Blood, Vol. 91 No. 1 (January 1), 1998:
pp. 309-318
Gamma-Globin Gene Promoter Elements Required for Interaction With
Globin Enhancers
By
Scott D. Langdon and
Russel E. Kaufman
From the Departments of Medicine and Biochemistry, Duke University
Medical Center, Durham, NC.
 |
ABSTRACT |
Normal expression of the human 
-globin domain genes is dependent
on at least three types of regulatory elements located within the
-globin domain: the locus control region (LCR), globin enhancer
elements (3
and 3A
), and the individual globin gene
promoter and upstream regions. It has been postulated that regulation
occurs through physical interactions between factors bound to these
elements, which are located at considerable distances from each other.
To identify the elements required for promoter-enhancer interactions
from a distance, we have investigated the expression of the wild-type,
truncated, and mutated -globin promoters linked to the 5HS2
enhancer. We show that in K562 cells, 5HS2 increases activity
approximately 20-fold from both a wild-type and truncated (-135
+25) promoter and that truncation or site-directed
mutagenesis of the tandem CCAAT boxes eliminated the enhancement by
5HS2. Mutation of the -globin gene promoter GATA-1 binding
sites did not decrease either promoter strength or enhancement of
activity by 5HS2. To determine if enhanced expression of
-globin gene promoters carrying mutations associated with hereditary
persistence of fetal hemoglobin (HPFH) was due to
greater interactions with enhancers, we linked these HPFH -globin
gene promoters to 5HS2 and demonstrated a twofold to threefold
higher expression than the corresponding wild-type promoter plus
enhancer in MEL cells. Addition of the A-globin gene 3
enhancer to a plasmid containing the -globin gene promoter and
5HS2 did not further enhance promoter strength. Furthermore, we
have demonstrated that the previously identified core 5HS2
enhancer (46-bp tandem AP-1/NF-E2 sites) increased expression only when
located 5, but not 3, to the -globin-luciferase
reporter gene, suggesting that its enhancer effect is not by DNA
looping. Our results suggest that CCAAT boxes, but not GATA or CACCC
binding sites, are required for interaction between the -globin
promoter and the LCR/5HS2 and that regulatory elements in
addition to the core enhancer may be required for the enhancer to act
from a distance.
| |
INTRODUCTION |
THE FIVE FUNCTIONAL human -globin
family genes (
, G, A, 
, and ) are grouped within a 70-kb
domain located on chromosome 11.1 The G and A genes
are normally expressed at high levels only during fetal development,
followed by switching to adult -globin around the time of birth. As
a result of this switching, Hb F constitutes only 1% to 2% of the
total hemoglobin in normal adults. An exception are individuals with
hereditary persistence of fetal hemoglobin (HPFH). These individuals
have elevated (5- to 80-fold) expression of -globin and Hb F levels
of up to 20% during adult life. Elevated Hb F levels can be beneficial
to patients with -thalassemias or sickle cell anemia by reducing the
severity of their disease.
The -globin domain genes are regulated by a region containing a
series of erythroid-specific DNase I hypersensitivity sites
(5HS1-4) located 6 to 18 kb upstream of the -globin gene
termed the locus control region (LCR).2-5 The -globin
domain LCR performs at least two important functions: first, it creates
an open chromosomal region more accessible to trans-acting
transcription factors6,7 and second, it contains strong
enhancers required for high-level, developmentally correct expression
of the individual -globin domain genes.8-12 Within the
LCR, 5HS2 behaves as a strong enhancer in both transient
expression and transgenic mice experiments.8-10,13 It is
sufficient for appropriate developmental expression of a linked globin
gene cluster in transgenic mice.14 Analysis of 5HS2
has identified tandem AP-1/NF-E2 sites, and a 46-bp fragment containing
these sites is necessary and sufficient to enhance expression of a
linked -globin reporter gene.15,16 Although the
molecular mechanisms underlying how the LCR directs correct globin gene
expression are unknown, physical interactions between multiple
protein-DNA complexes bound to individual gene promoters and the LCR
are postulated to be involved, perhaps via DNA looping5,17
(and references therein). Recently, Cavallesco and Tuan18
divided the HS2 enhancer into an enhancer core and five modulatory
domains to identify regions necessary for productive interaction with
the -globin gene promoter. They found that different subdomains
modulated enhancement of the -globin gene promoter activity both
positively and negatively at different developmental stages.
Furthermore, recent work by Ronchi et al19 led them to
conclude that multiple functionally redundant promoter elements are
involved in -globin gene promoter/LCR interactions. These
interactions may be required for the formation of an active
transcription complex that contains both the LCR and individual gene
promoters. In such a model, promoter elements could have dual roles of
promoting transcription initiation and aiding promoter/enhancer
interactions.
Besides the LCR, the G and A-globin genes are regulated by
cis-acting elements found within their promoters. Based on DNA-protein
binding experiments, promoter activity experiments, and the
identification of -globin promoter mutations in patients having
nondeletional HPFH, at least nine sites of DNA-protein interaction
(
30 ATAAA, 50 GGGGCCGG, 85 and 112 CCAAT,
145 CACCC, 170 and 190 GATA, 180 ATGCAAAT,
and 200 CCCGGG elements) have been identified within the
260 +25 region of the -globin
promoter.20-26 The functional importance of these binding
sites has been examined by numerous investigators using transient and
stable expression experiments. Within the -globin 5 upstream
region the ATAAA and tandem CCAAT elements constitute a minimal
promoter. These sites direct correct, but low level, transcription of
the -globin gene.27,28 The 145 CACCC site binds
Sp1 and is required for high level expression. Deletion or mutation of
the CACCC element reduces -globin promoter activity to 10% to 20%
of the wild-type level.29-31 Further upstream, the
150 260 region of the -globin promoter is
involved in directing correct developmental stage-specific expression.
When combined with a minimal -globin promoter, this region directed
expression of the otherwise silent -globin gene in K562 cells and in
transgenic mice.32,33
Not previously studied is how globin gene enhancers such as the
LCR/5HS2 interact with the -globin promoter from a distance
to increase -globin expression. Current models predict that multiple
promoter-enhancer interactions will be involved in the correct
developmental stage-specific expression. One approach to identify
regulatory factors involved in promoter-enhancer interaction is to
perform expression assays with normal and mutated promoters in the
absence and presence of an enhancer. The introduction of
cis-acting mutations in the -globin gene promoter in such
assays could identify transcription factor binding sites that are
required for physical interaction of the promoter and enhancer because
they may have a much greater effect on levels of enhancer-mediated
expression relative to basal expression. Studies of human -globin
domain genes using this approach have identified a GATA binding site
within the -globin promoter and an erythroid Kruppel-like factor
(EKLF) binding site within the -globin gene promoter that are
required for interaction between these promoters and erythroid
enhancers.34-36
Our goal in these studies was to identify elements required for
interaction of the -globin promoter with 5HS2 in a fetal
erythroid environment. In this report, we focus on the -globin
promoter and report a systematic analysis of the regulatory elements
within the human G-globin promoter required for the
interaction of the promoter with 5HS2. Although normally
expressed only during fetal development, -globin is expressed during
adult life in patients with HPFH. Therefore, we also examined the
effect of three nondeletional HPFH mutations on the interaction between
the -globin promoter and globin enhancers to investigate whether
increased interaction between the HPFH promoters and the LCR might
contribute to the continued expression of -globin in adult erythroid
cells. Because HPFH patients express -globin during both fetal and
adult life, we performed the assays with the HPFH mutations in both
fetal and adult erythroid cells. Finally, we compared the effect of the
full-length and core 5HS2 enhancers on -globin gene
expression to determine if the core 5HS2 enhancer was sufficient
for interaction with the -globin promoter. Our results demonstrate
the 5HS2 enhancer is able to activate a minimal -globin gene
promoter and suggest that CCAAT boxes, but not GATA or CACCC binding
sites, are required for interaction between the -globin promoter and
the LCR/5HS2. Also, regulatory elements within the full-length
5HS2, but not the 46-bp core enhancer, may be required for the
enhancer to act from a distance.
| |
MATERIALS AND METHODS |
Plasmid DNA constructions.
DNA fragments containing G-globin promoter sequence from
259, 204, 160, 135, and 72 to +25
relative to the start of transcription were generated by polymerase
chain reaction and cloned as BamHI-HindIII fragments
into the promoterless luciferase reporter plasmid pOLUC.37
The 5HS2 (1 kb, Genebank nucleotide [nt] no.
8260-9260), core HS2 (37 bp, nt no. 8651-8687), and 3 (250-bp
Pst I, nt no. 64310-64560) enhancer fragments were first cloned
into the multiple cloning site of pUC118, and a PvuII fragment
containing the enhancer sequence plus plasmid sequence was then cloned
into the unique PvuII site in pOLUC. The PvuII fragment
of pUC118 alone was used to create the reporter plasmids lacking an
enhancer. When the core HS2 enhancer was located 5 to the
-globin promoter, two complementary oligonucleotides with
BamHI ends were annealed together and directly cloned into the
unique BamHI site of the -globin-luciferase plasmid. The
correct 5 3 orientation of enhancer fragments
relative to the promoter-luciferase reporter gene was determined by
restriction enzyme analysis. -globin promoter mutations were created
using polymerase chain reaction site-directed mutagenesis38
and confirmed by DNA sequencing. Plasmids used in the stable
transformation colony assays were constructed by replacing the
luciferase reporter gene with the neomycin resistance
(neoR) gene from pUC9-Aneo.31
The plasmid pCMV-SEAP expresses secreted alkaline
phosphatase39 under control of the intermediate early gene
promoter of the human cytomegalovirus. The plasmid pRSV-bGAL contains
the bacterial lacZ reporter gene under the control of the Rous
Sarcoma Virus LTR promoter. Plasmid DNA used in electroporation
experiments was purified by CsCl/EtBr ultracentrifugation or Qiagen
plasmid kit (Qiagen, Chatsworth, CA).
Cell growth and electroporation conditions.
Human erythroleukemia K562 and murine erythroleukemia MEL cells were
grown in RPMI 1640 medium plus 10% fetal bovine serum and
penicillin/streptomycin (GIBCO-BRL, Grand Island, NY)
in a humidified 5% CO2 environment. The cells were
routinely maintained at a density of 1 to 5 × 105/mL.
Transient DNA transfections were performed by electroporation using a
BIORAD Gene Pulser (Bio-Rad Laboratories, Hercules,
CA). Approximately 2.5 × 106 cells were
electroporated with 10 µg supercoiled reporter plasmid DNA at 960
µF and 220 mV or 280 mV for K562 and MEL cells,
respectively. A total of 5 µg supercoiled pCMV-SEAP plasmid or
pRSV-GAL plasmid DNA was also included to measure electroporation
efficiency. The transfected cells were harvested after 16 hours and
then assayed for luciferase and secreted alkaline phosphatase enzyme
activity or -galactosidase enzyme activity. At least two different
DNA preparations of each reporter plasmid were tested.
Enzyme assays.
Electroporated cells were collected by centrifugation, washed with 1X
phosphate-buffered saline (PBS) and resuspended in
KPO4 buffer (100 mmol/L
KH2PO4 pH, 7.8, 3 mmol/L MgCl2, 1
mmol/L dithiothreitol [DTT]). Extracts were prepared
by adding an equal volume of KPO4 + 2% NP-40 buffer,
incubation on ice for 10 minutes, centrifugation for 10 minutes at
13,000g at 4°C, and collection of the supernatant.
Luciferase enzyme activity was determined as described40
using a model 1251 Luminometer (Pharmacia Biotech,
Piscataway, NJ). Secreted alkaline phosphatase enzyme activity was
determined in the culture supernatant by the method of Berger et
al.39 -Galactosidase enzyme activity was determined on
an aliquot of transfected cells or cell extract using the method of
Miller.41 Protein concentrations were determined by the
method of Bradford42 using bovine serum albumin as the
standard. Luciferase activity was corrected for electroporation
efficiency using the measured SEAP or -galactosidase activity and
calculated as light units per minute per mg protein per unit SEAP or
-galactosidase activity. Stable transformation colony assays were
performed as described.43
Gel retardation assays.
Nuclear extracts were prepared by the method of Dignam et
al.44 Gel retardation assays were performed according to
the method of Sykes and Kaufman45 with high-performance
liquid chromatography (HPLC) purified double-stranded oligonucleotides
containing either the wild-type -globin promoter sequence from nt
no. 165 to 212
5ATCTTGGGGGCCCCTTCCCCACACTATCTCAATGCAAATATCTGTCT 3 or the
mutated GATA sequence
5ATCTTGGGGGCCCCTTCCCCACACGCGATCAATGCAAAGCGATGTCT 3.
The rabbit polyclonal GATA-1 antiserum was raised against
Escherichia coli overproduced mouse GATA-1 protein in the
following manner. Full-length mouse GATA-1 was overexpressed in E
coli using the T7 RNA polymerase system of Studier et
al.46 The predominantly insoluble protein was gel purified
from a sodium dodecyl sulfate (SDS)-agarose Prosieve gel (FMC
Bioproducts, Rockland, ME) and used to immunize
rabbits. Positive antiserum was identified by immunoblotting and gel
retardation assays using E coli expressed, mouse, and human
GATA-1 protein (data not shown).
| |
RESULTS |
The location of the G-globin gene, 5HS2, and the
A and 3 enhancers in the -globin domain are shown in
Fig 1. DNA fragments containing wild-type,
mutant, and truncated -globin gene promoter sequences were cloned
upstream of the luciferase reporter gene in the plasmid p0LUC. Enhancer
sequences were cloned 150-bp 3 to the reporter gene and in the
normal 5 3 orientation to minimize
any promoter-like activity they might have. In this location, the
enhancers are required to work from a distance, rather than have a
local effect on the promoter. These reporter plasmids were transfected
into K562 cells and the luciferase activity was measured to determine
the level of -globin gene promoter activity. K562 cells were used as
a model of fetal erythroid development, as they express embryonic and
fetal, but not adult, globin.47 In some experiments, MEL
cells were used as host cells to test the expression of some of the
plasmids in an adult erythroid environment because MEL cells express
predominately -globin.48
View larger version (17K):
[in this window]
[in a new window]
| Fig 1.
Diagram of the human -globin gene domain showing the
arrangement of the five -globin genes, the position of the six
identified DNase I hypersensitive (HS) sites (arrows), and the location
of the 5HS2 and 3 enhancer elements (E). The expanded
view of the G gene promoter region shows the recognition sites for
the DNA-binding proteins GATA-1 and OBP.
|
|
Deletion analysis of the -globin promoter.
To assess the effect of cis-acting elements on the 5HS2-mediated
enhancement of -globin gene expression, deletions of the
G-globin promoter were created at positions 259,
204, 160, 135, and 73 relative to the start
of transcription. Deletion endpoints were selected to sequentially
remove known binding sites within the -globin promoter (Fig 1). In
the first set of experiments, no enhancers were included in the
expression vector. The relative promoter activity of these segments of
the -globin gene was assessed by transfection into K562 cells and
measurement of luciferase activity, shown in Fig
2. Deletion of -globin promoter sequence
from 259 to 160 reduced activity approximately 25%,
while deletion to 135 further decreased activity 85% over the
full-length construct, confirming the importance of the 145
CACCC binding site for full -globin promoter
activity.30,31,49
View larger version (31K):
[in this window]
[in a new window]
| Fig 2.
Relative activity of truncated -globin promoter plus
enhancer plasmids in uninduced K562 cells. Activities are calculated
relative to the wild-type -globin promoter-luciferase plasmid
without enhancer. The activity values are presented as the mean ± the
standard error of the mean (SEM) and n denotes the number of assays
performed.
|
|
Identical plasmids to which the 5HS2 enhancer was added were
then tested under similar conditions. The addition of 5HS2 to
the expression vector augmented the full-length (259) -globin
gene promoter expression approximately 15-fold to 20-fold over the
vector without the 5HS2 element. The promoter strength of the
truncation fragments from 204, 160, or 135 showed
similar levels of enhancement by the addition of 5HS2,
suggesting that there were no cis-acting elements in that region that
were important in 5HS2 enhancer-promoter interactions. For
example, although the 135 -globin promoter without the
5HS2 enhancer had only 14% of the 259 +25
promoter's activity, the addition of 5HS2 was still able to
increase activity 30-fold. Only the 73 -globin promoter did
not show a strong enhancement with 5HS2. These results
demonstrate that the 5HS2 enhancer is able to activate a minimal
-globin promoter and suggest that cis-acting elements located within
the 135 73 region are required for
promoter-5HS2 enhancer interaction. Two CCAAT boxes and a
degenerate GATA binding site have been previously identified in this
region.
Effect of CCAAT box mutations on -globin expression.
To directly test the importance of the CCAAT boxes, we mutated (CCAAT
CCGTT) the 112 and the 85 CCAAT boxes within
the 259 +25 -globin promoter and performed
transient assays in K562 cells. As shown in Fig
3, in the absence of any enhancer, the
mutation of either the upstream or downstream CCAAT box decreased
relative promoter activity to .64 ± 0.23 or .84 ± 0.37,
respectively. Mutation of both sites reduced activity to 16% of the
wild-type level. In these experiments, addition of the 5HS2
enhancer to the 259 +25 -globin promoter resulted
in a 9.7 ± 3.5-fold enhancement. In the presence of the 5HS2
enhancer, the individual mutation of the 112 and the 85
boxes reduced activity to 40% and 46% of this activity, respectively,
while mutation of both sites decreased activity to 5% of the wild-type
level. Thus, mutation of both CCAAT boxes reduced activity to the same
level as truncation of the -globin promoter to 73
+25. Based on these results, we conclude that at least one CCAAT box is
required for -globin promoter function and for enhancement of
-globin promoter activity by 5HS2.
View larger version (28K):
[in this window]
[in a new window]
| Fig 3.
Relative activity of wild-type and mutated CCAAT
-globin promoter plus enhancer plasmids in uninduced K562 cells.
Activities are calculated relative to the wild-type -globin
promoter-luciferase plasmid without enhancer. The activity values are
presented as the mean ± SEM and n denotes the number of assays
performed.
|
|
Role of -globin GATA binding sites.
In the human -globin promoter, a conserved GATA binding site is
required for interaction of the promoter with an erythroid-specific
enhancer, but loss of the site does not alter expression in the absence
of an enhancer.36 In the -globin promoter, two GATA
binding sites are located at position 169 195
separated by an OCT-1 binding site (Fig 1). These binding sites are
conserved in humans and simian primates expressing a fetal form of
-globin, implying an important role in -globin
expression.50 Deletion of the segment of DNA containing
these elements had no significant effect on 5HS2-mediated
enhancement of the -globin promoter, but did not rule out a specific
role for the GATA elements. To determine if these conserved sites are
needed for -globin promoter function or interaction of the promoter
with the 5'HS2 or 3 enhancers, we mutated the core DNA
sequence of both GATA binding sites from GATA to TCGC (mutGATA) by
site-directed mutagenesis and again performed transient expression
assays in K562 cells. Mutation of both GATA sites did not reduce
promoter activity (Fig 4). We interpret
these results to indicate that an essential interaction between the
promoter and 5HS2 was not eliminated. Although there was an
increased expression of the mutGATA promoter when linked to
5HS2, these differences in expression were not statistically
significant.
View larger version (33K):
[in this window]
[in a new window]
| Fig 4.
Relative activity of wild-type and mutGATA -globin
promoter plus enhancer plasmids in uninduced K562 and MEL cells.
Activities are calculated relative to the wild-type -globin
promoter-luciferase plasmid without enhancer. The activity values are
presented as the mean ± SEM and n denotes the number of assays
performed. The wild-type -globin promoter data in part A are
repeated from Figs 2 and 3.
|
|
Because mutations that reduce GATA binding to these GATA binding motifs
are associated with elevated expression of the human -globin gene
during adult life, we examined the expression of these promoters in MEL
cells, which have an adult developmental pattern of expression of
globin genes. Again, the -globin gene promoter carrying the GATA
mutations had a higher level of expression than the wild-type promoter
when linked to 5HS2 (2.9 ± 0.84 compared with 7.3
± 1.8, respectively, P < .005).
To determine if this effect was specific for the 5HS2 enhancer,
we linked the 3 enhancer to the wild-type and GATA mutant
-globin promoters and assayed their expression in K562 and MEL
cells. The 3 enhancer had no significant enhancing activity
when linked to the wild-type promoter in K562 cells. In contrast, it
increased the expression of the GATA mutant promoter 3.5-fold in K562
cells (P < .001). In MEL cells, the 3 enhancer
increased expression of the wild-type promoter approximately fivefold
and increased the expression of the mutant GATA promoter 6.6-fold, a
difference that is not statistically significant. These data indicate
that both the enhancer and the environment affect the degree of
activation in these experimental systems.
To determine if these effects could be duplicated with vectors that
were integrated into the genome, we performed stable transformation
colony assays.43 The level of -globin expression was
measured by the number of productive integration events that resulted
in G418-resistant colonies. As shown in Table
1, mutGATA -globin expression was again
not decreased compared with the WT promoter and an increased number of
integration events were seen with the GATA mutant promoter.
To ensure that these sequence changes abolish GATA-1 protein binding to
the DNA, we performed gel retardation assays using DNA fragments
containing the wild-type or mutated binding sites. Incubation of
nuclear proteins from K562 or MEL cells with the wild-type fragment
containing GATA and OCT binding sites resulted in one GATA-1 and one
OCT-1 protein/DNA complex being formed (Fig
5, lanes 1 to 4). Addition of GATA-1
antiserum in lanes 2 and 4 abolishes the GATA-1/DNA complex. Mutation
of the GATA sequences eliminates both GATA-1 and OCT-1 binding (Fig 5,
lanes 5 to 8). Because the proximal GATA binding site and the OCT
binding sites overlap (nt no. 175, see Fig 1), OCT-1 binding is
also lost with these mutations. We conclude that the binding of the
transcription factors GATA-1 and OCT-1 to the -globin promoter are
not required in this system for either promoter function or interaction
between the promoter and the 5HS2 or 3 enhancers.
Furthermore, loss of binding may permit higher levels of expression in
this system.
View larger version (102K):
[in this window]
[in a new window]
| Fig 5.
GATA-1 and OCT-1 do not bind to the mutated GATA binding
site. Gel retardation assays showing the binding of K562 (K) and MEL
(M) nuclear proteins to the wild-type and mutGATA binding sites. GATA-1
antiserum (lanes 2, 4, 6, and 8) disrupts the GATA-1/DNA complex.
|
|
Do three HPFH point mutations enhance
-globin/5HS2 interaction?
Based on these results, we examined the possibility that nondeletional
HPFH mutations might alter the interaction of the -globin promoter
with 5HS2, especially in an adult erythroid environment.
Mutations were made in the 259 +25 -globin
promoter to create the 202 C G, -198 T C,
and 175 T C mutations associated with HPFH, and these
promoters were examined for enhancer-mediated -globin expression in
both K562 and MEL cells (Figs 6 and
7). These mutations were also tested
because they lie in previously identified binding sites within the
-globin promoter.
View larger version (32K):
[in this window]
[in a new window]
| Fig 6.
Relative activity of -globin HPFH promoter plus
enhancer plasmids in uninduced K562 cells. Activities are calculated
relative to the wild-type -globin promoter-luciferase plasmid
without enhancer. The activity values are presented as the mean ± SEM
and n denotes the number of assays performed. A value of 1.0x
represents 45,947 ± 7,860 light units per minute per mg protein per
unit SEAP activity.
|
|
View larger version (31K):
[in this window]
[in a new window]
| Fig 7.
Relative activity of -globin HPFH promoter plus
enhancer plasmids in uninduced MEL cells. Activities are calculated
relative to the wild-type -globin promoter-luciferase plasmid
without enhancer. The activity values are presented as the mean ± SEM
and n denotes the number of assays performed. A value of 1.0x
represents 3,087 ± 1,089 light units per minute per milligram protein
per unit SEAP activity.
|
|
In the absence of enhancer elements, the activity of the 202 and
198 -globin HPFH promoters were unchanged compared with the
wild-type promoter. In agreement with previous reports, we found the
175 T C change increased expression in K562 cells 3.0
± 1.3-fold (P < .001) (Fig 6D).21,51-53 No
other significant increase in expression was observed in K562 or MEL
cells with any HPFH mutation. Previous studies have suggested that
these mutations do not cause persistence of -globin expression
merely by increasing promoter strength.31
We next tested the effects of addition of the 5HS2 enhancer on
the HPFH promoters in K562 cells. This enhancer is active in K562 and
MEL cells. In addition, we used the vector that substituted the
5HS2 enhancer with the 3 enhancer. The use of the
3 enhancer permitted us to determine if the effect of the
5HS2 enhancer is specific and allowed us to test for the
possibility that an HPFH mutation might permit the -globin gene
promoter carrying the mutation to have a productive interaction with
another globin enhancer, such as 3. In K562 cells, only the
175 T C promoter plus an enhancer had significantly
increased activity. The 5HS2 enhancer (Fig 6D) linked to the
-175 T C promoter produced a level of expression of 45.9
compared with the level of 19.3 seen when 5HS2 is linked to the
wild-type promoter (P < .001). This does not necessarily
indicate a greater enhancer/promoter interaction, as the basal
expression level of the -175 T C promoter had a threefold
level of expression over the wild-type. Substitution of the 3
enhancer for 5HS2 resulted in an 11.7-fold increased expression
of the mutant promoter compared with the threefold 3
enhancement of the wild-type promoter, again producing an effect that
can be explained by the basal promoter strength of the 175
mutant promoter and not more productive interactions with the enhancer.
The 198 T C and 202 C G mutations
plus either enhancer did not significantly increase expression compared
with the wild-type promoter.
In MEL cells (Fig 7), both
the 202 C G and 175 T C promoters
increased expression approximately twofold (P < .001) higher
with the 5HS2 enhancer than the wild-type promoter. The 198 T
C promoter plus 3 enhancer increased expression
2.7-fold higher (P < .02) than the wild-type promoter plus
3 enhancer. Thus, in an adult erythroid environment, each of
the three HPFH promoters in combination with a globin enhancer showed
twofold to threefold increased enhancement compared with the wild-type
promoter plus enhancer, while in fetal erythroid cells, only the
175 T C promoter showed increased enhancer-mediated
expression by globin enhancers.
View larger version (18K):
[in this window]
[in a new window]
| Fig 8.
Relative activity of wild-type -globin promoter plus
core HS2 enhancer plasmids in uninduced K562 cells. Activities are
calculated relative to the wild-type -globin promoter-luciferase
plasmid without enhancer. The activity values are presented as the mean
± SEM and n denotes the number of assays performed.
|
|
Do other -globin gene regulatory elements participate
in the interaction with HS2 or the -globin gene
promoter?
The previous studies have examined the interaction of HS2 with the
-globin gene promoter. However, these studies do not examine the
-globin gene promoter in its natural context linked to the
3 enhancer. Therefore, we examined the effect of the
5HS2 enhancer on -globin gene promoter function when the
3 enhancer was linked in cis. This enhancer was inserted
5 to the promoter and the 5HS2 enhancer was left in the
3 location used for all the previous assays. The expression
level of this plasmid was compared with the plasmid that included only
5HS2 enhancer. The addition of the 3 enhancer to the
gamma-luciferase expression vector resulted in no significant increase
in expression in transient assays (relative activity wild-type + no
enhancer = 1.0 v wild-type + A enhancer = 0.9).
Therefore, we conclude that in this assay system, the presence of
3 had no significant effect on the interaction of 5HS2
with the -globin gene promoter region.
The ultimate goal of these studies is to determine the factors in both
the enhancer and promoter that interact. Previous studies of
5HS2 have identified a tandem AP-1/NF-E2 core that functions as
an inducible enhancer in erythroid cells.15,16,54 When
linked 5 to the -globin gene promoter, it serves as a strong
activator at approximately 40% to 50% level of the full 5HS2
fragment. To determine if this core 5HS2 enhancer was
responsible for the interaction with the -globin promoter, we
substituted the 46-bp core enhancer for the full-length 5HS2
enhancer in either the 5 or 3 position of our expression
vector (Fig 8). When assayed in K562 cells, as previously reported, the
core HS2 enhancer increased expression 11.5-fold when placed
immediately upstream of the promoter.54 In contrast to the
full-length 5HS2 enhancer, however, the core HS2 enhancer did
not increase expression when placed 150 bp 3 to the -globin
promoter-luciferase reporter gene. This suggests that the core HS2
enhancer is unable to activate -globin expression from a distance
and therefore may not be functioning as a true enhancer. Furthermore,
they indicate that the core element is not responsible for the
interaction of 5HS2 with the -globin promoter. A more
detailed analysis of 5HS2 will be required.
| |
DISCUSSION |
Many models of globin switching propose that selective interaction
between individual promoters and the LCR is a central mechanism for
regulating globin gene expression.5,17 Using transient
expression assays, we have attempted to identify elements in the
-globin promoter that are essential for productive interactions with
globin gene enhancers. These experiments have focused on the
5HS2 enhancer because it has been demonstrated to be sufficient
for normal developmental expression of globin genes in experimental
systems.14 As previously reported, the strong 5HS2
enhancer increased expression from the -globin promoter
approximately 20-fold in uninduced K562 cells.54,55 In MEL
cells, -globin promoter activity was low and the globin enhancers
had only small effects on expression, reflecting the normally low fetal
globin levels found during adult life. Our data support the hypothesis
that interaction between the promoter and the LCR/5HS2
element can produce high level -globin expression and that this
interaction occurs predominately during fetal development.
Within the -globin promoter, loss of both CCAAT boxes by either
truncation or site-directed mutagenesis eliminated the enhancement by
5HS2. Mutation of either the proximal or distal CCAAT box,
however, resulted in an approximately 50% reduction in activity with
5HS2. Thus, it appears that at least one CCAAT box is required
for promoter-enhancer interaction and that either CCAAT box is
functional. The ability of 5HS2 to enhance a minimal globin
promoter containing CCAAT and TATA binding sites has also been reported
for both the - and -globin genes. A truncated -globin promoter
containing only its CCAAT and TATA sites was still activated 33-fold by
5HS2.56 Also, a truncated human -globin promoter
containing only a TATA and CCAAT element was activated by LCR sequences
in MEL cells.34 Therefore, CCAAT boxes may be generally
required for the LCR to interact with globin promoters.
In erythroid cells, the factors CP1/NFY, CDP, NF-E3, and GATA-1 have
been shown to interact in vitro with the -globin promoter CCAAT box
region.57-60 Of these factors, GATA-1 is the only factor
previously shown to be required for a promoter-enhancer interaction.
Several observations make it unlikely, however, that GATA-1 binding to
the -globin CCAAT box region is playing a similar role. First,
GATA-1 binding to the -globin CCAAT boxes is not observed in
embryonic and fetal cells, but is strong in extracts from adult cells
where -globin is not normally expressed.59 Second, in
adult cell extracts, GATA-1 binds to the wild-type, but not the
117 G A HPFH CCAAT box.57,59 And finally,
our mutation of the CCAAT boxes did not alter the GATA binding site,
yet we still observed a decrease in -globin enhancement. Thus, the
pattern of GATA-1 binding to the -globin CCAAT box region is
consistent with GATA-1 having a repressive, not positive function. Of
the three remaining known binding factors, CP1/NFY and NF-E3 are both
positive activators,61,62 and therefore elimination of
their binding would be consistent with our mutation results. Recent
experiments by Ronchi et al62 with purified NF-E3 did not
detect binding to the -85 CCAAT box and led them to conclude that the
112 CCAAT box is predominately occupied by CP1/NFY, rather than
NF-E3 in cells expressing -globin. Thus, the involvement of CP1/NFY
seems most consistent with our findings.
Previous studies of the - and -globin gene promoters have
identified GATA and CACCC sites as important for interaction with the
LCR. Gong et al36 demonstrated that within the promoter
the GATA site at 165 is required for interaction of the promoter
with erythroid enhancers. In similar experiments, Motamed et
al56 reported that the promoter CACCC box is an
essential component of the 5HS2 enhancer- promoter
interaction. In the -globin promoter, recent studies with the CACCC
box binding factor erythroid Kruppel-like factor (EKLF) have shown that
EKLF increased expression of a HS2-CAT reporter plasmid 30-fold in
K562 cells and when linked to a -LUC reporter HS2-CAT was
activated 1,000-fold.35 EKLF has also been shown to be
critical for inducible expression directed by either the 
- or
-LCR63 and mutations in the -globin promoter CACCC
box strongly decreased its response to the LCR in induced MEL
cells.34 Our finding that 5HS2 is able to strongly
activate a 130 +25 -globin promoter is in
agreement with the results of Stamatoyannopoulos et al,64
who found that the LCR was able to activate and correctly regulate a
141A transgene in mice. Combined with our finding
that mutation of the -globin promoter GATA sites resulted in no
decrease in promoter activity, these results suggest that the
-globin promoter does not require GATA-1 or CACCC binding factors to
interact with the LCR. This implies that the LCR must be interacting
with the -globin promoter in a different manner than with the -
and -globin promoters.
The role of GATA-1 in the regulation of the human -globin genes is
still unclear. The fact that the GATA sites are evolutionarily
conserved in all globin genes expressed during fetal development and
the occurrence of the 175 T C HPFH mutation suggests
that GATA-1 is involved in regulating -globin expression. Unlike the
human delta and epsilon genes,36,65,66 however, mutation of
the -globin GATA sites had no effect in this system on activation,
repression, or promoter-enhancer interaction. The modest increase in
activity we observed with mutGATA + 5HS2 may be the result of
eliminating OCT-1 binding, as a twofold repressive activity for OCT-1
in K562 cells has been reported.30,67 These results taken
together suggest that GATA-1 and OCT-1 binding are not essential for
-globin expression in fetal cells, although we have not ruled out a
repressive effect.
HPFH is a benign disorder where patients express high levels of
-globin during adult life. In a model of deletional HPFH, the
increased proximity of enhancer sequences to the -globin genes
resulting from inherited deletions of sequences 3 to the
-globin genes has been proposed as being responsible for the
increased Hb F production.68,69 We examined the possibility
that promoter/upstream mutations in nondeletional HPFH may be acting by
altering the interaction of the -globin promoter with the LCR and
either continuing promoter-enhancer interactions in adult cells
normally present only in fetal cells or by fostering interaction with a
different enhancer element, possibly the 3 enhancer. The HPFH
point mutations (202 C G, 198 T C,
175 T C) tested in this study fall in previously
identified regulatory elements and alter the binding of transcription
factors in vitro. The 202 C G mutation slightly
increases Sp1 binding and creates a binding site for the stage selector
protein.45,70 The 198 T C change creates
a strong Sp1 binding site28,71 and the 175 T
C mutation alters GATA-1 binding, while increasing promoter
strength approximately fourfold in erythroid cell
lines.21,51-53 Our finding that in MEL cells all three HPFH
promoters plus an enhancer had twofold to threefold higher expression
is consistent with the hypothesis that single-base HPFH mutations may
act to increase promoter-enhancer interactions. The small increases
found in these experiments, however, make determining the biologic
significance difficult. Additional studies will be required to answer
the question of whether increased interactions between HPFH promoters
and globin enhancers may be contributing to elevated Hb F levels in
adults.
The finding that the core HS2 element only functioned as an enhancer
when located immediately 5 to the -globin gene promoter
points out the importance of separating promoter and enhancer elements
when studying enhancer function. Experiments performed with enhancer
elements located adjacent to a promoter may only be measuring
transcriptional activation potential. Our core HS2 data suggests to us
a simple model where the tandem AP-1/NF-E2 sites act to bind
transcriptional activators such as NF-E2 and behaves as an activator.
Additional regulatory elements found within the 1-kb 5HS2
enhancer, however, are required for interaction from a distance with
the -globin gene. Several binding sites within the 5HS2
enhancer element have been previously identified including binding
sites for GATA-1, Sp1, USF, and YY1.20,72,73 These binding
sites are required for full 5HS2 activity.74-76 A
280-bp 5HS2 fragment containing these sites is also able to
enhance -globin expression from a distance in our assay system (data
not shown). Whether one or more of these sites are necessary for the
LCR to act from a distance remains to be established.
| |
FOOTNOTES |
Submitted March 12, 1996;
accepted August 27, 1997.
Supported in part by Grant No. 5P60-HL-2839-1-13 from the National
Institutes of Health (NIH). R.E.K. is a member of the
DUKE/UNC Comprehensive Sickle Cell Center. S.D.L. was supported by a
research fellowship from the Cooley's Anemia Foundation, New York,
NY.
Address reprint requests to Russel E. Kaufman, MD, Box 3250, Duke
University Medical Center, Durham, NC 27710.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section 1734 solely
to indicate this fact.
| |
REFERENCES |
1. Stamatoyannopoulos G, Nienhuis AW: Hemoglobin switching, in
Stamatoyannopoulos G, Nienhuis AW, Majerus PW, Varmus HE (eds):
Molecular Basis of Blood Diseases. Philadelphia, PA, Saunders, 1993, p
107
2.
Tuan D,
Solomon W,
Li Q,
London IM:
The "-like-globin" gene domain in human erythroid cells.
Proc Natl Acad Sci USA
82:6384,
1985[Abstract/Free Full Text]
3.
Forrester WC,
Takegawa S,
Papayannopoulou T,
Stamatoyannopoulos G,
Groudine M:
Evidence for a locus activation region: The formation of developmentally stable hypersensitive sites in globin-expressing hybrids.
Nucleic Acids Res
15:10159,
1987[Abstract/Free Full Text]
4.
Grosveld F,
Blom van Assendelft G,
Greaves DR,
Kollias G:
Position-independent, high-level expression of the human -globin gene in transgenic mice.
Cell
51:975,
1987[Medline]
[Order article via Infotrieve]
5.
Orkin SH:
Globin gene regulation and switching: Circa 1990.
Cell
63:665,
1990[Medline]
[Order article via Infotrieve]
6.
Forrester WC,
Epner E,
Driscol MC,
Enver T,
Brice M,
Papayannopoulou T,
Groudine M:
A deletion of the human -globin locus activation region causes a major alteration in chromatin structure and replication across the entire -globin locus.
Genes Dev
4:1637,
1990[Abstract/Free Full Text]
7.
Felsenfeld G:
Chromatin as an essential part of the transcriptional mechanism.
Nature
355:219,
1992[Medline]
[Order article via Infotrieve]
8.
Ryan TM,
Behringer RR,
Martin NC,
Townes TM,
Palmiter RD,
Brinster RL:
A single erythroid-specific Dnase I super-hypersensitive site activates high levels of human -globin gene expression in transgenic mice.
Genes Dev
3:314,
1989[Abstract/Free Full Text]
9.
Curtin PT,
Liu DP,
Liu W,
Chang JC,
Kan YW:
Human -globin gene expression in transgenic mice is enhanced by a distant Dnase I hypersensitive site.
Proc Natl Acad Sci USA
86:7082,
1989[Abstract/Free Full Text]
10.
Philipsen S,
Talbot D,
Fraser P,
Grosveld F:
The -globin dominant region: Hypersensitive site 2.
EMBO J
9:2159,
1990[Medline]
[Order article via Infotrieve]
11.
Talbot D,
Philipsen S,
Fraser P,
Grosveld F:
Detailed analysis of the site 3 region of the human beta-globin dominant control region.
EMBO J
9:2169,
1990[Medline]
[Order article via Infotrieve]
12.
Pruzina S,
Hanscombe O,
Whyatt D,
Grosveld F,
Philipsen S:
Hypersensitive site 4 of the human -globin locus control region.
Nucleic Acids Res
19:1413,
1991[Abstract/Free Full Text]
13.
Tuan DY,
Solomon WB,
London IM,
Lee DP:
An erythroid-specific, developmental-stage-independent enhancer far upstream of the human "beta-like globin" genes.
Proc Natl Acad Sci USA
86:2554,
1989[Abstract/Free Full Text]
14.
Roberts NA,
Sloane-Stanley JA,
Sharpe JA,
Wood WG:
Globin gene switching in transgenic mice carrying HS2-globin gene construct.
Blood
89:713,
1997[Abstract/Free Full Text]
15.
Sorrentino B,
Ney P,
Bodine D,
Nienhuis AW:
A 46 base pair enhancer sequence within the locus activating region is required for induced expression of the gamma-globin gene during erythroid differentiation.
Nucleic Acids Res
18:2721,
1990[Abstract/Free Full Text]
16.
Ney PA,
Sorrentino BP,
Lowrey CH,
Nienhuis AW:
Inducibility of the HSII enhancer depends on binding of an erythroid specific nuclear protein.
Nucleic Acids Res
18:6011,
1990[Abstract/Free Full Text]
17.
Choi O-R,
Engel JD:
Developmental regulation of -globin gene switching.
Cell
55:17,
1988[Medline]
[Order article via Infotrieve]
18. Cavallesco R, Tuan, D: Modulatory subdomains of the HS2 enhancer
differentially regulate enhancer activity in erythroid cells at
different developmental stages. Blood Cells, Molecules, and
Diseases 23:8, 1997
19. Ronchi A, Berry M, Raguz S, Imam A, Yannoutsos N, Ottolenghi, S,
Grosveld F, Dillon N: Role of the duplicated CCAAT box region in
globin gene regulation and hereditary persistence of fetal hemoglobin.
EMBO J 15:143, 1996
20.
Ikuta T,
Kan YW:
In vivo protein-DNA interactions at the -globin gene locus.
Proc Natl Acad Sci USA
88:10188,
1991[Abstract/Free Full Text]
21.
Martin DIK,
Tsai S-F,
Orkin SH:
Increased -globin expression in a nondeletion HPFH mediated by an erythroid-specific DNA-binding factor.
Nature
338:435,
1989[Medline]
[Order article via Infotrieve]
22.
Gumucio DL,
Rood KL,
Gray TA,
Riordan MF,
Sartor CI,
Collins FS:
Nuclear proteins that bind the human -globin gene promoter: Alterations in binding produced by point mutations associated with hereditary persistence of fetal hemoglobin.
Mol Cell Biol
8:5310,
1988[Abstract/Free Full Text]
23.
Mantovani R,
Malgaretti N,
Nicolis S,
Ronchi A,
Giglioni B,
Ottolenghi S:
The effects of HPFH mutations in the human -globin promoter on binding of ubiquitous and erythroid specific nuclear factors.
Nucleic Acids Res
16:7783,
1988[Abstract/Free Full Text]
24.
O'Neill D,
Kaysen J,
Donovan-Peluso M,
Castle M,
Bank A:
Protein-DNA interactions upstream from the human A gamma globin gene.
Nucleic Acids Res
18:1977,
1990[Abstract/Free Full Text]
25.
Mantovani R,
Malgaretti N,
Giglioni B,
Comi P,
Cappelini N,
Nicolos S,
Ottolenghi S:
A protein factor binding to an octamer motif in the -globin promoter disappears upon induction of differentiation and hemoglobin synthesis is K562 cells.
Nucleic Acids Res
15:9349,
1987[Abstract/Free Full Text]
26.
Jane SM,
Ney PA,
Vanin EF,
Gumucio DL,
Nienhuis AW:
Identification of a human stage selector element in the human -globin gene promoter that fosters preferential interaction with the 5HS2 enhancer when in competition with the -promoter.
EMBO J
11:2961,
1992[Medline]
[Order article via Infotrieve]
27.
Anagnou NP,
Karlsson S,
Moulton AD,
Keller G,
Nienhuis AW:
Promoter sequences required for function of the human gamma globin gene in erythroid cells.
EMBO J
5:121,
1986[Medline]
[Order article via Infotrieve]
28.
Catala F,
deBoer E,
Grosveld F:
Nuclear protein factors and erythroid transcription of the human A-globin gene.
Nucleic Acids Res
17:3811,
1989[Abstract/Free Full Text]
29.
Gumucio DL,
Rood KL,
Blanchard-McQuate KL,
Gray TA,
Saulino A,
Collins FS:
Interaction of Sp1 with the human globin promoter: Binding and transactivation of normal and mutant promoters.
Blood
78:1853,
1991[Abstract/Free Full Text]
30.
McDonagh KT,
Lin HJ,
Lowrey CH,
Bodine DM,
Nienhuis AW:
The upstream region of the human -globin gene promoter.
J Biol Chem
266:11965,
1991[Abstract/Free Full Text]
31.
Ulrich MJ,
Ley TJ:
Function of normal and mutated -globin gene promoters in electroporated K562 erythroleukemia cells.
Blood
75:990,
1990[Abstract/Free Full Text]
32.
Lin HJ,
Anagnou NP,
Rutherford TR,
Shimada T,
Nienhuis AW:
Activation of the human -globin promoter in K562 cells by DNA sequences 5 to the fetal - or embryonic 
-globin genes.
J Clin Invest
80:374,
1987
33.
Perez-Stable C,
Constantini F:
Roles of fetal G-globin promoter elements and the adult -globin 3 enhancer in the stage-specific expression of globin genes.
Mol Cell Biol
10:1116,
1990[Abstract/Free Full Text]
34.
Antoniou M,
Grosveld F:
-Globin dominant control region interacts differently with distal and proximal promoter elements.
Genes Dev
4:1007,
1990[Abstract/Free Full Text]
35.
Donze D,
Townes TM,
Bieker JJ:
Role of erythroid Kruppel-like factor in human - to -globin gene switching.
J Biol Chem
270:1955,
1995[Abstract/Free Full Text]
36.
Gong Q-H,
Stern J,
Dean A:
Transcriptional role of a conserved GATA-1 site in the human -globin gene promoter.
Mol Cell Biol
11:2558,
1991[Abstract/Free Full Text]
37.
Brasier AR,
Tate JE,
Habener JF:
Optimized use of the firefly luciferase assay as a reporter gene in mammalian cell lines.
Biotechniques
7:1116,
1989[Medline]
[Order article via Infotrieve]
38. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith
JA, Struhl K: Current Protocols in Molecular Biology. New York, NY,
Wiley-Interscience, 1991 p 857 (suppl 15)
39.
Berger J,
Hauber J,
Hauber R,
Geiger R,
Cullen BR:
Secreted placental alkaline phosphatase: A powerful new quantitative indicator of gene expression in eukaryotic cells.
Gene
66:1,
1988[Medline]
[Order article via Infotrieve]
40.
De Wet JR,
Wood KV,
DeLuca M,
Helinski DR,
Subramani S:
Firefly luciferase gene: Structure and expression in mammalian cells.
Mol Cell Biol
7:725,
1987[Abstract/Free Full Text]
41. Miller JH: Experiments in Molecular Genetics. Cold Spring
Harbor, NY, Cold Spring Harbor Laboratory, 1972
42.
Bradford MM:
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal Biochem
72:248,
1976[Medline]
[Order article via Infotrieve]
43.
Moon AM,
Ley TJ:
Functional properties of the -globin locus control region in K562 erythroleukemia cells.
Blood
77:2272,
1991[Abstract/Free Full Text]
44.
Dignam JD,
Lebovitz RM,
Roeder RG:
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res
11:1475,
1983[Abstract/Free Full Text]
45.
Sykes K,
Kaufman RE:
A naturally occuring gamma globin gene mutation enhances SP1 binding activity.
Mol Cell Biol
10:95,
1990[Abstract/Free Full Text]
46.
Studier FW,
Rosenberg AH,
Dunn JJ,
Dubendorff JN:
Use of T7 RNA polymerase to direct expression of cloned genes.
Methods Enzymol
185:60,
1990[Medline]
[Order article via Infotrieve]
47.
Rutherford TR,
Clegg JB,
Weatherall DJ:
K562 human leukaemic cells synthesize embryonic haemoglobin in response to haemin.
Nature
280:164,
1979[Medline]
[Order article via Infotrieve]
48.
Charnay P,
Treisman R,
Mellon P,
Chao M,
Axel R,
Maniatic T:
Differences in human - and -globin gene expression in mouse erythroleukemia cells: The role of intragenic sequences.
Cell
38:251,
1984[Medline]
[Order article via Infotrieve]
49.
Fischer K-D,
Haese A,
Nowock J:
Cooperation of GATA-1 and Sp1 can result in synergistic transcriptional activation or interference.
J Biol Chem
268:23915,
1993[Abstract/Free Full Text]
50.
Tagle DA,
Koop BF,
Goodman M,
Slightom JL,
Hess DL,
Jones RT:
Embryonic and globin genes of a prosimian primate (Galago crassicaudatus).
J Mol Biol
203:439,
1988[Medline]
[Order article via Infotrieve]
51.
Gumucio DL,
Lockwood WK,
Weber JL,
Saulino AM,
Delgrosso K,
Surrey S,
Schwartz E,
Goodman M,
Collins FS:
The -175 TC mutation increases promoter strength in erythroid cells: Correlation with evolutionary conservation of binding sites for two trans-acting factors.
Blood
75:756,
1990[Abstract/Free Full Text]
52.
Lloyd JA,
Lee RF,
Lingrel JB:
Mutations in two regions of the A gamma globin gene canonical promoter affect gene expression.
Nucleic Acids Res
17:4339,
1989[Abstract/Free Full Text]
53.
Nicolis S,
Ronchi A,
Malgaretti N,
Mantovani R,
Giglioni B,
Ottolenghi S:
Increased erythroid-specific expression of a mutated HPFH gamma-globin promoter requires the erythroid factor NFE-1.
Nucleic Acids Res
17:5509,
1989[Abstract/Free Full Text]
54.
Ney PA,
Sorrentino BP,
McDonagh KT,
Nienhuis AW:
Tandem AP-1-binding sites within the human -globin dominant control region function as an inducible enhancer in erythroid cells.
Genes Dev
4:993,
1990[Abstract/Free Full Text]
55.
Moi P,
Kan YW:
Synergistic enhancement of globin gene expression by activator protein-1-like proteins.
Proc Natl Acad Sci USA
87:9000,
1990[Abstract/Free Full Text]
56.
Motamed K,
Bastiani C,
Zhang Q,
Bailey A,
Shen CK:
CACC box and enhancer response of the human embryonic epsilon globin promoter.
Gene
123:235,
1993[Medline]
[Order article via Infotrieve]
57.
Superti-Furga G,
Barberia A,
Schaffner G,
Busslinger M:
The -117 mutation in Greek HPFH affects the binding of three nuclear factors to the CCAAT region of the -globin gene.
EMBO J
7:3099,
1988[Medline]
[Order article via Infotrieve]
58.
Delvoye NL,
Destroismaisons NM,
Wall LA:
Activation of the -globin promoter by the locus control region correlates with binding of a novel factor to the CAAT box in murine erythroleukemia cells but not in K562 cells.
Mol Cell Biol
13:6969,
1993[Abstract/Free Full Text]
59.
Berry M,
Grosveld F,
Dillon N:
A single point mutation is the cause of the Greek form of hereditary persistence of fetal hemoglobin.
Nature
358:499,
1992[Medline]
[Order article via Infotrieve]
60.
Fucharoen S,
Shimizu K,
Fukumaki Y:
A novel C-T transition within the distal CCAAT motif of the G-globin gene in the Japanese HPFH: Implication of factor binding in elevated fetal globin expression.
Nucleic Acids Res
18:5245,
1990[Abstract/Free Full Text]
61.
Katsube T,
Fukumaki Y:
A Role for the Distant CCAAT Box of the -globin gene in Hb switching.
J Biochem
117:68,
1995[Abstract/Free Full Text]
62.
Ronchi AE,
Bottardi S,
Mazzucchelli C,
Ottolenghi S,
Santoro C:
Differential binding of the NFE3 and CP1/NFY transcription factors in the human - and -globin CCAAT boxes.
J Biol Chem
270:21934,
1995[Abstract/Free Full Text]
63.
Bieker JJ,
Southwood CM:
The erythroid Kruppel-like factor transactivation domain is a critical component for cell-specific inducibility of a -globin promoter.
Mol Cell Biol
15:852,
1995[Abstract]
64.
Stamatoyannopoulos G,
Josephson B,
Zhang J-W,
Li Q:
Developmental regulation of human -globin genes in transgenic mice.
Mol Cell Biol
13:7636,
1993[Abstract/Free Full Text]
65.
Matsuda M,
Sakamoto N,
Fukumaki Y:
-thalassemia caused by disruption of the site for an erythroid-specific transcription factor, GATA-1, in the -globin gene promoter.
Blood
80:1347,
1992[Abstract/Free Full Text]
66.
Raich N,
Clegg CH,
Grofti J,
Romeo P-H,
Stamatoyannopoulos G:
GATA1 and YY1 are developmental repressors of the human -globin gene.
EMBO J
14:801,
1995[Medline]
[Order article via Infotrieve]
67.
Castle M,
O'Neill D,
Bank A:
In vitro transcription from the human A-globin gene promoter.
Blood
82:1344,
1993[Abstract/Free Full Text]
68.
Tuan D,
Feingold E,
Newman M,
Weissman SM,
Forget BG:
Different 3 endpoints of deletion causing -thalassemia and hereditary persistence of fetal hemoglobin: Implications for the control of gene expression in man.
Proc Natl Acad Sci USA
80:6937,
1983[Abstract/Free Full Text]
69. Feingold EA, Collins FS, Metherall JE, Stoeckert CJ Jr, Weissman
SM, Forget BG: Analysis of mutations associated with deletion and
non-deletion hereditary persistence of fetal hemoglobin, in
Stamatoyannopoulos G, Nienhuis AW (eds): Experimental Approaches for
the Study of Hemoglobin Switching. New York, NY, Liss, 1985, p 107
70.
Jane SM,
Gumucio DL,
Ney PA,
Cunningham JM,
Nienhuis AW:
Methylation-enhanced binding of Sp1 to the stage selector element of the human -globin gene promoter may regulate developmental specificity of expression.
Mol Cell Biol
13:3272,
1993[Abstract/Free Full Text]
71.
Ronchi A,
Nicolis S,
Santoro C,
Ottolenghi S:
Increased Sp1 binding mediates erythroid-specific overexpression of a mutated (HPFH) -globin promoter.
Nucleuc Acids Res
17:10231,
1989
72. Reddy PMS, Stamatoyannopoulos G, Papayannopoulou T, Shen C-K J:
Genomic footprinting and sequencing of human -globin locus. J Biol
Chem 269:8287, 1994
73.
Bresnick EH,
Felsenfeld G:
Evidence that the transcription factor USF is a component of the human -globin locus control region heteromeric protein complex.
J Biol Chem
268:18824,
1993[Abstract/Free Full Text]
74.
Ellis J,
Talbot D,
Dillon N,
Grosveld F:
Synthetic human globin 5HS2 constructs function as locus control regions only in multicopy transgene concatamers.
EMBO J
12:127,
1993[Medline]
[Order article via Infotrieve]
75.
Caterina JJ,
Ciavatta DJ,
Donze D,
Behringer RR,
Townes TM:
Multiple elements in human -globin locus control region 5HS2 are involved in enhancer activity and position-independent transgene expression.
Nucleic Acids Res
22:1006,
1994[Abstract/Free Full Text]
76.
Talbot D,
Grosveld F:
The 5HS2 of the globin locus control region enhances transcription through the interaction of a multimeric complex binding at two functionally distinct NF-E2 binding sites.
EMBO J
10:1391,
1991[Medline]
[Order article via Infotrieve]
Abstract
Introduction
Abstract
