Blood, November 15, 2004; 104(10): 3136 - 3147.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Brines, G. Grasso, F. Fiordaliso, A. Sfacteria, P. Ghezzi, M. Fratelli, R. Latini, Q.-w. Xie, J. Smart, C.-j. Su-Rick, et al.
Erythropoietin mediates tissue protection through an erythropoietin and common {beta}-subunit heteroreceptor
PNAS, October 12, 2004; 101(41): 14907 - 14912.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
M. Leist, P. Ghezzi, G. Grasso, R. Bianchi, P. Villa, M. Fratelli, C. Savino, M. Bianchi, J. Nielsen, J. Gerwien, et al.
Derivatives of Erythropoietin That Are Tissue Protective But Not Erythropoietic
Science, July 9, 2004; 305(5681): 239 - 242.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
T. J. Blake, B. J. Jenkins, R. J. D'Andrea, and T. J. Gonda
Functional cross-talk between cytokine receptors revealed by activating mutations in the extracellular domain of the {beta}-subunit of the GM-CSF receptor
J. Leukoc. Biol., December 1, 2002; 72(6): 1246 - 1255.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. G. Jegalian, A. Acurio, G. Dranoff, and H. Wu
Erythropoietin receptor haploinsufficiency and in vivo interplay with granulocyte-macrophage colony-stimulating factor and interleukin 3
Blood, April 1, 2002; 99(7): 2603 - 2605.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Hisakawa, D. Sugiyama, I. Nishijima, M.-j. Xu, H. Wu, K. Nakao, S. Watanabe, M. Katsuki, S. Asano, K.-i. Arai, et al.
Human granulocyte-macrophage colony-stimulating factor (hGM-CSF) stimulates primitive and definitive erythropoiesis in mouse embryos expressing hGM-CSF receptors but not erythropoietin receptors
Blood, December 15, 2001; 98(13): 3618 - 3625.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. G. Otto, V. C. Broudy, N. L. Lin, E. Parganas, J. N. Luthi, J. G. Drachman, J. N. Ihle, and C. A. Blau
Membrane localization is not required for Mpl function in normal hematopoietic cells
Blood, October 1, 2001; 98(7): 2077 - 2083.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. G. Otto, L. Jin, D. M. Spencer, and C. A. Blau
Cell proliferation through forced engagement of c-Kit and Flt-3
Blood, June 1, 2001; 97(11): 3662 - 3664.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. L. Scott, L. Robb, B. Papaevangeliou, R. Mansfield, N. A. Nicola, and C. G. Begley
Reassessment of interactions between hematopoietic receptors using common beta-chain and interleukin-3-specific receptor beta-chain-null cells: no evidence of functional interactions with receptors for erythropoietin, granulocyte colony-stimulating factor, or stem cell factor
Blood, August 15, 2000; 96(4): 1588 - 1590.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. C. Orban, M. K. Levings, and J. W. Schrader
Heterodimerization of the alpha and beta Chains of the Interleukin-3 (IL-3) Receptor Is Necessary and Sufficient for IL-3-Induced Mitogenesis
Blood, September 1, 1999; 94(5): 1614 - 1622.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jubinsky, P. T.
Right arrow Articles by Sieff, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jubinsky, P. T.
Right arrow Articles by Sieff, C. A.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1997 by American Society of Hematology         Online ISSN: 1528-0020