Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hillion, J.
Right arrow Articles by Bernard, O.A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hillion, J.
Right arrow Articles by Bernard, O.A.
Related Collections
Right arrow Neoplasia
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 90 No. 9 (November 1), 1997: pp. 3714-3719

AF6q21, a Novel Partner of the MLL Gene in t(6; 11)(q21; q23), Defines a Forkhead Transcriptional Factor Subfamily

By Josette Hillion, Maryvonne Le Coniat, Philippe Jonveaux, Roland Berger, and O.A. Bernard

From Unité Institut National de la Santé et de la Recherche Médicale (INSERM) U301 and Structure d' Intervention (SD) 401 No. 301 Centre National de la Recherche Scientifique (CNRS), Institut de Génétique Moléculaire, Paris; and Laboratoire de Génétique, Centre Hospitalier Universitaire (CHU), Hôpitaux de Brabois, Vandoeuvre, France.



    ABSTRACT
Abstract
Introduction
Methods
Results
Discussion
References

Fusion genes implicating the MLL gene have been recently demonstrated in various 11q23 chromosomal abnormalities in human hematopoietic malignancies. We analyzed a t(6; 11)(q21; q23) translocation detected in a secondary acute myeloblastic leukemia. This translocation results in fusion of the MLL gene on 11q23 to a previously unknown gene on chromosome 6 that differs from the previously reported MLL partner gene AF6q. The novel gene, named AF6q21, encodes a forkhead (FH) protein with strong similarities to the two FH family members whose genes are already known to be involved in chromosomal translocations of human malignancies, AFX and FKHR. Strikingly, in these translocations the breakpoints are located at the same position within the FH domains. Therefore, AF6q21, AFX, and FKHR could define a new FH subfamily particularly involved in human malignancies.



    INTRODUCTION
Abstract
Introduction
Methods
Results
Discussion
References

CHROMOSOMAL BAND 11q23 is nonrandomly rearranged with approximately 30 other bands in chromosomal abnormalities of malignant blood disorders.1-4 Most rearrangements of 11q23 occur within a clustered region of 8.3 kb and result in the fusion of the MLL gene, normally localized to 11q23, to a partner gene on the other chromosome. Based on molecular and cytogenetic data, the crucial chimeric gene has been hypothesized to be the 5' MLL-partner 3' fusion,5 and this has been recently demonstrated using "knock-in" mice expressing a fused MLL-AF9 product.6 Ten of these chimeric genes have been identified to date, and no common features or homologies have been found that might explain their involvement in these nonrandom events.3,4 Some partner genes are clearly related to each other, such as AF9/ENL and AF17/AF10. Interestingly, AF10 is also found to be rearranged independently of MLL in the t(10; 11)(p13; q14) chromosomal translocation observed in the human leukemic cell line U937.7 Identification of other partners of MLL is now in progress to try to understand the consequences of the fusion of MLL to so many various partner genes.

The detection of t(6; 11)(q21; q23) in a patient with secondary acute leukemia (AL) prompted us to identify the resulting molecular rearrangement. This region of chromosome 6q is indeed rearranged in a variety of hematopoietic disorders.2


    SUBJECTS AND METHODS
Abstract
Introduction
Methods
Results
Discussion
References

Patient. M.D., a 40-year-old man, was examined for AL in the Department of Hematology of Hospital Saint-Louis. He had been treated for Hodgkin's disease. When AL was discovered, the bone marrow was hypercellular with 100% blast cells. The immunophenotype was DR+, CD22+, CD29+, CD33-, and CD34+. From cytologic and immunologic features, the diagnosis was undifferentiated AL. Chromosomal studies were performed after 24 and 48 hours of bone marrow cell cultures, and the RHG-banding procedure was performed. The karyotype was 46,XY,t(6; 11)(q21; q23)[12]/idem,del(1)(q41)[10] (Fig 1).



View larger version (29K):
[in this window]
[in a new window]
 
Fig 1. Partial karyotype (RHG-banding) for del(1)(q41) and t(6; 11)(q21; q23). Arrows show the rearranged chromosomes.

Nucleic acid analysis. DNA was extracted by standard procedures, and RNA was isolated using Trizol reagent (GIBCO-BRL, Cergy Pontoise, France) following the manufacturer's instructions. Nucleic acid experiments were performed using standard protocols.8 Northern blot membranes were from Clontech Laboratory (Clontech, Palo Alto, CA). The FA4 probe (a gift from Y. Gu, Jefferson Cancer Institute, Philadelphia, PA, and E. Canaani, Weitzmann Institute of Science, Rehovot, Israel) encompasses exon 8 of MLL, and I5 is a 0.4-kb AvaII fragment located within intron 5 of MLL.9 The K562 cDNA library (in lambda gt11) was purchased from Clontech Laboratory, and a genomic DNA library was established from peripheral blood cells of a healthy male. The libraries were screened using standard protocols.8 The nucleotide sequence was determined using the T7 sequencing kit (Pharmacia, Les Ulis, France).

Polymerase chain reaction. Briefly, 5 µg total RNA was reverse-transcribed with 50 pmol primer 1, GATTAGGATCCACTAATATC (N6 ), using the cDNA cycle kit (Invitrogen, San Diego, CA). One one-hundredths was incubated in a 50-µL reaction mixture with 20 pmol of each synthetic primer, 100 µmol.L-1 of each dNTP, 1.5 mmol.L-1 MgCl2 , 50 mmol.L-1 KCl, and 1 U Amplitaq polymerase (Cetus, Emeryville, CA). Denaturation was performed at 94°C for 9 minutes in the first cycle and for 1 minute in 35 subsequent cycles. Annealing and extension steps were performed for 1 minute at 56°C and 90 seconds at 72°C, respectively. The oligonucleotides were MLL Ex7 (TCAGCACTCTCTCCAATGG) and oligo AF61 (CTTGTTGCTATTGTCCA).

Anchored polymerase chain reaction. Random primed cDNA was purified on chromaspin (Clontech). One fifth was submitted to polymerase chain reaction (PCR) amplification for 30 cycles with oligo 4 (GATTAGGATCCACTAATATC) and oligo 1, 11q23 Ex5 (CACGCCTAGTGAGCCCAAG). After gel purification, a second PCR was performed for 30 cycles between oligo 4 and a second nested primer 2, oligo 11q23 Ex5/6 (gcgaatTCCAGAGCAGAGCAAACAGA). The amplified cDNAs were subcloned and isolated using a third, internal, primer: oligo 11q23 Ex6 (CCCAAGTATCCCTGTAAAACA).

PCR-mediated library screening. Gene-specific and lambda gt11-specific primers were used in the first round of PCRs; a second round of PCRs were performed using the same lambda gt11-specific primer with a nested gene-specific primer. PCR products were subcloned and submitted to sequence analysis.

Fluorescence in situ hybridization studies. Fluorescence in situ hybridization (FISH) to metaphase chromosomes was performed as previously described.10 Phage probes were used: T10, containing a 16-kb genomic insert encompassing the first intron of AF6q21, and T3, containing a 20-kb genomic insert corresponding to the 3' part of the gene.



View larger version (40K):
[in this window]
[in a new window]
 
Fig 2. Involvement of the MLL gene in the t(6; 11)(q21; q23) translocation. Top: Southern blot analysis of DNA extracted from the patient (D) and the control (C). Bottom: Partial restriction map of the MLL gene spanning exons 5 to 11 with location of the probes used in this study.


    RESULTS
Abstract
Introduction
Methods
Results
Discussion
References

Involvement of MLL in the t(6; 11)(q21; q23) translocation. To establish the involvement of MLL in this translocation, Southern blot analysis of high-molecular-weight DNA from the patient's bone marrow cells was performed using the probes covering the breakpoint cluster region of MLL rearrangements in ALs. Hybridization of BamHI- and HindIII-digested DNA with the FA4 and I5 probes showed rearranged fragments in addition to normal-sized fragments, whereas in EcoRI-digested DNA, only FA4 detected an abnormal fragment (Fig 2). The 11q23 breakpoint was thus located within the common breakpoint cluster region of MLL. Since the rearranged fragments detected by the two probes differed in size, the breakpoint was predicted to be between MLL exons 6 and 8.

Characterization of 6q21 sequences fused to MLL. To characterize the putative fused cDNA between MLL and the 6q partner gene, anchored PCR experiments were performed starting from randomly primed RNA from the patient (see Subjects and Methods). Sequence analysis of a subset of MLL cDNAs revealed a novel exon substituting for exon 8. These novel sequences were fused in frame to the MLL sequences. These non-MLL sequences (199 bp) were used as a probe in Northern blot analysis and detected three RNA species (estimated to be 1.5, 2.8, and 6 kb) in various malignant human hematopoietic cell lines (data not shown). This pattern was clearly different from the MLL RNA species described, suggesting that the cDNAs were unlikely to represent the result of an undescribed alternative splicing of the MLL gene. Consistently, within rodent cell somatic hybrids, the same probe hybridized strongly to the lane corresponding to human chromosome 6. A weak signal was also observed with hybrid DNA containing chromosome 17 (data not shown).

To confirm the presence of this chimeric MLL RNA in the patient's material, bispecific PCR was performed using oligo MLL Ex7 on the 5' side and oligo AF61 on the 3' side. The amplified product had the predicted size (247 bp) and was not seen in control cDNA. Its specificity was confirmed by nucleotide sequencing. The partial sequence encompassing the t(6; 11) fusion point is shown in Fig 3A.



View larger version (51K):
[in this window]
[in a new window]
 
Fig 3. (A) Nucleotide sequence and predicted amino acid sequences of fused MLL-AF6q21 cDNAs. Fusion point is shown by arrows. (B) Genomic sequence surrounding exon 1 of AF6q21. The deduced protein is shown above the sequence. The upstream in-frame stop codon is shown by an asterisk. The longest AF6q21 cDNA isolated from the K562 cDNA library starts at nucleotide 90. Further upstream sequences are of genomic origin. Intronic sequences downstream of the putative splice site appear as lowercase letters. (C) Predicted AF6q21 protein starting at the second in-frame ATG. The NH2 region conserved with AFX and FKHR and the FH domain are underlined. The arrows border the fusion point with MLL.

Therefore, t(6; 11)(q21; q23) results in fusion between MLL and a gene on chromosome 6, provisionally named AF6q21.

Isolation of AF6q21 cDNAs. To further characterize the AF6q21 gene, a cDNA library established from the K562 cell line was screened using the AF6q21 probe. Fourteen cDNAs were isolated, and the longest was chosen for nucleotide sequencing. None of the cDNAs harbored a poly(A) tail. No ATG initiator codons were identified 5' to the putative open reading frames (ORFs) in this set of cDNAs. Further 5' AF6q21 sequences were obtained upon PCR screening of the K562 cDNA library up to nucleotide 90 (Fig 3). Probes covering almost all of the AF6q21 ORF were also used to isolate genomic sequences from a normal genomic library. Sequencing of the genomic counterpart confirmed the nucleotide sequence of the PCR-isolated fragments and allowed us to extend further 5' of the AF6q21 sequences. A cDNA probe containing almost all of the coding sequences reacted with a 6-kb RNA species, as did the 199-bp PCR probe, in RNA from various cell lines (Fig 4). Hybridization of a multiple tissue blot with the same probe revealed the same 6-kb RNA species in all organs examined, suggesting a ubiquitous expression of the AF6q21 gene.



View larger version (42K):
[in this window]
[in a new window]
 
Fig 4. Northern blot analysis of AF6q21 transcription in several human leukemic cell lines (left) and several human tissues (right) using a cDNA probe corresponding to almost all of the AF6q21 ORF. Control hybridization with an actin probe is shown at bottom. The position of size markers is indicated. Additional smaller species are detected in some samples upon longer exposure (data not shown). They could be due to variation in alternate splicing within the AF6q21 gene or to expression of a homologous gene such as the one postulated for chromosome 17. Loading is as follows: Left panel: 1, HL60; 2, HeLa; 3, K562; 4, MOLT4; 5, Raji; 6, SW480; 7, A549; 8, G361. Right panel: 1, heart; 2, brain; 3, placenta; 4, lung; 5, liver; 6, skeletal muscle; 7, kidney; 8, pancreas.

Compilation of sequence data allowed the establishment of a 2,549-bp consensus sequence. Analysis of this consensus demonstrated a coding capacity of 403 amino acids bordered by stop codons at both 5' and 3' sides.

The genomic sequences further upstream show a high GC content. Since such GC-rich regions are frequently associated with the 5' end of genes, this could represent the 5' end of the AF6q21 gene (Fig 3B).

Of the first two in-frame ATGs, the second occurs within a better Kozak consensus (ACCATGG)11 because of purines at positions -3 and +4. We therefore postulate that the second in-frame ATG is the major site of translational initiation of the AF6q21 RNA allowing the synthesis of a 381-amino acid protein. This second ATG is in a position similar to the ATGs of two proteins homologous to the AF6q21 protein (description follows), further supporting this hypothesis.

AF6q21 encodes a Forkhead domain protein. Sequence comparisons of the deduced AF6q21 protein to protein databases showed significant similarity to the forkhead (FH) DNA-binding domain proteins (Fig 3C). FH proteins belong to a rapidly growing family of proteins with site-specific DNA-binding and transcription-regulation properties.

Among the FH protein family, particularly high homology within the FH domain is observed with the AFX and FKHR proteins, whose genes are recombined following chromosomal translocations in human malignancies. AFX was isolated as an MLL translocation partner following the study of a t(X; 11)(q13; q23) translocation in a human ALL cell line.6,12,13 The FKHR gene is fused to PAX3 in t(2; 13) (q35; q14) and to PAX7 in t(1; 13)(p36; q14) translocations associated with alveolar rhabdomyosarcoma.14,15 Amino acid alignment of the FH domain of these three FH proteins is shown in Fig 5, and a derived consensus sequence is compared with a previously defined HNF3 FH consensus.16 AF6q21, AFX, and FKHR share several features that differ from other FH proteins, as previously noted.13,14 They lack a KPPY tetrapeptide at the NH2 side of the FH domain, and exhibit several additional or missing amino acids with respect to the FH consensus (Fig 5).



View larger version (30K):
[in this window]
[in a new window]
 
Fig 5. Comparison of AF6q21, AFX, and FKHR amino acid sequences. Top: Homology region within the NH2 part of the genes. Bottom: Alignment of FH domains. A HNF3 FH consensus is shown for comparison. Only amino acids identical in AF6q21, AFX, and FKHR appear in the consensus. Gaps introduced to maximize alignment are shown as dashes. Asterisks indicate identity between the FH consensus defined in this study and the HNF3 FH consensus.16 Numbering is with respect to the AF6q21 protein starting at the second in-frame ATG.

A second region at amino acids 16 to 39 of AF6q21 is found to be conserved between these three FH proteins (17 of 21 amino acids are identical within the three proteins; Fig 5). The corresponding region starts at amino acid 12 of AFX and amino acid 8 of FKHR. Database comparison did not reveal other proteins with significant homology to this amino acid sequence. The significance of the common features of the three FH domain proteins remains to be determined, but they may characterize a particular subfamily of FH proteins.

Partial genomic characterization of the AF6q21 gene. Examination of nucleotide sequences upstream of the putative AF6q21 translational start sites showed a high CG content, several recognition sites for rare cutters, and methylation-sensitive enzymes. Consistently, 93 nucleotides 645 bp upstream of the first nucleotide shown in Fig 3B were found to be identical to a reported CpG island genomic DNA fragment (cpg86e6, accession no. Z63553). This 119-bp DNA fragment has been isolated on the basis of its methylated status in human genomic DNA.17 Methylation of the 5' region of AF6q21 was therefore investigated using several methylation-sensitive enzymes (ie, Not I, SacII, and Sfi I) in Southern blot analysis using 5' AF6q21 genomic probes. Genomic DNA extracted from normal human peripheral blood cells and from several malignant cell lines was similarly sensitive to digestion with these enzymes (data not shown), indicating that this region of AF6q21 is not subjected to methylation.

Comparison between genomic and cDNA sequences showed divergence after nucleotide 786 in Fig 3B (amino acid 207 of the AF6q21 protein), a position that also corresponds to the fusion point between MLL and AF6q21. This indicates the presence of an intron, which we consider here as the first intron of AF6q21, for which the size could not be established. Therefore, the chromosomal breakpoint of the t(6; 11) translocation occurs within the first intron of AF6q21 sequences. It is noteworthy that the chromosomal breakpoints of translocations involving the AFX and FKHR genes also occur within the first intron of these genes.13,18

FISH studies with AF6q21 probes. FISH experiments were performed to confirm the localization of the breakpoint on chromosome 6. The two phages isolated as indicated earlier were first hybridized to metaphase chromosomes of a normal control and localized to band 6q21. FISH was then performed on metaphase chromosomes of the patient. The phage probe T10 (5' part of the gene) hybridized to the der(6) chromosome, and T3 (3' part) to rearranged 11. This confirmed the orientation as 5' centromere-3' telomere of AF6q21. In the patient's metaphase, hybridization signals were also observed on normal chromosome 6 with the two probes. Consistently, with somatic cell hybrid analysis, a secondary signal was also observed on chromosome band 17p11 (data not shown).


    DISCUSSION
Abstract
Introduction
Methods
Results
Discussion
References

Various chromosomal rearrangements involving band 11q23 have been described in hematopoietic disorders.1,19 Most rearrangements found in leukemias involve the MLL gene, which is fused to various partner genes in diverse translocations. Ten different fusion types have been described to date.3 Translocation t(6; 11)(q21; q23) has rarely been reported in AL,19 whereas t(6; 11)(q27; q23) fusing the MLL and AF6 genes appears to be relatively more common. Interestingly, the undifferentiated myeloid leukemia analyzed here was therapy-related, since it appeared after treatment for Hodgkin's disease. Chromosomal abnormalities found in leukemia after Hodgkin's disease frequently involve chromosomes 7 and 5, but abnormalities of band 11q23 rearranging MLL are also known to occur in secondary leukemia.20

The AF6q21 gene contains a FH DNA binding domain. The FH gene was initially described as a homeogene encoding a nuclear protein expressed in the extremities of the Drosophila embryo.21 The hepatocyte nuclear factor 3alpha containing a FH domain was then isolated from rat liver and shown to be a transcription factor.22 Other transcription regulator genes encoding a FH domain protein were then discovered in eukaryotes, including man.23,24

Two genes, AFX and FKHR, have recently been reported to be involved in chromosomal translocations of human malignancies. The first, AFX, is fused to MLL in t(X; 11) (q13;q23) of AL.6,12,13 The second gene, FKHR, is fused to members of the paired box or PAX transcription factor family, PAX3 and PAX7, as a result of two translocations, t(2; 13) and t(1; 13), characteristic of alveolar rhabdomyosarcoma.14,15 The amino acid sequence of the FH domain of AFX is closely related to those of the human FH gene, the hepatocyte transcription factors, and the oncogene qin.13,16,25,26 The similar localization of chromosomal breakpoints within the FH motif in the three genes, AFX, FKHR, and AF6q21, is striking but could be partly explained by the structure of these genes, since all translocations seem to occur within the first intron of the genes.13,18 FH homologues have been found to be expressed in a lineage-restricted manner in human hematopoietic cell lines.27 The FH genes are defined as belonging to the family of transcription regulator genes, but their functions in hematopoietic cells remain to be established, as well as the functional consequences of the fusion genes of malignant cells. The Drosophila gene trithorax, which has homology with the human MLL gene, has recently been claimed to directly regulate the region-specific homeotic gene FH.28 Whether a similar interaction exists in human homologous genes is not known, nor is it known if such regulation could favor the occurrence of translocations between MLL and genes possessing FH domains.

Homology regions lying outside of the FH domain have been noted between several FH protein subfamilies.16,26 Interestingly, an NH2 region conserved within the HNF3 protein family has been demonstrated to contribute to the transcriptional activation properties of HNF3beta .29 The functional significance of the similarities observed between AFX, AF6q21, and FKHR gene products remains unknown. However, their existence suggests that they represent a particular FH protein subgroup particularly involved in chromosomal translocations of human malignancies.

Possible FKHR homologous genes have been localized to human chromosomes 5, 6, 13, 17, and X.18 Our preliminary data suggest that an AF6q21-like sequence is assigned to chromosome band 17p11. It is worth determining if these sequences correspond to true AFX/FKHR/AF6q21 homologous genes, and if they are also involved in human malignancy.


    FOOTNOTES

   Submitted March 18, 1997; accepted June 30, 1997.
   Supported in part by grants from the Fondation contre la Leucémie and the Ligue Nationale contre le Cancer.
   Address reprint requests to O.A. Bernard, PhD, U 301 INSERM, 27 rue Juliette Dodu, 75010, Paris, France.

   The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hearly marked ``advertisment'' in accordance with 18 U.S.C. section 1734 solely to indicate this fact.


    ACKNOWLEDGMENT

We sincerely thank Prof B.D. Young for fruitful discussion. We also thank Dr M. Lanotte for the Northern blot membranes.


    REFERENCES
Abstract
Introduction
Methods
Results
Discussion
References

1. Young BD: Cytogenetic and molecular analysis of chromosome 11q23 abnormalities in leukaemia. Baillieres Clin Haematol 5:881, 1992[Medline] [Order article via Infotrieve]

2. Mitelman F, Kaneko Y, Berger R: Report of the Committee on Chromosome Changes in Neoplasia. Genome Priority Rep 1:700, 1993

3. Bernard OA, Berger R: Molecular basis of 11q23 rearrangements in hematopoietic malignant proliferations. Genes Chromosomes Cancer 13:75, 1995[Medline] [Order article via Infotrieve]

4. Young BD, Saha V: Chromosome abnormalities in leukaemia: The 11q23 paradigm. Cancer Surv 28:225, 1996[Medline] [Order article via Infotrieve]

5. Rowley JD: The der(11) chromosome contains the critical breakpoint junction in the 4-11, 9-11, and 11-19 translocations in acute leukemia. Genes Chromosomes Cancer 5:264, 1992[Medline] [Order article via Infotrieve]

6. Corral J, Forster A, Thompson S, Lampert F, Kaneko Y, Slater R, Kroes WG, van der Schoot CE, Ludwig W-D, Karpas A, Pocock C, Cotter F, Rabbitts TH: Acute leukemias of different lineages have similar MLL gene fusions encoding related chimeric proteins resulting from chromosomal translocation. Proc Natl Acad Sci USA 90:8538, 1993[Abstract/Free Full Text]

7. Dreyling MH, Martinez-Climent JA, Zheng M, Mao J, Rowley JD, Bohlander SK: The t(10; 11)(p13; q14) in the U937 cell line results in the fusion of the AF10 gene and CALM, encoding a new member of the AP-3 clathrin assembly protein family. Proc Natl Acad Sci USA 93:4804, 1996[Abstract/Free Full Text]

8. Sambrook J, Fritsch E, Maniatis T: Molecular Cloning: A Laboratory Manual (ed 2). Cold Spring Harbor, NY, Cold Spring Harbor Laboratory Press, 1989

9. Bernard OA, Mauchauffe M, Mecucci C, Vandenberghe H, Berger R: A novel gene, AF-1p, fused to HRX in t(1; 11)(p32; q23), is not related to AF-4, AF-9 or ENL. Oncogene 9:1039, 1994[Medline] [Order article via Infotrieve]

10. Cherif D, Julier C, Delattre O, Derré J, Lathrop G, Berger R: Simultaneous localization of cosmids and chromosome R-banding by fluorescence microscopy. Application to regional mapping of human chromosome 11. Proc Natl Acad Sci USA 87:6639, 1990[Abstract/Free Full Text]

11. Kozak M: Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44:283, 1986[Medline] [Order article via Infotrieve]

12. Parry P, Wei Y, Evans G: Cloning and characterization of the t(X; 11) breakpoint from a leukemic cell line identify a new member of the forkhead gene family. Genes Chromosomes Cancer 11:79, 1994[Medline] [Order article via Infotrieve]

13. Borkhardt A, Repp R, Haas OA, Leis T, Harbott J, Kreuder J, Hammermann J, Henn T, Lampert F: Cloning and characterization of AFX, the gene that fuses to MLL in acute leukemias with translocation t(X; 11)(q13; q23). Oncogene 14:195, 1997[Medline] [Order article via Infotrieve]

14. Galili N, Davis RJ, Fredericks WJ, Mukhopadhyay S, Rauscher FJI, Emanuel BS, Rovera G, Barr FG: Fusion of a fork head domain to PAX-3 in the solid tumor alveolar rhabdomyosarcoma. Nat Genet 5:230, 1993[Medline] [Order article via Infotrieve]

15. Davis R, D'Cruz C, Lovell M, Biegel J, Barr F: Fusion of PAX7 to FHKR by the variant t(1; 3)(p36; q14) translocation in alveolar rhabdomyosarcoma. Cancer Res 54:2869, 1994[Abstract/Free Full Text]

16. Clevidence DE, Overdier DG, Tao W, Qian X, Pani L, Lai E, Costa RH: Identification of nine tissue-specific transcription factors of the hepatocyte nuclear factor 3/forkhead DNA-binding-domain family. Proc Natl Acad Sci USA 90:3948, 1993[Abstract/Free Full Text]

17. Cross SH, Charlton JA, Nan X, Bird AP: Purification of CpG islands using a methylated DNA binding column. Nat Genet 6:236, 1994[Medline] [Order article via Infotrieve]

18. Davis RJ, Bennicelli JL, Macina RA, Nycum LM, Biegel JA, Barr FG: Structural characterization of the FKHR gene and its rearrangement in alveolar rhabdomyosarcoma. Hum Mol Genet 4:2355, 1995[Abstract/Free Full Text]

19. Mitelman F: Catalog of Chromosome Aberrations in Cancer (ed 5). New York, NY, Wiley-Liss, 1994

20. Pedersen-Bjergaard J, Philip P: Balanced translocations involving bands 11q23 and 21q22 are highly characteristic of myelodysplasia and leukemia following therapy with cytostatic agents targeting at DNA-topoisomerase II. Blood 78:1147, 1991[Free Full Text]

21. Weigel D, Jürgens G, Küttner F, Seifert E, Jäckle H: The homeotic gene fork head encodes a nuclear protein and is expressed in the terminal regions of the Drosophila embryo. Cell 57:645, 1989[Medline] [Order article via Infotrieve]

22. Lai E, Prezioso VR, Smith E, Litvin O, Costa RH, Darnell J Jr: HNF-3A, a hepatocyte-enriched transcription factor of novel structure, is regulated transcriptionally. Genes Dev 4:1427, 1990[Abstract/Free Full Text]

23. Lai E, Clark KL, Burley SK, Darnell J Jr: Hepatocyte nuclear factor 3/fork head or "winged helix" proteins: A family of transcription factors of diverse biologic function. Proc Natl Acad Sci USA 90:10421, 1993[Abstract/Free Full Text]

24. Pierrou S, Hellqvist M, Samuelsson L, Enerback S, Carlsson P: Cloning and characterization of seven human forkhead proteins: Binding site specificity and DNA bending. EMBO J 13:5002, 1994[Medline] [Order article via Infotrieve]

25. Lai E, Prezioso VR, Tao WF, Chen WS, Darnell J Jr: Hepatocyte nuclear factor 3 alpha belongs to a gene family in mammals that is homologous to the Drosophila homeotic gene fork head. Genes Dev 5:416, 1991[Abstract/Free Full Text]

26. Li J, Vogt P: The retroviral oncogene qin belongs to the transcription factor family that includes the homeotic fork head gene. Proc Natl Acad Sci USA 90:4490, 1993[Abstract/Free Full Text]

27. Hromas R, Moore J, Johnston T, Socha C, Klemsz M: Drosophila forkhead homologues are expressed in a lineage-restricted manner in human hematopoietic cells. Blood 81:2854, 1993[Abstract/Free Full Text]

28. Kuzin B, Tillib S, Sedkov Y, Mizrokhi L, Mazo A: The Drosophila trithorax gene encodes a chromosomal protein and directly regulates the region-specific homeotic gene fork head. Genes Dev 8:2478, 1994[Abstract/Free Full Text]

29. Pani L, Overdier D, Porcella A, Qian X, Lai E, Costa R: Hepatocyte nuclear factor 3beta contains two transcriptional activation domains, one which is novel and conserved with the Drosophila fork head protein. Mol Cell Biol 12:3723, 1992[Abstract/Free Full Text]


© 1997 by The American Society of Hematology.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Cancer Res.Home page
C. J. Lau, Z. Koty, and J. Nalbantoglu
Differential Response of Glioma Cells to FOXO1-Directed Therapy
Cancer Res., July 1, 2009; 69(13): 5433 - 5440.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
H. Huang and D. J. Tindall
Dynamic FoxO transcription factors
J. Cell Sci., August 1, 2007; 120(15): 2479 - 2487.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
D. A Glauser and W. Schlegel
The emerging role of FOXO transcription factors in pancreatic {beta} cells
J. Endocrinol., May 1, 2007; 193(2): 195 - 207.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. M. Shore, P. C. White, R. C.-Y. Hui, A. Essafi, E. W.-F. Lam, M. Rowe, and P. Brennan
Epstein-Barr Virus Represses the FoxO1 Transcription Factor through Latent Membrane Protein 1 and Latent Membrane Protein 2A
J. Virol., November 15, 2006; 80(22): 11191 - 11199.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
X. Sagaert, P. de Paepe, L. Libbrecht, V. Vanhentenrijk, G. Verhoef, J. Thomas, I. Wlodarska, and C. De Wolf-Peeters
Forkhead Box Protein P1 Expression in Mucosa-Associated Lymphoid Tissue Lymphomas Predicts Poor Prognosis and Transformation to Diffuse Large B-Cell Lymphoma
J. Clin. Oncol., June 1, 2006; 24(16): 2490 - 2497.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
S. P. Treon, Z. R. Hunter, A. Aggarwal, E. P. Ewen, S. Masota, C. Lee, D. D. Santos, E. Hatjiharissi, L. Xu, X. Leleu, et al.
Characterization of familial Waldenstrom's macroglobulinemia
Ann. Onc., March 1, 2006; 17(3): 488 - 494.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Liu, S. Wang, S. Wei, L. Sun, and X. Feng
Receptor Activator of NF-{kappa}B (RANK) Cytoplasmic Motif, 369PFQEP373, Plays a Predominant Role in Osteoclast Survival in Part by Activating Akt/PKB and Its Downstream Effector AFX/FOXO4
J. Biol. Chem., December 30, 2005; 280(52): 43064 - 43072.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
V. Perrot and M. M. Rechler
The Coactivator p300 Directly Acetylates the Forkhead Transcription Factor Foxo1 and Stimulates Foxo1-Induced Transcription
Mol. Endocrinol., September 1, 2005; 19(9): 2283 - 2298.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Libura, D. J. Slater, C. A. Felix, and C. Richardson
Therapy-related acute myeloid leukemia-like MLL rearrangements are induced by etoposide in primary human CD34+ cells and remain stable after clonal expansion
Blood, March 1, 2005; 105(5): 2124 - 2131.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. Arimoto-Ishida, M. Ohmichi, S. Mabuchi, T. Takahashi, C. Ohshima, J. Hayakawa, A. Kimura, K. Takahashi, Y. Nishio, M. Sakata, et al.
Inhibition of Phosphorylation of a Forkhead Transcription Factor Sensitizes Human Ovarian Cancer Cells to Cisplatin
Endocrinology, April 1, 2004; 145(4): 2014 - 2022.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Wang, L. Chen, T. J. Maures, J. Herrington, and C. Carter-Su
SH2-B Is a Positive Regulator of Nerve Growth Factor-mediated Activation of the Akt/Forkhead Pathway in PC12 Cells
J. Biol. Chem., January 2, 2004; 279(1): 133 - 141.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
B. M. T. Burgering and R. H. Medema
Decisions on life and death: FOXO Forkhead transcription factors are in command when PKB/Akt is off duty
J. Leukoc. Biol., June 1, 2003; 73(6): 689 - 701.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Komatsu, T. Watanabe, M. Uchida, M. Mori, K. Kirito, S. Kikuchi, Q. Liu, T. Tauchi, K. Miyazawa, H. Endo, et al.
A Member of Forkhead Transcription Factor FKHRL1 Is a Downstream Effector of STI571-induced Cell Cycle Arrest in BCR-ABL-expressing Cells
J. Biol. Chem., February 14, 2003; 278(8): 6411 - 6419.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Zhang and C. Wang
PAX3-FKHR Transformation Increases 26 S Proteasome-dependent Degradation of p27Kip1, a Potential Role for Elevated Skp2 Expression
J. Biol. Chem., January 3, 2003; 278(1): 27 - 36.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. W. So and M. L. Cleary
MLL-AFX Requires the Transcriptional Effector Domains of AFX To Transform Myeloid Progenitors and Transdominantly Interfere with Forkhead Protein Function
Mol. Cell. Biol., September 15, 2002; 22(18): 6542 - 6552.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. Lin, C. T. Miller, J. I. Contreras, M. S. Prescott, S. L. Dagenais, R. Wu, J. Yee, M. B. Orringer, D. E. Misek, S. M. Hanash, et al.
The Hepatocyte Nuclear Factor 3 {alpha} Gene, HNF3{alpha} (FOXA1), on Chromosome Band 14q13 Is Amplified and Overexpressed in Esophageal and Lung Adenocarcinomas
Cancer Res., September 15, 2002; 62(18): 5273 - 5279.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Furukawa-Hibi, K. Yoshida-Araki, T. Ohta, K. Ikeda, and N. Motoyama
FOXO Forkhead Transcription Factors Induce G2-M Checkpoint in Response to Oxidative Stress
J. Biol. Chem., July 19, 2002; 277(30): 26729 - 26732.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. H. Banham, N. Beasley, E. Campo, P. L. Fernandez, C. Fidler, K. Gatter, M. Jones, D. Y. Mason, J. E. Prime, P. Trougouboff, et al.
The FOXP1 Winged Helix Transcription Factor Is a Novel Candidate Tumor Suppressor Gene on Chromosome 3p
Cancer Res., December 1, 2001; 61(24): 8820 - 8829.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
D. N. Finegold, M. A. Kimak, E. C. Lawrence, K. L. Levinson, E. M. Cherniske, B. R. Pober, J. W. Dunlap, and R. E. Ferrell
Truncating mutations in FOXC2 cause multiple lymphedema syndromes
Hum. Mol. Genet., May 1, 2001; 10(11): 1185 - 1189.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
R. W. Johnstone, M. Gerber, T. Landewe, A. Tollefson, W. S. Wold, and A. Shilatifard
Functional Analysis of the Leukemia Protein ELL: Evidence for a Role in the Regulation of Cell Growth and Survival
Mol. Cell. Biol., March 1, 2001; 21(5): 1672 - 1681.
[Abstract] [Full Text] [PDF]


Home page
Cell Growth Differ.Home page
D. J. Price, T. Miralem, S. Jiang, R. Steinberg, and H. Avraham
Role of Vascular Endothelial Growth Factor in the Stimulation of Cellular Invasion and Signaling of Breast Cancer Cells
Cell Growth Differ., March 1, 2001; 12(3): 129 - 135.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
A. Jackson, P. Carrara, V. Duke, P. Sinclair, M. Papaioannou, C. J. Harrison, and L. Foroni
Deletion of 6q16-q21 in Human Lymphoid Malignancies: A Mapping and Deletion Analysis
Cancer Res., June 1, 2000; 60(11): 2775 - 2779.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Tsao, X. Zhang, K. Fowlkes, and F. G. Haluska
Relative Reciprocity of NRAS and PTEN/MMAC1 Alterations in Cutaneous Melanoma Cell Lines
Cancer Res., April 1, 2000; 60(7): 1800 - 1804.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
Y. Cao and C. Wang
The COOH-terminal Transactivation Domain Plays a Key Role in Regulating the in Vitro and in Vivo Function of Pax3 Homeodomain
J. Biol. Chem., March 24, 2000; 275(13): 9854 - 9862.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Tomizawa, A. Kumar, V. Perrot, J. Nakae, D. Accili, and M. M. Rechler
Insulin Inhibits the Activation of Transcription by a C-terminal Fragment of the Forkhead Transcription Factor FKHR. A MECHANISM FOR INSULIN INHIBITION OF INSULIN-LIKE GROWTH FACTOR-BINDING PROTEIN-1 TRANSCRIPTION
J. Biol. Chem., March 15, 2000; 275(10): 7289 - 7295.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
S. R. Datta, A. Brunet, and M. E. Greenberg
Cellular survival: a play in three Akts
Genes & Dev., November 15, 1999; 13(22): 2905 - 2927.
[Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Takaishi, H. Konishi, H. Matsuzaki, Y. Ono, Y. Shirai, N. Saito, T. Kitamura, W. Ogawa, M. Kasuga, U. Kikkawa, et al.
Regulation of nuclear translocation of Forkhead transcription factor AFX by protein kinase B
PNAS, October 12, 1999; 96(21): 11836 - 11841.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
H. T. Adler, R. Chinery, D. Y. Wu, S. J. Kussick, J. M. Payne, A. J. Fornace Jr., and D. C. Tkachuk
Leukemic HRX Fusion Proteins Inhibit GADD34-Induced Apoptosis and Associate with the GADD34 and hSNF5/INI1 Proteins
Mol. Cell. Biol., October 1, 1999; 19(10): 7050 - 7060.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Taki, H. Ohnishi, K. Shinohara, M. Sako, F. Bessho, M. Yanagisawa, and Y. Hayashi
AF17q25, a Putative Septin Family Gene, Fuses the MLL Gene in Acute Myeloid Leukemia with t(11;17)(q23;q25)
Cancer Res., September 1, 1999; 59(17): 4261 - 4265.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
W. H. Biggs III, J. Meisenhelder, T. Hunter, W. K. Cavenee, and K. C. Arden
Protein kinase B/Akt-mediated phosphorylation promotes nuclear exclusion of the winged helix transcription factor FKHR1
PNAS, June 22, 1999; 96(13): 7421 - 7426.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Rena, S. Guo, S. C. Cichy, T. G. Unterman, and P. Cohen
Phosphorylation of the Transcription Factor Forkhead Family Member FKHR by Protein Kinase B
J. Biol. Chem., June 11, 1999; 274(24): 17179 - 17183.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Guo, G. Rena, S. Cichy, X. He, P. Cohen, and T. Unterman
Phosphorylation of Serine 256 by Protein Kinase B Disrupts Transactivation by FKHR and Mediates Effects of Insulin on Insulin-like Growth Factor-binding Protein-1 Promoter Activity through a Conserved Insulin Response Sequence
J. Biol. Chem., June 11, 1999; 274(24): 17184 - 17192.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Osaka, J. D. Rowley, and N. J. Zeleznik-Le
MSF (MLL septin-like fusion), a fusion partner gene of MLL, in a therapy-related acute myeloid leukemia with a t(11;17)(q23;q25)
PNAS, May 25, 1999; 96(11): 6428 - 6433.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. L. Strissel, R. Strick, J. D. Rowley, and N. J. Zeleznik-Le
An In Vivo Topoisomerase II Cleavage Site and a DNase I Hypersensitive Site Colocalize Near Exon 9 in the MLL Breakpoint Cluster Region
Blood, November 15, 1998; 92(10): 3793 - 3803.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W.-H. Zheng, S. Kar, and R. Quirion
Insulin-like Growth Factor-1-induced Phosphorylation of the Forkhead Family Transcription Factor FKHRL1 Is Mediated by Akt Kinase in PC12 Cells
J. Biol. Chem., December 8, 2000; 275(50): 39152 - 39158.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Tanaka, K. Kirito, Y. Kashii, M. Uchida, T. Watanabe, H. Endo, T. Endoh, K.-i. Sawada, K. Ozawa, and N. Komatsu
Forkhead Family Transcription Factor FKHRL1 Is Expressed in Human Megakaryocytes. REGULATION OF CELL CYCLING AS A DOWNSTREAM MOLECULE OF THROMBOPOIETIN SIGNALING
J. Biol. Chem., April 27, 2001; 276(18): 15082 - 15089.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Brodbeck, M. M. Hill, and B. A. Hemmings
Two Splice Variants of Protein Kinase Bgamma Have Different Regulatory Capacity Depending on the Presence or Absence of the Regulatory Phosphorylation Site Serine 472 in the Carboxyl-terminal Hydrophobic Domain
J. Biol. Chem., July 27, 2001; 276(31): 29550 - 29558.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. J. Kourlas, M. P. Strout, B. Becknell, M. L. Veronese, C. M. Croce, K. S. Theil, R. Krahe, T. Ruutu, S. Knuutila, C. D. Bloomfield, et al.
Identification of a gene at 11q23 encoding a guanine nucleotide exchange factor: Evidence for its fusion with MLL in acute myeloid leukemia
PNAS, February 29, 2000; 97(5): 2145 - 2150.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hillion, J.
Right arrow Articles by Bernard, O.A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hillion, J.
Right arrow Articles by Bernard, O.A.
Related Collections
Right arrow Neoplasia
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1997 by American Society of Hematology         Online ISSN: 1528-0020