Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cayuela, J.-M.
Right arrow Articles by Sigaux, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cayuela, J.-M.
Right arrow Articles by Sigaux, F.
Related Collections
Right arrow Neoplasia
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 90 No. 9 (November 1), 1997: pp. 3720-3726

Disruption of the Multiple Tumor Suppressor Gene MTS1/p16INK4a/CDKN2 by Illegitimate V(D)J Recombinase Activity in T-Cell Acute Lymphoblastic Leukemias

By Jean-Michel Cayuela, Betty Gardie, and François Sigaux

From the Laboratory of Molecular Hematology, Institut National de la Santé et de la Recherche Médicale (INSERM) U462, Centre Hayem, Hôpital Saint Louis, Paris, France.



    ABSTRACT
Abstract
Introduction
Methods
Results & Discussion
References

We have recently shown that the multiple tumor suppressor gene 1 (MTS1 ) encoding the p16INK4a and p19ARF cell-cycle inhibitors is inactivated by deletion or disruption in most human T-cell acute lymphoblastic leukemias (T-ALLs), representing the most frequent genetic event thus far described in this disease. To analyze the mechanism of these chromosomal events, we used cloning, sequencing, and/or polymerase chain reaction mapping to study 15 rearrangements occurring in the MTS1 locus. We found that these breakpoints occur in two clusters (MTS1bcralpha and MTS1bcrbeta ). The three rearrangements occurring in MTS1bcralpha correspond to a recurrent recombination juxtaposing 5' MTS2 exon 1 and 5' MTS1 exon 1alpha sequences. Breakpoints for 10 of 12 rearrangements within MTS1bcrbeta are located at a polymorphic (CA) repeat, suggesting that this sequence might play a role in the clustering. For both MTS1bcralpha and MTS1bcrbeta , sequence analyses and PCR mapping experiments show that the tightly clustered breakpoints are located in the vicinity of heptamers whose sequence is similar to those involved in the V(D)J recombination. Moreover, short deletions, GC-rich random nucleotide additions, and clone-specific junctional sequences are present in all cases, further suggesting that the rearrangements are due to illegitimate V(D)J recombinase activity. These data are the first demonstration that a tumor suppressor gene can be inactivated by the V(D)J recombinational mechanism. Moreover, they reinforce the view that this process, normally required for T-cell differentiation, plays a crucial role in the pathogenesis of T-ALL.



    INTRODUCTION
Abstract
Introduction
Methods
Results & Discussion
References

MULTIPLE TUMOR suppressor gene 1 (MTS1/p16INK4a/CDKN2 ), which is located at chromosome 9p21 and encodes the two distinct cell-cycle inhibitors p16INK4a 1 and p19ARF,2 has been found to be inactivated by mutations and/or deletions in a number of transformed cell lines3,4 as well as in various types of primary tumors (reviewed in Sherr5 ). These data suggested that this gene is a major tumor suppressor gene, a conclusion that has recently been reinforced by analysis of knockout mice lacking functional MTS1 genes.6 Another putative tumor suppressor gene, MTS2,3 is located 12 kb centromeric to MTS1 exon 1beta (Fig 1A). This gene encodes the p15INK4b protein, which shares with p16INK4a the ability to inhibit cdk4 and cdk6 kinase activities.7



View larger version (37K):
[in this window]
[in a new window]
 
Fig 1. Restriction map of the MTS locus and schematic representation of its configuration in T-ALL samples. (A) An updated MTS locus map is shown. The probes used and the 2 breakpoint clusters MTS1bcralpha and MTS1bcrbeta are indicated. C5.3, 2.7, and 2.3, sequence tagged sites (STSs); E, exon; *, polymorphic BamHI site; +, the 16 breakpoints include that of the T84 sample, for which the MTS1 configuration was not fully characterized. (B) Schematic representation of the 2 chromosome 9s in cases with rearrangements occurring in the locus (22 T-ALL samples and the MOLT4 cell line).21 In 1 sample, T106, 2 breakpoints occurring on each chromosome 9 were detected. In T39, breakpoints were different at presentation (T39p) and relapse (T39r). Dashed lines indicate deletions; vertical arrows indicate breakpoint-containing regions. The T84 configuration is not shown. All rearrangements within MTS1bcrbeta suppress the possibility to express p16INK4a (encoded by exon 1alpha , exon 2, and exon 3) and p19ARF (encoded by exon 1beta , exon 2, and exon 3). In rearrangements within MTS1bcralpha , MTS1 exon 1beta is deleted and p16INK4a encoding exons remain unchanged. Transcripts initiated from the promoter located 5' to MTS1 exon 1alpha and the p16INK4a protein are expressed (data not shown). These data suggest that p19ARF and/or p15INK4b and not p16INK4a could be the functional target(s) of the rearrangements in these cases (Gordie et al, submitted for publication).

Recently, our group and subsequent groups showed that inactivation by chromosomal rearrangements of MTS1 (and to a lesser degree, MTS2 ) occurs in the majority of T-cell acute lymphoblastic leukemias (T-ALLs), suggesting an important role in the development of this disease.8-11 We also showed that MTS1 inactivation essentially involved chromosomal deletions, with breakpoints located in the MTS1 locus in approximately one third of the cases.12

To shed light on the mechanism of these rearrangements in T-ALL, we analyzed 15 representative breakpoints by cloning, sequencing, and/or polymerase chain reaction (PCR) mapping. We demonstrate that most breakpoints are tightly clustered, and show evidence that these rearrangements involve an illegitimate V(D)J recombinase activity.

These results show for the first time that a tumor suppressor gene can be inactivated by the V(D)J recombinational mechanism.


    MATERIALS AND METHODS
Abstract
Introduction
Methods
Results & Discussion
References

Cells. Bone marrow or peripheral blood samples were obtained from 79 patients with T-ALL. Mononuclear cells obtained from bone marrow or peripheral blood samples were isolated by Ficoll-Hypaque (Eurobio, Les Ulis, France) centrifugation and viably frozen in liquid nitrogen until use. The diagnosis was established according to standard French-American-British criteria.13 Tumor cell phenotype was determined by flow cytometric procedures as previously described.14 A high percentage (usually >95%) of tumor cells were present in all samples. Each patient was identified by a unique number used in all reports from our group. Preliminary Southern blot data from 59 cases have been published previously.12 The T-ALL-derived MOLT4 cell line was also studied.

Southern blot analysis of MTS1 rearrangements. MTS1 and MTS2 configurations were analyzed by Southern blotting15 using a set of probes and various digests as described previously.12 Additional probes were also used. MTS1 5' exon 1alpha and MTS1 exon 1beta probes were obtained by PCR using OL13/OL17 and OL2/OL4 oligonucleotides, respectively.

Data were analyzed according to a restriction map12 that was updated and corrected with respect to the localization of MTS1 exon 1beta . This exon was localized by Southern blot analyses of a P1 phage (P1 2264; Genome Systems, St Louis, MO) containing the MTS1 and MTS2 genes and of an 18-kb subcloned HindIII-HindIII fragment of this phage containing the centromeric part of 2.3, MTS1 exon 1beta , 2.7, and MTS2 exon 2.

PCR analysis of chromosomal breakpoints. Standard methods were used.15 Dilutions of DNA extracted from the peripheral blood lymphocytes of a healthy donor in DNA extracted from the pre-B cell line REH, in which both MTS1 and MTS2 genes are deleted, were included in each experiment.

Inverse PCR and breakpoint cloning strategy. To perform the inverse PCR,16 genomic DNA was digested by the relevant restriction endonuclease (described later), and size-selected restriction fragments were ligated at low concentration using T4 DNA ligase (New England Biolabs Ltd, Hertfordshire, UK). DNA circles were PCR-amplified using divergent primers recognizing sequences located on the known part of the rearranged fragment. PCR products were cloned in a PCR Script (SK+ ) vector (Stratagene, La Jolla, CA) and sequenced. To verify that chromosomal rearrangements had been cloned, direct PCR amplification of junctional sequences was performed on genomic DNA using sequence information obtained by the inverse PCR procedure. Moreover, in the case of MTS1bcrbeta , Southern blot experiments performed with probes recognizing sequences located on each side of the breakpoints and with relevant restriction enzymes were compared, showing identical data (experiments not shown).

The T117 breakpoint was cloned by inverse PCR using restriction endonuclease Mbo I and primers OL18 and OL16. Cloning of MOLT4, T42, and T123 breakpoints was performed by inverse PCR after BglII digestion using primers OL5 and OL3. The germline sequence containing the sequence fused to MTS1bcrbeta in T42 and T123 was characterized by subcloning and sequencing after PCR screening of a P1 library (Genome Systems, St Louis, MO) with OL19 and OL21 oligonucleotides.

Southern blot analysis of PCR fragments. PCR products were electrophoresed in a 2% agarose, 2% NuSieve (FMC BioProducts, Rockland, ME) gel, transferred to a hybond N+ (Amersham International, Amersham, UK) membrane, and hybridized with 32P-radiolabeled oligonucleotides.

Nucleotide sequence analysis. Cloned PCR fragments were sequenced using the T7 Sequencing Kit (Pharmacia, Orsay, France). The oligonucleotide sequences are as follows: OL1, 5'GAAAGACACATCCAAGAGAA3'; OL2, 5'GGGGTGGGGGTGAAGGTG3'; OL3, 5'CGCCCCCTGCCCATCTCC3'; OL4, 5'CGATTGAGGGCTGTGTGAAG3'; OL13, 5'ATTCAAGAGCTAACAGGTATTAG3'; OL16, 5'GGGAGGGAGTCATTGGAAGG3'; OL18, 5'GCCCAACGCACCGAATAGT3'; OL19, 5'AAGAGAGTGAAAGGAAGAACA3'; OL20, 5'GTGCCAGTGTTCTTCCTTTCA3'; OL21, 5'GTTTGATTCTTGGGATATATTT3'; OL22, 5'GTGAACTTTTGGGGGTGTTATT3'; AJT39p, 5'GAGCCACCATCCCTGAGCA3'; AJT117, 5'GTCTCTACGCGGTTGCTTCT3'; AJT127, 5'GTCTCCCAGGGACCTGCTT3'; AJMOLT4, 5'ACACTCTTGACAATAACACC3'; AJT42, 5'TTCCTGCCACTTAGTGCCTG3'; and AJT123, 5'CGGTCGCGGCCTTGGGG3'. Sequences of the other oligonucleotides are shown in the figures.


    RESULTS AND DISCUSSION
Abstract
Introduction
Methods
Results & Discussion
References

Clustering of MTS1 breakpoints in T-ALL. Eighty T-ALL samples and the MOLT4 cell line were studied by Southern blot analysis using a set of MTS locus probes12 and EcoRI, HindIII, and, in selected cases, BglII digests (Fig 1). No MTS locus alteration was found in 11% (nine of 80) of the samples. Biallelic and monoallelic deletions of both MTS1 and MTS2 genes were found in 58% (46 of 80) and 4% (three of 80) of the cases, respectively, extending our previous results.12 Twenty-five breakpoints were detected corresponding to 22 T-ALL cases and the MOLT4 cell line.

Apart from five breakpoints scattered over a 42-kb region extending from MTS2 exon 2 to MTS1 exon 3, the other 20 breakpoints were clustered in two regions (Fig 1B). Sixteen of them (64%) are between the 2.7 and 2.3 sequence-tagged sites, thus confirming12 the existence of a major cluster (MTS1bcrbeta ). The four remaining breakpoints were located in a 1.1-kb EcoRI-HindIII fragment situated 5' to the MTS1 exon 1alpha , thus defining a new minor cluster (MTS1bcralpha ).

A recurrent rearrangement due to illegitimate V(D)J recombinase activity and juxtaposing 5' MTS2 exon 1 and 5' MTS1 exon 1alpha sequences. To localize the breakpoints within the minor cluster, the three cases with available material (T39p, T117, and T127) were further analyzed by Southern blotting using a 5' MTS1 exon 1alpha probe (Fig 2A and B). These experiments suggested that a common rearrangement had occurred, and localized the T117 and T127 breakpoints to a Xba I-Mbo I fragment of 20 nucleotides and T39p breakpoint to a EcoRI-Mbo I fragment of 123 nucleotides (Fig 2A). The T39p breakpoint was more precisely localized by PCR (Fig 2C) to a 50-bp fragment that includes the three breakpoints. Because the sequence of this fragment (Fig 2D) contains a CACTGTG heptamer identical to that found in recombination recognition sequences targeting Ig and T-cell receptor (TCR) gene rearrangements,17,18 we hypothesized that illegitimate V(D)J recombinase activity could be involved in these rearrangements.



View larger version (39K):
[in this window]
[in a new window]
 
Fig 2. Characterization of the MTS1bcralpha breakpoint cluster. (A) Restriction map of the MTS1bcralpha region. Only relevant restriction sites are shown. Xb, Xba I; Xh, XhoII; M, Mbo I; E, EcoRI; OL, oligonucleotide. (B) Southern blot analysis of T39p, T117, and T127 rearrangements using the 5' exon1alpha probe and Mbo I, XhoII, and Xba I digests. The T39p sample contains approximately 15% nontumoral cells. (C) Reverse view of ethidium bromide-stained gel showing PCR experiments using primers OL17 v OL14 or OL15. Dilutions of DNA from peripheral blood lymphocytes (PBL) from a healthy donor in DNA from the pre-B cell line REH, in which both MTS1 and MTS2 genes are deleted, were included. M, molecular weight marker V (Boehringer Mannheim, Meylan, France); C-, negative control (no DNA). (D) Nucleotide sequence of the MTS1bcralpha breakpoint cluster. Mbo I, Xba I, and EcoRI restriction sites are underlined, and the candidate heptamer targeted by the recombinase activity is boxed. Positions of oligonucleotides used to localize the breakpoints are shown.

The T117 MTS1bcralpha breakpoint was first cloned by inverse PCR, and germline chromosome 9 sequences were identified by a search of data banks (Burian DM, Mitchell N, Roe BA, unpublished, 1996; Sveen L, Olopade FI, Rowley JD, unpublished, 1996; accession no. AC000049). Primers recognizing sequences located on each side of the breakpoint (OL16 and OL1) were then designed and used to directly amplify T39p, T117, and T127 breakpoints. The three breakpoints were cloned and sequenced (Fig 3).



View larger version (33K):
[in this window]
[in a new window]
 
Fig 3. Cloning and sequencing of 3 breakpoints occurring in MTS1bcralpha . Top: Schematic representation of the 36-kb deletion that brings sequences 5' to MTS2 exon 1 (MTS2bcr1 ) upstream to MTS1 exon 1alpha . (black-square) MTS1 exons; (square ) MTS2 exons. Vertical arrows represent breakpoints. Insert: Hybridization with junction-specific oligonucleotides after direct PCR amplification of T39p, T117, and T127 breakpoints with OL16 and OL1. PCR products were analyzed in a 2% agarose, 2% NuSieve gel, transferred on a hybond N+ membrane, and successively hybridized with 32P-radiolabeled oligonucleotide specific for junctional sequences of T39p (AJ T39p), T117 (AJ T117), and T127 (AJ T127) and with a common internal oligoprobe, OL15. C-, negative control (no DNA). Bottom: Nucleotide sequence alignment of T39p, T117, and T127 rearrangements with germline chromosome 9 sequences. Canonic heptamers are boxed, and putative N regions are underlined. No consensus nonamer was found. However, highly degenerated nonamers may be present at 23 bp from the MTS2bcr1 heptamer and at 12 bp from the MTS1bcralpha heptamer. Localization of breakpoints on germline sequences is indicated by arrows.

The sequences located downstream of the breakpoints were identical. A 36-kb interstitial deletion had occurred, juxtaposing sequences located 0.4 kb upstream of MTS2 exon 1 with sequences located 0.7 kb upstream of MTS1 exon 1alpha (Fig 3, top). On both sides of the deletions, the tightly clustered breakpoints occurred in the vicinity of heptamers with sequences similar to those involved in the V(D)J recombination and that had been deleted by the recombinations. Short deletions and GC-rich N regions were found in all cases (Fig 3, bottom). Clone-specific junctional sequences were generated and shown to be specific by hybridization experiments performed after direct PCR on genomic DNA (Fig 3, insert). All of these data are the hallmark of V(D)J recombinase activity.17,18

Molecular characterization of rearrangements occurring in MTS1bcrbeta . We then investigated if a similar mechanism could be involved in rearrangements occurring in MTS1bcrbeta by refining the mapping of breakpoints by Southern blot analysis (not shown) for the 16 cases, using a MTS1 exon 1beta probe and various digests. In two cases (T73 and T79), no signal was observed, thus localizing the breakpoints 5' to MTS1 exon 1beta (Fig 4A). In the other 14 cases, rearranged fragments were observed, showing that the corresponding breakpoints were within a 3-kb region located 3' to MTS1 exon 1beta (Fig 4A).



View larger version (43K):
[in this window]
[in a new window]
 
Fig 4. Characterization of the MTS1bcrbeta cluster and cloning of 3 representative rearrangements. (A) Partial map of the DNA region flanked by STS2.3 and STS2.7. Localization of the 2 breakpoints occurring 5' to MTS1 exon 1beta (T73 and T79) and of the 14 breakpoints occurring 3' to exon 1beta is shown. Breakpoints were localized by Southern blot experiments using the MTS1 exon 1beta probe and BglII digests, and in certain cases, Sal I, BamHI, EcoRI, and HindIII digests. Bracketed cases show rearranged fragments of identical length in various digests. (B) Top: Schematic representation of MOLT4, T42, and T123 rearrangements. Vertical arrows represent breakpoints. Insert: Hybridization with junction-specific oligonucleotides after direct PCR amplification of the MOLT4 breakpoint using primers OL5 and OL22 and the T42 and T123 breakpoints using primers OL5 and OL20. PCR products were successively hybridized with 32P-radiolabeled oligonucleotides specific for junctional sequences of MOLT4 (AJ MOLT4), T42 (AJ T42), and T123 (AJ T123) and with a common internal oligoprobe, OL6. Bottom: Nucleotide sequence alignment of MOLT4, T42, and T123 rearrangements with chromosome 9 germline sequences. Heptamers are boxed, and putative N regions are underlined. No definite nonamer was found.

Three breakpoints located in this region (MOLT4, T42, and T123) were then cloned and sequenced (Fig 4B). Germline sequences corresponding to the identical sequences rearranged to the MTS1bcrbeta in T42 and T123 were characterized after PCR screening of a P1 library. Southern blot experiments on somatic hamster-human hybrids demonstrated that the translocated sequences in T42, T123, and MOLT4 DNA were located on chromosome 9, and deletion analysis indicated that the sequence translocated to the MTS1 locus in MOLT4 was centromeric to the sequences translocated in the T42 and T123 cases (data not shown). Analysis of the nucleotide sequences (Fig 4B, bottom) shows the hallmark of V(D)J recombinase activity. Clone-specific junctional sequences had been generated by the recombinase machinery (Fig 4B, insert).

To analyze whether other rearrangements occurring in the corresponding part of MTS1bcrbeta (ie, 3' to MTS1 exon 1beta ) are generated by the same mechanism, their breakpoints were defined by PCR (Fig 5). In addition to T42, T123, and MOLT4, seven other rearrangements were located in a region of approximately 70 nucleotides that includes a polymorphic (CA)n repeat19 and the <UNL>CACAGT</UNL>A heptamer (nucleotides identical to those of the consensus V(D)J recognition signal sequence are underlined). The (CA)n repeat contains <UNL>CACA</UNL>CAC heptamers that are also potential targets for the recombinase since, as for the CACAGTA heptamer, a CA dinucleotide is present in the sequence adjacent to the heptamer, theoretically contributing to the efficacy of the recombinase process.20,21 Breakpoints of two other cases (T55r and T6) were identified downstream of the (CA) repeat near heptamer-like sequences, <UNL>CAC</UNL>GCAG and <UNL>CACA</UNL>TTT, respectively (Fig 5).



View larger version (60K):
[in this window]
[in a new window]
 
Fig 5. Localization of the breakpoints occurring 3' to MTS1 exon 1beta by PCR. (A) Partial map of the region located 3' to MTS1 exon 1beta . The polymorphic dinucleotide CA repeat and the primers OL5 to OL12 used to localize the breakpoints are indicated. Breakpoint-containing regions determined by PCR are represented above by solid bars. (B) Reverse view of an ethidium bromide-stained gel showing representative PCR experiments using primers OL5 v OL7 or OL6. Dilutions of DNA from PBL from a healthy donor in DNA from pre-B cell line REH were included in the experiment. M, molecular weight marker V. One undeleted allele is present in case T84. T128 and T39R could not be studied by PCR, because of the presence of nontumoral cells in the T128 sample and the absence of available material for T39R. (C) Nucleotide sequence of the region located immediately 3' to MTS1 exon 1beta . The position of the relevant oligonucleotides is shown, and candidate heptamers are boxed.

All of these data suggest that the V(D)J recombinational mechanism is involved in rearrangements occurring in MTS1bcrbeta .

Breakpoint clustering at a (CA) polymorphic repeat. Breakpoints of 10 rearrangements, all leading to inactivation of both p16INK4a and p19ARF encoding sequences, are thus clustered at a (CA) repeat, suggesting that this motif may play a role in the clustering. In certain conditions, (CA) repeats adopt a Z-DNA structure and bind nuclear nonhistone high-mobility group proteins 1 and 2.22 Moreover, it has been recently shown by in vitro experiments that these DNA-binding proteins stimulate V(D)J cleavage.23 Purine-pyrimidine tracts (potential Z-DNA) have been described near (but not at) certain translocation breakpoints that occur in T-ALL cases, suggesting a role in targeting the recombination.24 In the case of MTS1 rearrangements, the repeat is precisely located at the breakpoint and may improve the efficacy of V(D)J recombinase-mediated recombination. During the physiologic V(D)J process,25-28 a nick is introduced at the exact border between the recombination signal sequence heptamer and the coding sequence, followed by creation of a hairpin at the coding end and of a blunt signal end. Ligation of coding ends occurs after opening of the hairpin. The particular structure of the CACA portion of the heptamer29 may facilitate the initial cleavage reaction,20,21 especially in cases where the adjacent sequence adopts a similar structure, as is the case for the (CA) repeat.

MTS1, a tumor suppressor gene inactivated by "illegitimate" V(D)J recombinase activity in immature T-cell proliferation. Illegitimate V(D)J recombinase activity has been suggested to be involved in the mechanism of recurrent translocations involving TCR genes as one of the two partners, found in rare T-ALL cases.17,18 Although a V(D)J recombinase-mediated process is clearly involved in the TCR gene breakpoint as an initial or secondary event, whether the same process is used for the non-TCR gene breakpoint remains an open question.18 To date, the best demonstration involving putative or proven oncogenes has been provided by the study of SIL-TAL1 deletions, which activate the proto-oncogene TAL1 in approximately 20% of T-ALL cases.30,31 MTS1 disruption is therefore the second example of a V(D)J recombinase-targeted event involving two non-TCR partners in T-ALL, and the first example of tumor suppressor gene inactivation by such a process. The V(D)J process, indispensable to the generation of clone-specific T-cell antigen receptors, therefore has the drawback of being mutagenic and probably plays a crucial role in the development of this aggressive form of human leukemia.


    FOOTNOTES

   Submitted April 10, 1997; accepted June 30, 1997.
   Supported by grants from the Fondation Saint Louis, Délégation à la Recherche Clinique AP-HP, and Ligue Nationale contre le Cancer (Comité de Paris).
   Address reprint requests to François Sigaux, MD, Laboratory of Molecular Hematology, Centre Hayem, Hôpital Saint-Louis, 1 av Claude Vellefaux, 75475, Paris, Cedex 10, France.

   The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hearly marked ``advertisment'' in accordance with 18 U.S.C. section 1734 solely to indicate this fact.


    ACKNOWLEDGMENT

We thank S. Genyk for technical assistance and M.H. Stern, J.C. Bories, C. Gazin, and E. Macintyre for very helpful comments. We also thank D.M. Willerford for a critical reading of the manuscript and all G.B.B.M. members for discussion.


    REFERENCES
Abstract
Introduction
Methods
Results & Discussion
References

1. Serrano M, Hannon GJ, Beach D: A new regulatory motif in cell-cycle control causing specific inhibition of cyclin D/CDK4. Nature 366:704, 1993[Medline] [Order article via Infotrieve]

2. Quelle DE, Zindy F, Ashmun RA, Sherr CJ: Alternative reading frames of the INK4a tumor suppressor gene encode two unrelated proteins capable of inducing cell cycle arrest. Cell 83:993, 1995[Medline] [Order article via Infotrieve]

3. Kamb A, Gruis NA, Weaver-Feldhaus J, Liu Q, Harshman K, Tavtigian SV, Stockert E, Day R, Johnson BE, Skolnick MH: A cell cycle regulator potentially involved in genesis of many tumor types. Science 264:436, 1994[Abstract/Free Full Text]

4. Nobori T, Miura K, Wu DJ, Lois A, Takabayashi K, Carson DA: Deletions of the cyclin-dependent kinase-4 inhibitor gene in multiple human cancers. Nature 368:753, 1994[Medline] [Order article via Infotrieve]

5. Sherr CJ: Cancer cell cycles. Science 274:1672, 1996[Abstract/Free Full Text]

6. Serrano M, Lee H, Chin L, Cordon-Cardo C, Beach D, De Pinho RA: Role of the INK4a locus in tumor suppression and cell mortality. Cell 85:27, 1996[Medline] [Order article via Infotrieve]

7. Hannon GJ, Beach D: p15INK4B is a potential effector of TGF-beta-induced cell cycle arrest. Nature 371:257, 1994[Medline] [Order article via Infotrieve]

8. Hebert J, Cayuela JM, Berkeley J, Sigaux F: Candidate tumor-suppressor genes MTS1 (p16INK4A) and MTS2 (p15INK4B) display frequent homozygous deletions in primary cells from T- but not from B-cell lineage acute lymphoblastic leukemias. Blood 84:4038, 1994[Abstract/Free Full Text]

9. Cayuela JM, Hebert J, Sigaux F: Homozygous MTS1 (p16INK4A) deletion in primary tumor cells of 163 leukemic patients. Blood 85:854, 1995 (letter)

10. Okuda T, Shurtleff SA, Valentine MB, Raimondi SC, Head DR, Behm F, Curcio-Brint AM, Liu Q, Pui CH, Sherr CJ, Beach D, Look AT, Downing JR: Frequent deletion of p16INK4a/MTS1 and p15INK4b/MTS2 in pediatric acute lymphoblastic leukemia. Blood 85:2321, 1995[Abstract/Free Full Text]

11. Takeuchi S, Bartram CR, Seriu T, Miller CW, Tobler A, Janssen JW, Reiter A, Ludwig WD, Zimmermann M, Schwaller J, Lee E, Miyoshi I, Koeffler HP: Analysis of a family of cyclin-dependent kinase inhibitors: p15/MTS2/INK4B, p16/MTS1/INK4A, and p18 genes in acute lymphoblastic leukemia of childhood. Blood 86:755, 1995[Abstract/Free Full Text]

12. Cayuela JM, Madani A, Sanhes L, Stern MH, Sigaux F: Multiple tumor-suppressor gene 1 inactivation is the most frequent genetic alteration in T-cell acute lymphoblastic leukemia. Blood 87:2180, 1996[Abstract/Free Full Text]

13. Bennett JM, Catovsky D, Daniel MT, Flandrin G, Galton DAG, Gralnick HR, Sultan C: Proposals for the classification of the acute leukaemias. Br J Haematol 33:451, 1976[Medline] [Order article via Infotrieve]

14. Chen Z, Sigaux F, Miglierina R, Valensi F, Daniel MT, Ochoa-Noguera MH, Flandrin G: Immunological typing of acute lymphoblastic leukemia: Concurrent analysis by flow cytometry and immunocytology. Leuk Res 10:1411, 1986[Medline] [Order article via Infotrieve]

15. Sambrook J, Fritsch EF, Maniatis T (eds): Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1989

16. Collins F, Weissman S: Directional cloning of DNA fragments at a large distance from an initial probe: A circularization method. Proc Natl Acad Sci USA 81:6812, 1984[Abstract/Free Full Text]

17. Chen J, Alt FW: Gene rearrangement and B-cell development. Curr Opin Immunol 5:194, 1993[Medline] [Order article via Infotrieve]

18. Lewis SM: The mechanism of V(D)J joining: Lessons from molecular, immunological, and comparative analyses. Adv Immunol 56:27, 1994[Medline] [Order article via Infotrieve]

19. Mao L, Merlo A, Bedgi G, Shapiro GI, Edwards CD, Rollins BJ, Sidransky D: A novel p16INK4A transcript. Cancer Res 55:2995, 1995[Abstract/Free Full Text]

20. Ramsden DA, Gellert M: Formation and resolution of double-strand break intermediates in V(D)J rearrangement. Genes Dev 9:2409, 1995[Abstract/Free Full Text]

21. Cuomo CA, Mundy CL, Oettinger MA: DNA sequence and structure requirements for cleavage of V(D)J recombination signal sequences. Mol Cell Biol 16:5683, 1996[Abstract]

22. Gaillard C, Strauss F: Association of poly(CA).poly(TG) DNA fragments into four-stranded complexes bound by HMG1 and 2. Science 264:433, 1994[Abstract/Free Full Text]

23. Van Gent DC, Hiom K, Paull TT, Gellert M: Stimulation of V(D)J cleavage by high mobility group proteins. EMBO J 16:2665, 1997[Medline] [Order article via Infotrieve]

24. Boehm T, Mengle-Gaw L, Kees RR, Spurr N, Lavenir I, Forster A, Rabbitts TH: Alternating purine-pyrimidine tracts may promote chromosomal translocations seen in a variety of human lymphoid tumours. EMBO J 8:2621, 1989[Medline] [Order article via Infotrieve]

25. Bogue M, Roth DB: Mechanism of V(D)J recombination. Curr Opin Immunol 8:175, 1996[Medline] [Order article via Infotrieve]

26. Difilippantonio MJ, McMahan CJ, Eastman QM, Spanopoulou E, Schatz D: RAG1 mediates signal sequence recognition and recruitment of RAG2 in V(D)J recombination. Cell 87:253, 1996[Medline] [Order article via Infotrieve]

27. Spanopoulou E, Zaitseva F, Wang FH, Santagata S, Baltimore D, Panayotou G: The homeodomain region of Rag-1 reveals the parallel mechanisms of bacterial and V(D)J recombination. Cell 87:263, 1996[Medline] [Order article via Infotrieve]

28. Hiom K, Gellert M: A stable RAG1-RAG2-DNA complex that is active in V(D)J cleavage. Cell 88:65, 1997[Medline] [Order article via Infotrieve]

29. Timsit Y, Vilbois E, Moras D: Base-pairing shift in the major groove of (CA)n tracts by B-DNA crystal structures. Nature 354:167, 1991[Medline] [Order article via Infotrieve]

30. Aplan PD, Lombardi DP, Ginsberg AM, Cossman J, Bertness VL, Kirsch IR: Disruption of the human SCL locus by "illegitimate" V-(D)-J recombinase activity. Science 250:1426, 1990[Abstract/Free Full Text]

31. Brown L, Cheng JT, Chen Q, Siciliano MJ, Crist W, Buchanan G, Baer R: Site-specific recombination of the tal-1 gene is a common occurrence in human T cell leukemia. EMBO J 9:3343, 1990[Medline] [Order article via Infotrieve]


© 1997 by The American Society of Hematology.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
M. Zhang and P. C. Swanson
V(D)J Recombinase Binding and Cleavage of Cryptic Recombination Signal Sequences Identified from Lymphoid Malignancies
J. Biol. Chem., March 14, 2008; 283(11): 6717 - 6727.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Fasseu, P. D. Aplan, M. Chopin, N. Boissel, J.-C. Bories, J. Soulier, H. von Boehmer, F. Sigaux, and A. Regnault
p16INK4A tumor suppressor gene expression and CD3{epsilon} deficiency but not pre-TCR deficiency inhibit TAL1-linked T-lineage leukemogenesis
Blood, October 1, 2007; 110(7): 2610 - 2619.
[Abstract] [Full Text] [PDF]


Home page
Vet PatholHome page
S. P. Fosmire, R. Thomas, C. M. Jubala, J. W. Wojcieszyn, V. E. O. Valli, D. M. Getzy, T. L. Smith, L. A. Gardner, M. G. Ritt, J. S. Bell, et al.
Inactivation of the p16 Cyclin-Dependent Kinase Inhibitor in High-Grade Canine Non-Hodgkin's T-Cell Lymphoma
Vet. Pathol., July 1, 2007; 44(4): 467 - 478.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
X.-Y. Su, V. Della-Valle, I. Andre-Schmutz, C. Lemercier, I. Radford-Weiss, P. Ballerini, M. Lessard, M. Lafage-Pochitaloff, F. Mugneret, R. Berger, et al.
HOX11L2/TLX3 is transcriptionally activated through T-cell regulatory elements downstream of BCL11B as a result of the t(5;14)(q35;q32)
Blood, December 15, 2006; 108(13): 4198 - 4201.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Tsuji, H. Ishii-Ohba, T. Katsube, H. Ukai, S. Aizawa, M. Doi, K. Hioki, and T. Ogiu
Involvement of Illegitimate V(D)J Recombination or Microhomology-Mediated Nonhomologous End-Joining in the Formation of Intragenic Deletions of the Notch1 Gene in Mouse Thymic Lymphomas
Cancer Res., December 15, 2004; 64(24): 8882 - 8890.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
J. Sakata, J. Inoue, H. Ohi, H. Kosugi-Okano, Y. Mishima, K. Hatakeyama, O. Niwa, and R. Kominami
Involvement of V(D)J recombinase in the generation of intragenic deletions in the Rit1/Bcl11b tumor suppressor gene in {gamma}-ray-induced thymic lymphomas and in normal thymus of the mouse
Carcinogenesis, June 1, 2004; 25(6): 1069 - 1075.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
P. Berggren, R. Kumar, S. Sakano, L. Hemminki, T. Wada, G. Steineck, J. Adolfsson, P. Larsson, U. Norming, H. Wijkstrom, et al.
Detecting Homozygous Deletions in the CDKN2A(p16INK4a)/ARF(p14ARF) Gene in Urinary Bladder Cancer Using Real-Time Quantitative PCR
Clin. Cancer Res., January 1, 2003; 9(1): 235 - 242.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Kitagawa, K. Inoue, S. Sasaki, Y. Hayashi, Y. Matsuo, M. R. Lieber, H. Mizoguchi, J. Yokota, and T. Kohno
Prevalent Involvement of Illegitimate V(D)J Recombination in Chromosome 9p21 Deletions in Lymphoid Leukemia
J. Biol. Chem., November 22, 2002; 277(48): 46289 - 46297.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. L. Wiemels, B. C. Leonard, Y. Wang, M. R. Segal, S. P. Hunger, M. T. Smith, V. Crouse, X. Ma, P. A. Buffler, and S. R. Pine
Site-specific translocation and evidence of postnatal origin of the t(1;19) E2A-PBX1 fusion in childhood acute lymphoblastic leukemia
PNAS, November 12, 2002; 99(23): 15101 - 15106.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. J. Williams, I. Grandal, D. J. Vesprini, U. Wojtyra, J. S. Danska, and C. J. Guidos
Irradiation Promotes V(D)J Joining and RAG-Dependent Neoplastic Transformation in SCID T-Cell Precursors
Mol. Cell. Biol., January 15, 2001; 21(2): 400 - 413.
[Abstract] [Full Text]


Home page
BloodHome page
J.-W. Vaandrager, E. Schuuring, K. Philippo, and P. M. Kluin
V(D)J recombinase-mediated transposition of the BCL2 gene to the IGH locus in follicular lymphoma
Blood, September 1, 2000; 96(5): 1947 - 1952.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
E. P. Xing, Y. Nie, Y. Song, G.-Y. Yang, Y. C. Cai, L.-D. Wang, and C. S. Yang
Mechanisms of Inactivation of p14ARF, p15INK4b, and p16INK4a Genes in Human Esophageal Squamous Cell Carcinoma
Clin. Cancer Res., October 1, 1999; 5(10): 2704 - 2713.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. Gardie, J.-M. Cayuela, S. Martini, and F. Sigaux
Genomic Alterations of the p19ARF Encoding Exons in T-Cell Acute Lymphoblastic Leukemia
Blood, February 1, 1998; 91(3): 1016 - 1020.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cayuela, J.-M.
Right arrow Articles by Sigaux, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cayuela, J.-M.
Right arrow Articles by Sigaux, F.
Related Collections
Right arrow Neoplasia
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1997 by American Society of Hematology         Online ISSN: 1528-0020