|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 1 (January 1), 1998:
pp. 30-36
Successful Peripheral T-Lymphocyte-Directed Gene Transfer for a
Patient With Severe Combined Immune Deficiency Caused by Adenosine
Deaminase Deficiency
By
Masafumi Onodera,
Tadashi Ariga,
Nobuaki Kawamura,
Ichiro Kobayashi,
Makoto Ohtsu,
Masafumi Yamada,
Atsushi Tame,
Hirofumi Furuta,
Motohiko Okano,
Shuzo Matsumoto,
Hitoshi Kotani,
Gerard J. McGarrity,
R. Michael Blaese, and
Yukio Sakiyama
From the Department of Pediatrics, Hokkaido University School of
Medicine, Sapporo, Japan; Clinical Gene Therapy Branch, National Human
Genome Research Institute, National Institutes of Health, Bethesda, MD;
Institute of Medical Science, Health Sciences University of Hokkaido,
Ainosato, Sapporo, Japan; and Genetic Therapy, Inc, Gaithersburg, MD.
 |
ABSTRACT |
Ten patients with adenosine deaminase deficiency
(ADA ) have been enrolled in gene therapy
clinical trials since the first patient was treated in September 1990.
We describe a Japanese ADA severe combined immune
deficiency (SCID) patient who has received periodic infusions of
genetically modified autologous T lymphocytes transduced with the human
ADA cDNA containing retroviral vector LASN. The percentage
of peripheral blood lymphocytes carrying the transduced ADA gene has
remained stable at 10% to 20% during the 12 months since the fourth
infusion. ADA enzyme activity in the patient's circulating T cells,
which was only marginally detected before gene transfer, increased to
levels comparable to those of a heterozygous carrier individual and was
associated with increased T-lymphocyte counts and improvement of the
patient's immune function. The results obtained in this trial are in
agreement with previously published observations and support the
usefulness of T lymphocyte-directed gene transfer in the treatment of
ADA SCID.
 |
INTRODUCTION |
ADENOSINE DEAMINASE (EC3.5.4.4; ADA) is
an enzyme in the purine salvage pathway that is critical for the
deamination of adenosine and deoxyadenosine and consequent formation of
inosine and deoxyinosine, respectively. The deficiency of ADA impairs
the function of the human immune system resulting in severe combined
immunodeficiency (SCID) characterized by severe T lymphocyte
dysfunction and agammaglobulinemia.1-3 The clinical course
of inherited ADA deficiency (ADA ) ranges from the
rapidly fatal, early onset of classical ADA SCID to the
minimally dysfunctional immune system of patients presenting
"partial" ADA deficiency.4,5 A recent review
classified ADA deficiency into four types as determined by the age at
clinical onset and suggested that these variants are the result of
different, specific mutations resulting in various severities of enzyme
dysfunction.6
Although the current treatment of choice for ADA SCID is
an HLA-matched bone marrow transplant,7 less than one third
of patients have access to an appropriate donor. An alternative is
enzyme replacement using polyethene glycol-modified bovine ADA
(PEG-ADA). This represents a life saving, but costly, therapeutic
option for the patients that do not have an HLA-matched
donor.8,9 Although enzyme replacement with PEG-ADA
partially reconstitutes the immune function of most patients with
ADA SCID, a few patients have been unresponsive to
PEG-ADA.
The determination of the complete sequence of both the ADA
cDNA10-12 and the genomic ADA structural gene13
has facilitated the molecular analysis of ADA patients
and permitted identification of various genetic mutations in unrelated
ADA patients. Early identification of the mutant gene
led ADA SCID to become the first disorder to be treated
by gene therapy. Two ADA SCID patients who had manifested
differing levels of severity of persistent immunodeficiency despite
continuous treatment with PEG-ADA thus were enrolled in
1990.14 Since then, 10 patients with ADA SCID
have undergone gene therapy as recently described.14-17 The
strategies adopted in these trials have differed and the efficacy of
treatment has varied.
We report the molecular analysis of the genetic defect in an
ADA SCID patient enrolled in the first gene therapy
protocol in Japan and analyze the clinical results obtained during the
first 18 months of this clinical trial.
 |
MATERIALS AND METHODS |
Cell culture.
B-lymphoblastoid cell lines (B-LCL) were established from our
ADA SCID patient, his parents and a healthy volunteer by
Epstein-Bar Virus (EBV) transformation. B-LCL were
maintained in RPMI-1640 medium (GIBCO-BRL, Grand Island, NY) with 10%
fetal calf serum (FCS; GIBCO-BRL) and 50 mmol/L -mercaptoethanol
(Sigma Chemical Co, St Louis, MO).
Sequence analysis of patient's ADA cDNA and genomic DNA.
For the analysis of the ADA cDNA sequence, total cellular RNA was
isolated from B-LCL using TRIZOL Reagent (GIBCO-BRL). First-strand cDNA
was synthesized from 2 µg of total cellular RNA (First strand
synthesis kit; Promega, Madison, WI). Full-length ADA cDNA fragments
extending from the translation start site codon to 230 base pair (bp)
3 of the stop codon were amplified by reverse transcriptase-polymerase
chain reaction (RT-PCR). Oligonucleotide primers for RT-PCR were as
follows: sense primer; CCATGGCCCAGACGCCCGCCTT, antisense primer;
ACCATAGCCCATGTGCAAGGGC. Reactions containing 0.5 µL (2.5 U)
Taq polymerase (TaKaRa Ex Taq, TaKaRa Shuzo Co, Ltd,
Tokyo, Japan) were incubated for 30 cycles of 60 seconds at 92°C, 90
seconds at 58°C, and 180 seconds at 72°C with the extension time at
72°C increased to 10 minutes in the last cycle. Amplified products
were isolated from 1.0% agarose gel and then subcloned into pCR II
vector (Invitrogen, San Diego, CA). Sequence analysis of
double-stranded DNA was performed using Sequenase version II DNA
sequencing kit (Amersham Life Science, Arlington Heights, IL) with
[35S]dATP (Amersham Life Science) and a series of
ADA-specific primers. Amplified products were sequenced through a 6%
acrylamide gel (National Diagnostics, Atlanta, GA). To analyze the ADA
genomic sequence, high molecular DNA was obtained from B-LCL by
standard techniques.18 Primers and PCR conditions for
amplification of ADA all exons have also been described
previously.19-21 Amplified products were isolated from
agarose gel and sequenced directly using the Thermal Cycler DNA
sequencing kit (Circum Vent; New England Biolabs Inc, Beverly, MA). ADA
cDNA sequences are numbered relative to the start site of translation
and genomic DNA according to Wiginton et al.13
Southern blot analysis.
High molecular weight DNA from B-LCL was digested with restriction
endonuclease Rsa I, separated in 1.0% agarose gel, and
transferred onto a nylon membrane (Biotrace HP; Gelman Sciences, Ann
Arbor, MI). Filters were then hybridized to a 32P randomly
labeled 444-bp Rsa I-Pst I fragment from the ADA cDNA.
Retroviral-mediated gene transfer into patient's peripheral T
cells.
The clinical protocol used here has been described
elsewhere.22 Briefly, peripheral T lymphocytes from the
patient were obtained by apheresis (CS3000 plus, Baxter Corp, Chicago,
IL), isolated by density gradient centrifugation, and then maintained
in AIM-V medium (GIBCO-BRL) supplemented with 5% FCS (GIBCO-BRL), 100
U/mL of recombinant human IL-2 (rIL-2, SHIONOGI, Osaka, Japan) and 10
ng/mL of anti-CD3 antibody (Orthoclone OKT3 Injection; Ortho, Raritan,
NJ) in gas-permeable culture bags (Nipro Pretobag; Nishyo, Osaka,
Japan). After 72 hours, half of the medium was removed and replaced
with supernatant containing the LASN retroviral vector23
supplemented with interleukin-2 (IL-2) and 10 µg/mL of protamine
(Shimizu, Shimizu City, Japan). The LASN supernatant, prepared under
Good Manufacturing Practices guidelines, was supplied by Genetic
Therapy Inc (Gaithersburg, MD). The transduction procedure was repeated
twice following an optimized transduction protocol combining
low-temperature (32°C) incubation and centrifugation.24
After two rounds of transduction, the virus supernatant was replaced
with fresh medium supplemented with IL-2 and the cells were cultured
for an additional 6 days. At the 11th day of culture, the cells were
harvested and washed extensively with saline containing 0.5% human
albumin and then reinfused into the patient.
Analysis of the inserted proviral genome by semi-quantitative PCR.
Sense (GAGGCTGTGAAGAGCGGCAT) and anti-sense (CTCGAAGTGCATGTTTTCCT)
primers were designed to match the sequence of the start site of exon 7
and the end of exon 8, respectively. Using these primers, the
amplification of DNA samples from vector-containing cells generates two
bands; the larger one (250 bp) derived from the endogenous ADA gene
containing intron 7 (76 bp) and the smaller one (174 bp) from the LASN
provirus. To evaluate the frequency of transduced cells in the
patient's peripheral blood, a standard curve was prepared from a
serial dilution of in vitro-transduced and G418-selected B-LCL with
untransduced cells. The ratio of the amount of amplified ADA cDNA
derived from the integrated vector and the amplified genomic sequence
was calculated after hybridization with an ADA cDNA probe.
Thin-layer chromatography (TLC) analysis of ADA enzyme activity.
Mononuclear cells were washed twice with phosphate-buffed saline to
remove FCS and then suspended in 100 mmol/L Tris, pH 7.4 containing 1%
bovine serum albumin. Cell lysates were obtained by 5 rapid freeze-thaw
cycles. Cellular debris was removed by centrifugation and the lysates
were stored at 80°C until used. ADA enzyme activity was assayed by
the measurement of the conversion of [14C] adenosine
(Amersham Life Science) to [14C] inosine and
[14C] hypoxanthine followed by TLC separation of the
reaction products performed as previously described.25 The
results were expressed as nanomoles of inosine and hypoxanthine
produced per min by 108 cells (nmol/min/108
cells).
 |
RESULTS |
Clinical course.
The patient is a 5-year-old Japanese male. Symptoms including a chronic
productive cough and a purulent nasal discharge began at 8 months of
age. At 10 months he developed respiratory distress and was
hospitalized for the treatment of severe pneumonia that was
unresponsive to antibiotics. On admission at age 10 months, the patient
had lymphopenia (absolute lymphocyte count 520/µL), with few mature T
and B lymphocytes (CD3, 125/µL; CD4, 62/µL; CD8, 41/µL; CD19,
26/µL) and low serum Ig levels (IgG, 342 mg/dL; IgA, 18 mg/dL; and
IgM, 60 mg/dL). Both humoral and cellular immunity were defective, with
undetectable isohemagglutinins and absent T-cell proliferative
responses to phytohemagglutinin, Concanavalin A, and pokeweed mitogen.
Since ADA activity in his red blood cells (RBCs) was
undetectable and the deoxyadenosine triphosphate (dATP) level was 506
nmol/mL RBCs (normal <2 nmol/mL), the diagnosis of SCID due to ADA
deficiency of the "delayed onset" type6 was
established. In the absence of a suitable bone marrow donor, PEG-ADA
therapy was initiated at 15 months of age and supplemented with
intravenous Ig (IVIG). After treatment with PEG-ADA (37.5 U/kg/wk), the
plasma ADA activity in the patient's peripheral blood increased from
0.14 to 53.15 µmol/h/mL and the peripheral blood lymphocyte (PBL)
count increased to the range of 1,000 to 2,000/µL. Despite continuous
PEG-ADA treatment, however, his Ig levels remained below normal and the
lymphopenia recurred during the second year of enzyme replacement. The
PBL count decreased to less than 1,000/µL with CD3+ cell
counts of 400/µL before the start of gene therapy (PBL, 702/µL;
CD3, 400/µL; CD4, 205/µL; CD8, 191/µL; CD19, 57/µL on protocol
day 0).
Identification of mutations responsible for ADA deficiency.
To analyze mutations in our patient, we amplified full-length ADA cDNA
from the patient's EBV transformed B-LCL by RT-PCR.
Sequence analysis revealed that all of the clones (6/6) carried a
G632 to A transition resulting in replacement of the
arginine residue by histidine at codon 211 (Fig
1A). The mutation eliminates a recognition
site for the restriction enzyme Rsa I. We took advantage of
this feature to distinguish the mutated allele from the normal
allele.19 High molecular weight DNA extracted from the
patient's B-LCL was digested with Rsa I, blotted and
hybridized to an ADA cDNA probe spanning the region from this mutation
site in exon 7 to the end of exon 11 (Fig 1B). Rsa I digestion
showed both a normal (3.1 kb) and a larger fragment (4.4 kb) in the
patient lane, indicating that the patient was heterozygous for loss of
the Rsa I recognition site in exon 7. To determine the parental
derivation, amplified genomic fragments spanning intron 6 to intron 9
of the patient and his parents were digested with Rsa I and
electrophoresed in 2% agarose gel (Fig 1C). The patient's digestion
pattern was identical to that obtained from the analysis of the
father's DNA, indicating that this mutation was derived from the
paternal allele.

View larger version (26K):
[in this window]
[in a new window]

View larger version (35K):
[in this window]
[in a new window]

View larger version (67K):
[in this window]
[in a new window]
| Fig 1.
Characterization of the paternal missense mutation. (A)
Sequence (sense) of amplified cDNA subclones from a control (left) and
the patient (right). The position of the G632 A
transition is indicated by arrows next to the sequence ladder. (B)
Identification of heterozygosity for the missense mutation. DNA samples
from a control (lane 1) and the patient B-LCL (lane 2) were hybridized
to a radiolabeled 444-bp Rsa I-Pst I cDNA probe
extending from the mutation site to the end of exon 11 after
Rsa I digestion. The normal Rsa I sites are at base
pair 27,276 in exon 6, 28,516 in exon 7, and 31,671 in
intron 11, predicting a 3.154-kb band hybridized to the probe in normal
control, while loss of Rsa I site in exon 7 results in a larger
band (4.394 kb). (C) Determination of the paternal mutation. Amplified
genomic fragments (739 bp) from intron 6 (base pair 28377) to intron 9
(base pair 29115) were digested with Rsa I and electrophoresed
in 2.0% agarose gel, and stained with ethidium bromide. The fragment
has one Rsa I recognition site at base pair 28,517 in exon 7,
predicting 141- and 598-bp fragments. Loss of the Rsa I site by
the mutation results in an undigested fragment.
|
|
Northern blot analyses showed that the quantity of the ADA message from
both the patient and his mother was reduced to approximately half of
control (data not shown). All cDNA clones carried the paternal missense
mutation, suggesting that the mutation derived from the maternal allele
resulted in undetectable mRNA. To characterize this mutation, we
analyzed exons 1 to 11 by PCR amplification of genomic DNA and direct
sequencing. Sequence analyses of the amplified fragments including exon
2 showed the patient to be heteroallelic for a splice site mutation at
the first position of intron 2 (G+1 A transversion)
(Fig 2A). This mutation eliminates a
recognition site for the restriction enzyme BspMI.
BspMI digestion showed that the patient and his mother were
heterozygous for this mutation, while the father showed a normal
individual digestion pattern (Fig 2B). Reports of mutation analyses of
other patients have shown that a mutation affecting a mRNA splicing
mechanism may give rise to a nonfunctional or unstable
mRNA.26,27 This mechanism is also supported by the fact
that Rsa I digestion showed that all full-length cDNA clones
(48/48) from the patient's B-LCL carried the paternal G632
to A missense mutation.

View larger version (53K):
[in this window]
[in a new window]

View larger version (45K):
[in this window]
[in a new window]
| Fig 2.
Identification of the maternal mutation at the splice
donor site in intron 2. (A) Sequence (sense) of the exon 2/intron 2
junction in amplified genomic DNA. Genomic fragments containing exon 2
were amplified from a control (left) and the patient (right) and
sequenced directly. A mutation at the splice donor site in intron 2
(G+1 A) is indicated by arrows. (B) Detection of
the splice site mutation by the BspMI digestion. Amplified
genomic fragments (690 bp) from intron 1 (bp 14,901) to intron 2 (base
pair 15,590) was digested with BspMI, electrophoresed in 2.0%
agarose gel, and stained with ethidium bromide. The fragment has two
BspMI recognition sites at bp 15,282 and 15,344, predicting
62-, 246-, and 382-bp fragments in the control lane. Loss of the
BspMI site (base pair 15,282) by the mutation results in the
undigested fragment (308 bp). Lane 1, control; lane 2, father; lane 3,
mother; and lane 4, patient. BspMI digestion shows the patient
and his mother were heterozygous for the splice site mutation.
|
|
Retroviral mediated gene transfer into peripheral T cells.
At the age of 4, the patient was enrolled in a clinical gene therapy
trial that repeated the protocol of the first gene therapy experiment
at the National Institutes of Health (NIH) in 1990.22 The
patient's peripheral mononuclear cells, obtained by apheresis, were
stimulated with IL-2 (100 U/mL) and anti-CD3 antibody (OKT3; 10 ng/mL).
After 72 hours of stimulation, they were transduced twice during the
next 48 hours by exposure to the ADA retroviral vector LASN, expanded
20- to 50-fold in number by culturing for 6 days after the beginning of
transduction, and then reinfused into the patient (see Materials and
Methods). No selection procedure to enrich for gene-transduced cells
was performed. Semiquantitative PCR of the cells in the first and
second infusions revealed that the frequency of the vector-carrying
cells ranged from 3% to 7% (data not shown).
Clinical course after gene therapy.
The patient received a total of 10 infusions over the 18-month period
(Fig 3). A striking increase in lymphocyte
number was observed early in the trial, followed by a gradual return to
the basal level. This was followed by a sustained increase after the
8th infusion (protocol day 322) and the patient's PBL count has since
remained in the normal range (PBL, 1,980/µL; CD3, 1,822/µL; CD4,
240/µL; CD8, 1,538/µL; CD19, 154/µL on protocol day 429).
Progressive inversion of CD4/CD8 ratio has been observed since the 4th
infusion due to an increase of the absolute CD8+ cell
count. This phenomenon is thought to be the result of preferential
proliferation of CD8+ cells during in vitro culture and
transduction. ADA enzyme activity, nearly undetectable in the
patient's lymphocytes before gene therapy, also increased
progressively after the 7th infusion (protocol day 252) and reached 27
U on protocol day 476, which is approximately comparable to that of a
heterozygous carrier individual (the patient's mother, 34.8 U).

View larger version (31K):
[in this window]
[in a new window]
| Fig 3.
Clinical course before and after gene therapy. Gene
therapy started on August 1, 1995 (protocol day 0) with the patient
receiving a total of 10 infusions to date. PEG-ADA therapy was
initiated at 15 months of age. The lymphocyte count is indicated by a
solid line and CD4/CD8 ratio was measured using PBL before infusion.
ADA activity shown by a solid bar is expressed as nanomoles of inosine
and hypoxanthine produced per minute by 108 cells.
Replacement of IVIG after gene therapy is shown as an arrow. The
patient received a Ig replacement (2.5 g) monthly before gene
therapy.
|
|
The number of transduced cells in the patient's peripheral blood were
assessed by semiquantitative PCR using PBL obtained before each
infusion (Fig 4). The frequency of the
genetically modified cells increased with the number of infusions of
the ADA gene transduced lymphocytes and exceeded 10% of total
circulating mononuclear cells just before the 5th infusion (on protocol
day 126; Fig 4, lane 4). The frequency measured before each of the 6th
through 10th infusions (on protocol days 210 to 462) has remained
stable at 10% to 20%.

View larger version (21K):
[in this window]
[in a new window]
| Fig 4.
Semiquantitative PCR analysis to evaluate the frequency
of vector-carrying cells in the patient's peripheral blood. Patient's
mononuclear cells were obtained before the indicated infusion: before
gene therapy (lane 1), 2nd infusion (protocol day [D] 21-lane 2), 4th
infusion (D 98-lane 3), 5th infusion (D 126-lane 4), 6th infusion (D
175-lane 5), 8th infusion (D 322-lane 6, and 10th infusion (D 462-lane
7), and assayed for the frequency of vector containing cells by
semiquantitative PCR. A standard was prepared by diluting cells
containing the LASN vector with nontransduced cells. The ratio was
determined by comparing the density of the cDNA derived band to that of
the genomic DNA derived band.
|
|
To evaluate the functional consequences of the ADA enzyme activity that
had been induced by gene transfer, we compared the patient's immune
function before and after the treatment (Table
1). Eleven months after beginning gene
therapy, the patient's isohemagglutinin titer (IgG) increased from
undetectable to 1:16 and delayed-type hypersensitivity
(DTH) skin test responses became stronger. The interval
between IVIG infusions which were given monthly before gene therapy,
was widened and eventually stopped after gene therapy. Despite this,
the patient's serum Ig levels gradually increased and have remained
normal for more than a half year without additional IVIG treatment (Fig
3 and Table 1). These results suggest that the accumulated genetically
corrected T lymphocytes in the patient's peripheral blood are
associated with improvement of cellular and humoral immune responses
and an increase in his circulating lymphocyte count. Although he
sometimes became transiently febrile after infusions, the patient
showed no serious adverse reactions to the treatments.
 |
DISCUSSION |
Advances in molecular biology during the past 3 decades have suggested
that gene transfer could provide a new approach to the treatment of
inherited diseases as well as acquired disorders such as cancer and
acquired immune deficiency syndrome.28 The number of active
gene therapy protocols has increased greatly since the first clinical
gene therapy trial.29 ADA SCID is one of the
few early candidate disorders suitable for such
interventions.30 Accordingly, 10 ADA SCID
patients have been enrolled in gene therapy clinical protocols that
employed different strategies, retroviral vector designs, and target
cell populations. The results obtained from these trials have recently
been reported.14-17
This trial of gene therapy for an ADA SCID patient in
Japan began in August 1995. Over the next 18 months he received a total
of 10 infusions of cultured-expanded autologous T cells that had been
transduced with the LASN retroviral vector. After an initial period of
fluctuating counts, the patient's T cells stabilized in the normal
range and this has been sustained for the last half year. The frequency
of integrated provirus in the patient's peripheral blood increased to
approximately 15% (0.1 to 0.2 proviral copies/cell) by the 4th
infusion and has remained stable since that time. The patient's cell
associated adenosine deaminase enzyme activity has increased from
barely detectable before treatment to values approaching those found in
the peripheral mononuclear cells of his heterozygous carrier mother.
Delayed hypersensitivity skin tests, a measure of T-cell function, have
improved. Isohemagglutinin titers have also increased and his
dependence on infusions of normal gammaglobulin has eased. The patient
has gained 3 kg in weight during this trial. He is still receiving
periodic PEG-ADA replacement and is attending public school with no
more infections than his classmates.
The period of observation has simply not been sufficient to assess the
full breadth or the duration of this improved clinical status and
immune responsiveness. Further, additional studies will be required to
reconcile the apparent dissociation between the level of T-cell ADA
observed and the proportion of cells containing integrated vector at
different time points. Also, the effect of withdrawal of the exogenous
PEG-ADA treatment must await more complete characterization of the
quality of the patient's immune system and the repertoire of
specificities represented in the transduced T-cell population.
Four gene therapy clinical trials including 10 ADA SCID
patients have been performed since the first trial in 1990. Although
these trials provided much data that suggested how future gene therapy
might be improved by changing retroviral vector design, transduction
methods and target cell populations, we found it difficult to compare
the efficacy of these various trials because of differences inherent
within these basic strategies. Our trial has been performed following
the identical protocol and vector preparations and autologous T
lymphocyte isolation procedures that were used in the NIH trial. From
this perspective, our trial provides an additional opportunity to
evaluate the effectiveness of peripheral T lymphocyte-directed gene
therapy for ADA SCID patients. Interestingly, the
clinical course of our patient is quite similar to that observed in
patient 1 in the NIH trial. Both trials have shown high gene transfer
efficiency, remarkable increase of the ADA enzyme activity and eventual
improvement of immune function. In contrast, patient 2 in the NIH trial
experienced a low gene transfer efficiency and no significant increase
in the ADA enzyme activity even though she exhibited some increase in
immunological function. Although the factors leading to this difference
have not yet been completely identified, a striking difference in the
transduction efficiency of peripheral T cells between the three
patients may be relevant. Transduction efficiencies before infusion
were 3% to 7% for the present case, 1% to 10% for patient 1 and
0.1% to 1% for patient 2 in the NIH trial. An abbreviated
proliferative capacity of patient 2 in the NIH trial was also observed.
In addition, a contribution of the development of an immune response to
the neomycin resistance gene must be considered since the existence of
dominant selectable markers of nonhuman origin may result in unwanted
immune reactivity that could eliminate or functionally impair
transgene-expressing cells.31
The severity of the underlying ADA gene defects could also affect gene
transfer. In addition to the mutation analysis reported here, specific
ADA gene defects have also been reported for the two NIH
patients.20 These three cases can be classified by the
severity of their clinical presentation. Both the present case and
patient 1 in the NIH trial are of the "delayed onset" type, have
splice site mutation defects and have achieved significant levels of
"gene-corrected" circulating cells. However, the NIH patient 2
carries compound missense mutations and has manifested low transduction
efficiency despite her less severe "late onset" type of
presentation at age 5. Although there are insufficient numbers of
treated patients to draw firm conclusions at this point, it does appear
thus far that the responses of patients with "more severe" gene
defects and clinical presentations are at least as responsive as cases
with "milder ADA defects."
It should be noted that the ADA gene transduced T lymphocytes possess a
selective advantage over the nontransduced cells due to the latter's
high intracellular concentration of deoxyadenosine.32,33 In
the ADA newborn trial using gene-corrected
CD34+ cells obtained from the patient's umbilical cord
blood,16 LASN vector was detected in the peripheral blood T
cells of these patients at a stable frequency of approximately 0.01%
during the first 18 months of observation. Then, after a 50% reduction
in their weekly dose of PEG-ADA, the proportion of ADA
vector-containing T cells in the blood increased to approximately 10%
in each case (D.B. Kohn, personal communication, September
1995). In the present case, the dosage schedule of PEG-ADA
enzyme has remained constant since the beginning of the trial (18
U/kg/wk on the protocol day 431), during which time the patient's
immune function has substantially improved. It might be expected that
the proportion of the transduced cells in the patient's PBL will
increase as the PEG-ADA dosage is decreased.
To date, three clinical trials have been performed to assess the
possibility of treating ADA SCID patients by correcting
hematopoietic progenitor cells.15-17 The results obtained
from these trials suggest that cord blood provides a stem cell
population more suitable for efficient retroviral-mediated gene
transfer than does bone marrow. Taken with the observations made in the
NIH trial, our results strongly suggest that the effectiveness of T
lymphocyte-directed gene transfer is a viable addition to the treatment
programs that should be considered for ADA SCID patients.
After additional courses of treatment and continued observation to
determine the breadth and durability of these positive responses, we
hope to reduce or eliminate exogenous ADA enzyme supplementation in
this patient. Improvements in vector design to permit higher levels of
ADA expression and innovative strategies that provide greater
efficiency of stem cell gene transduction may make gene therapy the
treatment of choice for ADA SCID patients.
 |
FOOTNOTES |
Submitted May 28, 1997;
accepted August 20, 1997.
Supported by the grant for Scientific Research Expenses
for Health and Welfare Programs (Funds of Highly Advances Medical
Research), Tokyo, Japan.
Address reprint requests to Yukio Sakiyama, MD, PhD, Department of
Pediatrics, Hokkaido University School of Medicine, North 15, West 7,
Kita-ku, Sapporo, 060 Japan.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section 1734 solely
to indicate this fact.
 |
ACKNOWLEDGMENT |
We are grateful to Dr M.S. Hershfield for measuring some ADA activities
and providing PEG-ADA, Dr A. Wakisaka for semiquantitative PCR, Drs
L.M. Muul, C. Carter, and C. Wannebo for the transduction methods, Drs
R.A. Knazek, F. Candotti, and D.M. Nelson for their critical review for
the manuscript.
 |
REFERENCES |
1.
Giblett ER,
Anderson JE,
Cohen F,
Pollara B,
Meuwissen HJ:
Adenosine-deaminase deficiency in two patients with severely impaired cellular immunity.
Lancet
2:1067,
1972[Medline]
[Order article via Infotrieve]
2. Kredich NM, Hershfield MS: Immunodeficiency disease associated
with adenosine deaminase deficiency and purine nucleoside phosphorylase
deficiency, in Scriver CM, Beaudet AL, Sly WS, Valle D (eds): The
metabolic basis of inherited disease (ed 5). New York, NY, McGraw Hill,
1989, p 1045
3. Hirschhorn R: Adenosine deaminase deficiency, in Rosen FS,
Seligmann M (eds): Immunodeficiency Reviews, vol 2. London, UK, Harwood
Academic, 1990, p 175
4.
Morgan G,
Levinsky RJ,
Hugh-Jones K,
Fairbanks LD,
Morris GS,
Simmonds HA:
Heterogeneity of biochemical, clinical and immunological parameters in severe combined immunodeficiency due to adenosine deaminase deficiency.
Clin Exp Immunol
70:491,
1987[Medline]
[Order article via Infotrieve]
5.
Hirschhorn R,
Ellenbogen A:
Genetic heterogeneity in adenosine deaminase (ADA) deficiency: Five different mutations in five new patients with partial ADA deficiency.
Am J Hum Genet
38:13,
1986[Medline]
[Order article via Infotrieve]
6. (suppl 1)
Hirschhorn R:
Overview of biochemical abnormalities and molecular genetics of adenosine deaminase deficiency.
Pediatr Res
33:S35,
1993
7.
Chen SH,
Ochs HD,
Scott CR,
Giblett ER,
Tingle AJ:
Adenosine deaminase deficiency: Disappearance of adenine deoxynucleotides from a patient's erythrocytes after successful marrow transplantation.
J Clin Invest
62:138,
1978
8.
Hershfield MS,
Buckley RH,
Greenberg ML,
Melton AL,
Schiff R,
Hatem C,
Kurtberg J,
Markert ML,
Kabayashi RH,
Kobayashi AL,
Abuchowski A:
Treatment of adenosine deaminase deficiency with polyethyleneglycol-modified adenosine deaminase.
N Engl J Med
316:589,
1987[Abstract]
9. (suppl 1)
Hershfield MS,
Chaffee S,
Sorensen RU:
Enzyme replacement therapy with polyethylene glycol-adenosine deaminase in adenosine deaminase deficiency: overview and case reports of three patients, including two now receiving gene therapy.
Pediatr Res
33:S42,
1993
10.
Daddona PE,
Shewach DS,
Kelley WN,
Argos P,
Markham AF,
Orkin SH:
Human adenosine deaminase. cDNA and complete primary amino acid sequence.
J Biol Chem
259:12101,
1984[Abstract/Free Full Text]
11.
Valerio D,
McIvor RS,
Williams SR,
Duyvesteyn MG,
van Ormondt H,
van der Eb AJ,
Martin DW Jr:
Cloning of human adenosine deaminase cDNA and expression in mouse cells.
Gene
31:147,
1984[Medline]
[Order article via Infotrieve]
12.
Wiginton DA,
Adrian GS,
Hutton JJ:
Sequence of human adenosine deaminase cDNA including the coding region and a small intron.
Nucleic Acids Res
12:2439,
1984[Abstract/Free Full Text]
13.
Wiginton DA,
Kaplan DJ,
States JC,
Akeson AL,
Perme CM,
Bilyk IJ,
Vaughn AJ,
Lattier DL,
Hutton JJ:
Complete sequence and structure of the gene for human adenosine deaminase.
Biochemistry
25:8234,
1986[Medline]
[Order article via Infotrieve]
14.
Blaese RM,
Culver KW,
Miller AD,
Carter CS,
Fleisher T,
Clerici M,
Shearer G,
Chang L,
Chiang Y,
Tolstoshev P,
Greenblatt JJ,
Rosenberg SA,
Klein H,
Berger M,
Mullen CA,
Ramsey WJ,
Muul L,
Morgan RA,
Anderson WR:
T lymphocyte-directed gene therapy for ADA SCID: Initial trial results after 4 years.
Science
270:475,
1995[Abstract/Free Full Text]
15.
Bordignon C,
Notarangelo LD,
Nobili N,
Ferrari G,
Casorati G,
Panina P,
Mazzolari E,
Maggioni D,
Rossi C,
Servida P,
Ugazio AG,
Mavilio F:
Gene therapy in peripheral blood lymphocytes and bone marrow for ADA immunodeficient patients.
Science
270:470,
1995[Abstract/Free Full Text]
16.
Kohn DB,
Weinberg KI,
Nolta JA,
Heiss LN,
Lenarsky C,
Crooks GM,
Hanley ME,
Annett G,
Brooks JS,
el-Khoureiy A,
Lawrence K,
Wells D,
Moen RC,
Bastian J,
Williams-Herman DE,
Elder M,
Wara D,
Bowen T,
Hershfield MS,
Mullen CA,
Blaese RM,
Parkman R:
Engraftment of gene-modified umbilical cord blood cells in neonates with adenosine deaminase deficiency.
Nat Med
1:1017,
1995[Medline]
[Order article via Infotrieve]
17.
Hoogerbrugge PM,
van Beusechem VW,
Fischer A,
Debree M,
le Deist F,
Perignon JL,
Morgan G,
Gaspar B,
Fairbanks LD,
Skeoch CH,
Moseley A,
Harvey M,
Levinsky RJ,
Valerio D:
Bone marrow gene transfer in three patients with adenosine deaminase deficiency.
Gene Ther
3:179,
1996[Medline]
[Order article via Infotrieve]
18. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A
Laboratory manual (ed 2). Cold Spring Harbor, NY, Cold Spring Harbor
Laboratory, 1989
19.
Hirschhorn R,
Ellenborgen A,
Tzall S:
Five missense mutations at the adenosine deaminase locus (ADA) detected by altered retraction fragments and their frequency on ADA patients with severe combined immunodeficiency.
Am J Med Genet
49:201,
1992
20.
Santisteban I,
Arredondo-Vega FX,
Kelly S,
Mary A,
Fischer A,
Hummell DS,
Lawton A,
Sorensen RU,
Stiehm ER,
Uribe L,
Weinberg K,
Hershfield MS:
Novel splicing, missense, and deletion mutations in seven adenosine deaminase-deficient patients with late/delayed onset of combined immunodeficiency disease. Contribution of genotype to phenotype.
J Clin Invest
92:2291,
1993
21.
Hirschhorn R,
Yang DR,
Israni A:
An Asp8Asn substitution results in the adenosine deaminase (ADA) genetic polymorphism (ADA 2 allozyme): Occurrence on different chromosomal backgrounds and apparent intragenic crossover.
Ann Hum Genet
58:1,
1994[Medline]
[Order article via Infotrieve]
22.
Blaese RM,
Anderson WF,
Culver KW:
The ADA human gene therapy clinical protocol.
Hum Gene Ther
1:327,
1990[Medline]
[Order article via Infotrieve]
23.
Hock RA,
Miller AD,
Osborne WR:
Expression of human adenosine deaminase from various strong promoters after gene transfer into human hematopoietic cell lines.
Blood
74:876,
1989[Abstract/Free Full Text]
24.
Bunnell BA,
Muul LM,
Donahue RE,
Blaese RM,
Morgan RA:
High-efficiency retroviral-mediated gene transfer into human and nonhuman primate peripheral blood lymphocytes.
Proc Natl Acad Sci USA
92:7739,
1995[Abstract/Free Full Text]
25.
Kohn DB,
Mitsuya H,
Ballow M,
Selegue JE,
Barankiewicz J,
Cohen A,
Gelfand E,
Anderson WF,
Blaese RM:
Establishment and characterization of adenosine deaminase-deficient human T cell lines.
J Immunol
142:3971,
1989[Abstract]
26.
Aebi M,
Hornig H,
Padgett RA,
Reiser J,
Weissmann C:
Sequence requirements for splicing of higher eukaryotic nuclear pre-mRNA.
Cell
47:555,
1986[Medline]
[Order article via Infotrieve]
27.
Krawczak M,
Reiss J,
Cooper DN:
The mutational spectrum of single base-pair substitutions in mRNA splice junctions of human genes: Causes and consequences.
Hum Genet
90:41,
1992[Medline]
[Order article via Infotrieve]
28.
Miller AD:
Human gene therapy comes of age.
Nature
357:455,
1992[Medline]
[Order article via Infotrieve]
29.
Marcel T,
Grausz JD:
The TWC worldwide gene therapy enrollment report, end 1996.
Hum Gene Ther
8:775,
1997[Medline]
[Order article via Infotrieve]
30. (suppl 1)
Blaese RM:
Development of gene therapy for immunodeficiency: Adenosine deaminase deficiency.
Pediatr Res
33:S49,
1993
31.
Riddell SR,
Elliott M,
Lewinsohn DA,
Gilbert MJ,
Wilson L,
Manley SA,
Lupton SD,
Overell RW,
Reynolds TC,
Corey L,
Greenberg PD:
T-cell mediated rejection of gene-modified HIV-specific cytotoxic T lymphocytes in HIV-infected patients.
Nat Med
2:216,
1996[Medline]
[Order article via Infotrieve]
32.
Ferrari G,
Rossini S,
Giavazzi R,
Maggioni D,
Nobili N,
Soldati M,
Ungers G,
Mavilio F,
Gilboa E,
Bordignon C:
An in vivo model of somatic cell gene therapy for human severe combined immunodeficiency.
Science
251:1363,
1991[Abstract/Free Full Text]
33.
Hirschhorn R,
Yang DR,
Puck JM,
Huie ML,
Jiang CK,
Kurlandsky LE:
Spontaneous in vivo reversion to normal of an inherited mutation in a patient with adenosine deaminase deficiency.
Nat Genet
13:290,
1996[Medline]
[Order article via Infotrieve]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A. Mortellaro, R. J. Hernandez, M. M. Guerrini, F. Carlucci, A. Tabucchi, M. Ponzoni, F. Sanvito, C. Doglioni, C. D. Serio, L. Biasco, et al.
Ex vivo gene therapy with lentiviral vectors rescues adenosine deaminase (ADA)-deficient mice and corrects their immune and metabolic defects
Blood,
November 1, 2006;
108(9):
2979 - 2988.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Geronimi, E. Richard, I. Redonnet-Vernhet, I. Lamrissi-Garcia, M. Lalanne, C. Ged, F. Moreau-Gaudry, and H. de Verneuil
Highly Efficient Lentiviral Gene Transfer in CD34+ and CD34+/38-/lin- Cells from Mobilized Peripheral Blood after Cytokine Prestimulation
Stem Cells,
July 1, 2003;
21(4):
472 - 480.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. M. Muul, L. M. Tuschong, S. L. Soenen, G. J. Jagadeesh, W. J. Ramsey, Z. Long, C. S. Carter, E. K. Garabedian, M. Alleyne, M. Brown, et al.
Persistence and expression of the adenosine deaminase gene for 12 years and immune reaction to gene transfer components: long-term results of the first clinical gene therapy trial
Blood,
April 1, 2003;
101(7):
2563 - 2569.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. G. Hawley and D. A. Sobieski
Of Mice and Men: The Tale of Two Therapies
Stem Cells,
July 1, 2002;
20(4):
275 - 278.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. S. Rosen
Successful Gene Therapy for Severe Combined Immunodeficiency
N. Engl. J. Med.,
April 18, 2002;
346(16):
1241 - 1243.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Ariga, N. Oda, K. Yamaguchi, N. Kawamura, H. Kikuta, S. Taniuchi, Y. Kobayashi, K. Terada, H. Ikeda, M. S. Hershfield, et al.
T-cell lines from 2 patients with adenosine deaminase (ADA) deficiency showed the restoration of ADA activity resulted from the reversion of an inherited mutation
Blood,
May 1, 2001;
97(9):
2896 - 2899.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Ariga, N. Oda, I. Sanstisteban, F. X. Arredondo-Vega, M. Shioda, H. Ueno, K. Terada, K. Kobayashi, M. S. Hershfield, and Y. Sakiyama
Molecular Basis for Paradoxical Carriers of Adenosine Deaminase (ADA) Deficiency That Show Extremely Low Levels of ADA Activity in Peripheral Blood Cells Without Immunodeficiency
J. Immunol.,
February 1, 2001;
166(3):
1698 - 1702.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T.C. Hart, M.L. Marazita, and J.T. Wright
The Impact of Molecular Genetics on Oral Health Paradigms
Critical Reviews in Oral Biology & Medicine,
January 1, 2000;
11(1):
26 - 56.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Kawamura, T. Ariga, M. Ohtsu, I. Kobayashi, M. Yamada, A. Tame, H. Furuta, M. Okano, M. Egashira, N. Niikawa, et al.
In Vivo Kinetics of Transduced Cells in Peripheral T Cell-Directed Gene Therapy: Role of CD8+ Cells in Improved Immunological Function in an Adenosine Deaminase (ADA)-SCID Patient
J. Immunol.,
August 15, 1999;
163(4):
2256 - 2261.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Onodera, D. M. Nelson, A. Yachie, G. J. Jagadeesh, B. A. Bunnell, R. A. Morgan, and R. M. Blaese
Development of Improved Adenosine Deaminase Retroviral Vectors
J. Virol.,
March 1, 1998;
72(3):
1769 - 1774.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|