|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 1 (January 1), 1998:
pp. 319-323
A Point Mutation in the Bulge of the Iron-Responsive Element of the L
Ferritin Gene in Two Families With the Hereditary
Hyperferritinemia-Cataract Syndrome
By
M.E. Martin,
S. Fargion,
P. Brissot,
B. Pellat, and
C. Beaumont
From the Génétique et Pathologie Moléculaires de
l'Hématopoièse, INSERM U409, Faculté Xavier Bichat,
Paris, France; Ospedale Maggiore di Milano, IRCCS, Milano, Italy;
Clinique des Maladies du Foie. C.H.R.U. Pontchaillou et INSERM U49,
Rennes; and Maladies de l'Appareil Digestif, La Varenne Saint Hilaire,
France.
 |
ABSTRACT |
The molecular basis for the recently described hereditary
hyperferritinemia-cataract syndrome is the presence of a mutation in
the iron-responsive element (IRE) of the L ferritin gene, located on
chromosome 19q13.3-13.4. Two mutations have been reported so far,
altering adjacent nucleotides in the IRE loop, in a region that has
been extensively studied in vitro and shown to mediate high affinity
interaction with the iron-responsive protein. In this report, we
describe two families with a new mutation in the bulge of the IRE stem,
and we show that this mutation alters the protein-binding affinity of
the IRE in vitro to the same extent as the loop mutation. In
addition, we present evidence that some variability in the age of onset
of cataract can be associated with this genetic syndrome, probably
because of additional genetic or environmental factors that modulate
the penetrance of the L ferritin defect in the lens. We confirm that
the patients do not have increased iron stores despite the persistence
of elevated serum ferritin levels and that, accordingly, they do not
tolerate well venesection therapy. Further studies will be necessary to
elucidate the mechanism responsible for the onset of cataract.
| |
INTRODUCTION |
THE HEREDITARY hyperferritinemia-cataract
syndrome is a new syndrome recently discovered simultaneously in
France1 and in Italy.2 In each of the three
families described so far, several members presented with an elevated
level of serum ferritin and a bilateral cataract of early onset.
Genetic studies were performed in two of the three
families,3,4 and a mutation was found in the
iron-responsive element (IRE) of the L ferritin gene, located on
chromosome 19q13.3-13.4. Intracellular iron homeostasis is normally
achieved through an iron-mediated posttranscriptional regulation. This
regulation operates through the interaction between a cytoplasmic
iron-regulatory protein (IRP) and a conserved stem-loop motif that is
known as IRE and that is present in the 5 untranslated region of
all ferritin mRNAs5,6 of the erythroid 5-aminolevulinate
synthase (ALA-S) mRNA7 and in the 3 untranslated
region of the transferrin receptor (TfR) mRNA.8 Under
conditions of limited iron supplies, the IRE-binding affinity of the
cytoplasmic IRP is high, leading to repression of ferritin synthesis
and stabilization of the TfR mRNA.9,10 The overall
structure of the various IRE is highly conserved with a six-nucleotide
loop of consensus sequence 5-CAGUGN-3 and a paired stem
with a small asymmetrical bulge. The two mutations identified so far in
the hyperferritinemia-cataract syndrome affect adjacent nucleotides in
the IRE loop, with either an A to G change at the second position of
the loop3 or a G to C change in the third
position.4 The A to G change has been shown to reduce the
protein-binding affinity of the IRE in vitro and to affect L ferritin
synthesis in vivo. Functional studies performed on lymphoblastoid cell
lines established from the patients showed that the presence of a
mutated IRE in the L ferritin mRNA impaired the negative feedback
regulation that normally operates on ferritin synthesis in conditions
of limited iron supplies.3 Identification of a mutated IRE
in the patients with a hereditary hyperferritinemia-cataract syndrome
was the first evidence that a constitutive nonregulated L ferritin
synthesis can be responsible for a pathological condition, but the
mechanism responsible for the onset of cataract is still not
elucidated. Hereditary cataracts are clinically and genetically
heterogeneous, and the genes responsible have only been found in the
hyperferritinemia-cataract syndrome and in the Coppock-like cataract,
which is caused by the activation of the  E-crystallin
pseudogene.11 The genes for other distinct cataracts have
been mapped to chromosome regions 1q21-q25, 2q33-q36, 16q22.1, and
17q24.12-15
The hyperferritinemia-cataract syndrome had remained undetected until
recently, probably because serum ferritin determination is not a
regular test in ophthalmology departments. Therefore, the
proportion of hereditary cataract as well as the heterogeneity of the
mutations that are caused by the mutated L ferritin IRE are still
largely unknown.
Here we describe a new mutation that affects the bulge of the iron
responsive element in two new families, with the first hint that some
phenotypic variability is possible within this syndrome.
| |
MATERIALS AND METHODS |
Case Report
Family 1.
The proband (I1) (Fig 1), a 77-year-old woman, was
hospitalized for a sudden episode of generalized edema accompanied by
reduced serum albumin levels. In her past clinical history a bilateral
cataract was reported. Hemoglobin, leukocyte, and platelet counts were
in the normal range, serum iron was 12.8 µmol/L, transferrin 3.14
g/L, and ferritin 1,600 µg/L. Sedimentation rate was elevated,
whereas the other acute phase reactants were within normal range.
Because a kidney and hepatic origin of the edema was ruled out, as well
as malnutrition and gastrointestinal protein loss, the patient was
subjected to a liver biopsy, which showed a normal liver structure and
a scant amount of iron. A monoclonal IgG gammapathy was present, but
the bone marrow biopsy was normal with no evidence of iron overload.
After health recovery, the patient was discharged from the hospital
with normal blood tests, with the exception of serum ferritin, which
was persistently elevated. In an attempt to reduce the
hyperferritinemia, the patient was started on a program of
phlebotomies, but after only three phlebotomies of 350 mL each, she
developed anemia (hemoglobin [Hb] decreased from 11.7 to 8.4),
transferrin saturation decreased from 20% to 5%, but serum ferritin
did not change. A family study was performed, and two sons and a
grandchild were tested.
View larger version (11K):
[in this window]
[in a new window]
| Fig 1.
Pedigree of two families with the hereditary
hyperferritinemia-cataract syndrome. Within each symbol, the left part
indicates serum ferritin level and the right part the lens status.
Serum ferritin levels are indicated in micrograms per liter. A question
mark denotes an unknown serum ferritin level. Probands are identified
by an arrow.
|
|
The elder son (II1), 52 years old, did not have any
pathological report but did have a bilateral cataract that had been
operated on 10 years before. All his tests were normal (serum iron 21.4
µmol/L and transferrin 2.1 g/L), but his ferritin was 1,200 µg/L.
He was phlebotomized, and after six phlebotomies Hb turned from 15.6 to
13, transferrin saturation decreased, and serum ferritin did not vary.
Later, the patient moved to another city and he was again subjected to
several phlebotomies for the high values of ferritin and consequently
developed a severe anemia without any modification of ferritin values.
He was also subjected to liver biopsy, which showed a completely normal
liver without evidence of iron or inflammatory cells. However, some
granular, yellowish pigment of unknown composition was also observed.
His 16-year-old daughter was examined; blood cell counts and iron
indices were all in the normal range. The younger son
(II2), 45 years old, had increased serum ferritin (2,264
µg/L) and a normal transferrin saturation. He was subjected to 14
phlebotomies, once a week, with a decrease of Hb from 15 to 12.5 g/dL,
a decrease of transferrin saturation, but no modification of ferritin
levels. He had no history of cataract, and a recent control ruled out
the presence of cataract.
Family 2.
The proband (III1) (Fig 1), a 24-year-old woman whose sole
previous medical problem was a bilateral cataract, presented in 1995
with constant hyperferritinemia. This biochemical abnormality was
detected in the frame of a family study initiated from her sister who
had been suspected from having genetic hemochromatosis. She was
otherwise clinically asymptomatic. Serum ferritin levels ranged between
1,250 and 1,400 µg/L (upper normal limit 250). Serum iron was normal
(16 to 19 µmol/L), and transferrin saturation (19% to 28%) slightly
decreased. Blood cell counts, sedimentation rate, serum hepatic enzyme
activities (aspartate transaminase [AST], alanine transaminase
[ALT], -glutamyl transferase [GGT]) were normal. Liver biopsy
showed no abnormalities, and particularly Perl's staining was
negative.
Her family members presented as follows: (1) her mother
(II1) had a bilateral congenital cataract and
hyperferritinemia; (2) her maternal grandfather had a bilateral
cataract; (3) her brother (III2) had a bilateral cataract,
no serum ferritin could be checked; and (4) her sister
(III3), born in 1953, had been explored in 1993 to 1994 for
chronic hyperferritinemia discovered after a malaise in 1992. Serum
ferritin levels were comprised between 1,025 and 1,330 µg/L, with
erythrocyte ferritin at 182 attograms (ag)/cell
(normal range = 4 to 28 ag/cell). Serum iron was 22.8
µmol/L, and transferrin saturation was 35%. Hb was 14.2 g/dL, and
MCV 93.8 fL. The liver biopsy showed no iron deposition. A
few venesections were performed, but they were poorly tolerated with
rapid appearance of microcytic anemia (Hb, 10.5 g/dL; MCV, 84 fL). The
patient had been operated on for a left cataract and presented a mild
right cataract.
Genomic DNA Analysis
Genomic DNA was extracted from blood samples collected on citrate-EDTA
and subjected to polymerase chain reaction (PCR) amplification. A first
round of amplification was performed using Lprom and Lex2 (see below)
as 5 and 3 primers, and 30 cycles with
95°C for 30 seconds, 58°C for 30 seconds, and
72°C for 1 minute. The resulting 610-bp fragment was then purified
on agarose gel and further amplified using seminested primers (Lex1 and
Lex2), mapping to exon 1 and 2. The resulting 570-bp fragment was
purified and sequenced.
Primers used for PCR amplification were (see Fig
2A): Lprom: 5
CGGCGCACCATAAAAGAAGCC (upper primer); Lex2: 5
GCTGGTTTTGCATCTTCAG (lower primer); and Lex1: 5
AGTTCGGCGGTCCCGCGGGTC (upper primer).
View larger version (23K):
[in this window]
[in a new window]
| Fig 2.
Identification of the mutation in the IRE of the L
ferritin gene. (A) Schematic representation of the functional L
ferritin gene on chromosome 19q13.3-q13.4 and position of the primers
used for the PCR amplification. (B) Sequence analysis of genomic DNA
from a normal individual (left) and from patient III1 in
Family 2 (right). Comparison of the sequence of the reverse strand
reveals a C to A mutation at the heterozygous state in the patient DNA.
(C) Predicted secondary structure of the IRE in the L ferritin mRNA and
position of the mutation in the 5 UGC bulge. Numbering is from
the first nucleotide in exon 1.
|
|
Gel Retardation Assay
Labeled RNAs were transcribed in vitro from oligonucleotide template
using T7 RNA polymerase, as previously described.3 The
oligonucleotide used to synthesize the normal L ferritin IRE probe was:
5
TGTTCCGTCCAAACACTGTTGAAGCAAGAGACA-TCGCCCTATAGTGAGTCGTATTAGCC.
The sequence of the oligonucleotide used to synthesize the mutated IRE
probes differed by substituting a C to a T at position 17 (mut1) and an
A to a C at position 25 (mut2) from the 5 end of the
oligonucleotide. The underlined sequence represents the T7 RNA
polymerase promoter and was double-stranded in the transcription
reaction with an oligonucleotide complementary to this region. The RNA
used as a probe was labeled with 32P-UTP to a specific
activity of approximately 106 cpm/ng. The RNA used as a
competitor was trace-labeled with 35S-UTP to a specific
activity of 500 to 200 cpm/ng. Cytoplasmic extracts were prepared from
the human K562 erythroleukemia cell line.
Gel retardation assays were performed by incubating 5 µg of K562
cytoplasmic extracts treated with  -mercaptoethanol, with 50,000 cpm
of 32P-labeled IRE at room temperature for 30 minutes. Low
affinity interactions were removed by a further incubation with 5 mg of
heparin per mL for 10 minutes. Electrophoresis of RNA-protein complexes
was performed on 6% nondenaturing polyacrylamide gel in 0.5 ×
TBE (acrylamide/Bis ratio 60:1) for 2 hours.
| |
RESULTS |
We performed PCR amplification of genomic DNA from affected members of
both families. Two rounds of PCR with a different primer pair were
necessary to avoid the amplification of the ferritin L subunit
intronless pseudogenes.16 A first round was performed using
a sense primer mapping to the proximal promoter region of the L
ferritin gene and an antisense primer mapping to exon 2. The resulting
610-bp fragment was gel-purified, and a nested PCR was performed using
a combination of oligonucleotides mapping to the beginning of exon 1
and to exon 2. Sequencing of the PCR fragment revealed that affected
members were heterozygous for a point mutation, consisting in a G to T
transition in the bulge of the IRE (Fig 2B and C).
To confirm that the mutation was responsible for a reduced binding
affinity of the IRE to the IRP, we performed gel retardation assay.
Normal and mutated sense RNA probes were generated by in vitro
transcription in the presence of 32P-UTP. In the presence
of K562 cytoplasmic extracts, the normal probe generated a
high-affinity protein RNA complex (Fig 3,lane 2). Mutated probes corresponding to the previously described loop
mutation (mut1, lane 4) or to the new bulge mutation (mut2, lane 6) did
not generate any specific complex. In addition, the IRE/IRP complex
generated by the normal IRE probe was partially displaced by a 50-fold
molar excess of the cold probe (lane 8) and almost entirely by a
100-fold excess (lane 9), whereas similar excess of the cold probe
bearing the loop mutation (mut1, lanes 10 to 12) or the bulge mutation
(mut2, lanes 13 to 15) did not compete for binding to the normal IRE
probe.
View larger version (88K):
[in this window]
[in a new window]
| Fig 3.
Gel retardation assay with normal and mutated L ferritin
IRE probes. 32P-labeled L ferritin IRE probe (5 ×
104 cpm) of either normal sequence (lanes 1, 2, and 7 to
15) or carrying the loop mutation (mut1, lanes 3 and 4) or the bulge
mutation (mut2, lane 5 and 6) was incubated with 5 µg K562
cytoplasmic extracts. The products were analyzed by electrophoresis on
nondenaturing polyacrylamide gels either as free probe (lanes 1, 3, and
5) or after incubation with the extract only (lanes 2, 4, and 6). For
the competition studies, the normal radiolabeled IRE probe was
incubated with the extracts in the presence of a 10-, 50- or 100-fold
molar excess of a cold normal IRE probe (lanes 7 to 9) or of a cold
mutated IRE probe with a loop mutation (mut1, lanes 10 to 12) or a
bulge mutation (mut2, lanes 13 to 15).
|
|
The results confirm that the G to T mutation in the bulge of the L
ferritin IRE fully impairs the protein-binding affinity of the IRE and
is likely to be responsible for the increased serum ferritin levels in
patients of the two families and probably for the associated cataract.
| |
DISCUSSION |
In this report, we describe a new mutation in the IRE of the L ferritin
mRNA in two families with a hereditary hyperferritinemia-cataract
syndrome, one from Italy and one from France. The first two mutations
previously reported affected adjacent nucleotides from the IRE loop,
whereas the two families described here have the same G to T change in
the three unpaired nucleotide bulge of the IRE. This finding suggests
that this syndrome is likely to be more frequent than was expected at
first and reinforces the idea that the presence of a mutated IRE in the
L ferritin gene, located on chromosome 19q13.3-13.4, is responsible for
the association of cataract and hyperferritinemia. In addition, the
position of the mutation is the first in vivo evidence for the key role
of the bulge in the binding affinity of the IRE, although it has been
shown that the tertiary structure of the stem-bulge region of the IRE
is a critical determinant of translational regulation by
iron.17 The structure of the stem varies between the
different IREs,6 with a three-base UGC bulge in both H and
L ferritin IRE, whereas the stem of the five IREs in the transferrin
receptor mRNA and of the single IRE in the erythroid ALA-S mRNA have a
single cytosine bulge. An extensive in vitro study performed by
Henderson et al has shown the importance for the IRE function of this
highly conserved cytosine present in the bulge of all known
IREs.18 Our results present evidence that the G from the
UGC bulge is important for the IRE function in vivo and for the
high-affinity RNA protein interaction in vitro. This mutation abrogates
the base pairing between G32 and C50 (Fig 2C), which might be necessary
for the proper conformation of the IRE, as shown by studies based on
nuclear magnetic resonance (NMR)
spectroscopy19 or on identification of ligands with the
highest affinity for the IRP.20 Alternately, the mutation
might impair a specific point of protein-RNA interaction, because
studies using UV radiation-induced cross-links have shown that
nucleotides 31 to 43, including the UGC bulge and most of the loop,
interact with the IRP and are likely to be buried within the active
site of the native, iron-free protein.21
In the two families reported here, seven individuals had a known
history of cataract, and whenever serum ferritin levels were assayed,
they were found to be elevated (six patients), ranging from 1,200 to
2,200 µg/L. These values are very similar to those reported in the
family with an A to G mutation in the loop,3 suggesting
that mutations in both the loop and the bulge affect the in vivo
function of the IRE to the same extent. This is in agreement with our
in vitro studies, which show that both mutated IREs have lost
IRP-binding activity and have no ability to compete for IRP binding to
the wild-type sequence. However, we observed a marked phenotypic
variability in the age of onset of cataract between the two families
reported here, despite the presence of the same mutation. In fact,
whereas in Family 2 affected members developed cataract during the late
childhood, the patients from Family 1 showed signs of cataract around
the age of 40; surprisingly, patient II2, age 45 years,
still does not show any evidence of lens opacification, although he
carries the mutation and his level of serum ferritin is even higher
than the other members of the family (2,260 v 1,200 to 1,600).
The mechanism leading to the onset of cataract is still unknown, but it
is possible to speculate that abnormal deposits of ferritin molecules
in the successive layers of lens epithelial cells lead progressively to
lens opacification. In the case of patient II2, it is
possible that additional factors, either genetic or environmental,
modulate the penetrance of the L ferritin defect in the lens. Further
follow-up will show whether he develops cataract or not.
Altogether, five families with the hyperferritinemia-cataract have now
been described, and it becomes clear that the elevated serum ferritin
levels do not reflect the presence of increased iron stores. Whenever a
liver biopsy or a bone marrow biopsy (this report, Family 1, patient
I1) was performed, there was no increased staining for
iron. Accordingly, these patients did not tolerate well venesection
therapy. It is also important to emphasize that recently a new syndrome
has been described where patients who most often present metabolic
disorders, such as increased body mass index, hyperlipidemia, glucose
intolerance, and hypertension, have hyperferritinemia and normal
transferrin saturation.22 However, contrary to the
hereditary hyperferritinemia-cataract syndrome, these patients have
iron overload and need phlebotomies. It becomes mandatory to be aware
of the existence of these two syndromes because it appears from the few
cases described so far that patients with the
hyperferritinemia-cataract syndrome may rapidly developed severe anemia
when they are phlebotomized, even if serum ferritin does not decrease.
On the contrary, the phlebotomies will lead to a progressive reduction
in the serum ferritin level in patients with iron overload. Therefore,
a strict follow-up of these patients should be performed, including
regular hemoglobin determination together with serum ferritin assay.
| |
FOOTNOTES |
Submitted January 29, 1997;
accepted September 4, 1997.
Address reprint requests to C. Beaumont, PhD, INSERM U409,
Faculté Xavier Bichat, 16 rue Henri Huchard, BP 416, 75870 Paris
cedex 18, France.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section 1734 solely
to indicate this fact.
| |
ACKNOWLEDGMENT |
We are grateful to Dr Devidas (Service de Médecine
Interne, Centre Hospitalier de Corbeil, Corbeil-Essones, France) for
kindly providing clinical information on his patients.
| |
REFERENCES |
1.
Bonneau D,
Winter-Fuseau I,
Loiseau MN,
Amati P,
Berthier M,
Oriot D,
Beaumont C:
Bilateral cataract and high serum ferritin: A new dominant genetic disorder?
J Med Genet
32:778,
1995[Abstract/Free Full Text]
2.
Girelli D,
Olivieri O,
De Franceschi L,
Corrocher R,
Bergamaschi G,
Cazzola M:
A linkage between hereditary hyperferritinemia not related to iron overload and autosomal dominant congenital cataract.
Br J Haematol
90:931,
1995[Medline]
[Order article via Infotrieve]
3.
Beaumont C,
Leneuve P,
Devaux I,
Scoazec JY,
Berthier M,
Loiseau MN,
Grandchamp B,
Bonneau D:
Mutation in the iron responsive element of the L ferritin mRNA in a family with dominant hyperferritinemia and cataract.
Nat Genet
11:444,
1995[Medline]
[Order article via Infotrieve]
4.
Girelli D,
Corrocher R,
Bisceglia L,
Olivieri O,
De Franceschi L,
Zelante L,
Gasparini P:
Molecular basis for the recently described hereditary hyperferritinemia-cataract syndrome: A mutation in the iron-responsive element of ferritin L-subunit gene (the "Verona mutation").
Blood
86:4050,
1995[Abstract/Free Full Text]
5.
Hentze MW,
Caughman SW,
Rouault TA,
Barriocanal JG,
Dancis A,
Harford JB,
Klausner RD:
Identification of the iron-responsive element for the translational regulation of human ferritin mRNA.
Science
238:1570,
1987[Abstract/Free Full Text]
6.
Theil C:
Iron regulatory elements (IREs): A family of mRNA non-coding sequences.
Biochem J
304:1,
1994
7.
Melefors O,
Goossen B,
Johansson HE,
Stripecke R,
Gray NK,
Hentze MW:
Translational control of 5-aminolevulinate synthase mRNA by iron-responsive elements in erythroid cells.
J Biol Chem
268:5974,
1993[Abstract/Free Full Text]
8.
Casey JL,
Koeller DM,
Ramin VC,
Klausner RD,
Harford JB:
Iron regulation of transferrin receptor mRNA levels requires iron-responsive elements and a rapid turnover determinant in the 3' untranslated region of the mRNA.
EMBO J
8:3693,
1989[Medline]
[Order article via Infotrieve]
9.
Hentze MW,
Kuhn LC:
Molecular control of vertebrate iron metabolism: mRNA-based regulatory circuits operated by iron, nitric oxide, and oxidative stress.
Proc Natl Acad Sci USA
93:8175,
1996[Abstract/Free Full Text]
10.
Klausner RD,
Rouault TA,
Harford JB:
Regulating the fate of mRNA: The control of cellular iron metabolism.
Cell
72:19,
1993[Medline]
[Order article via Infotrieve]
11.
Brakenhoff RH,
Henskens HAM,
van Rossum MW,
Lubsen NH,
Schoenmakers JGG:
Activation of the E-cristallin pseudogene in the human hereditary Coppock-like cataract.
Hum Mol Genet
3:279,
1994[Abstract/Free Full Text]
12.
Renwick JH,
Lawler SD:
Probable linkage between a congenital cataract locus and the Duffy blood group locus.
Ann Hum Genet
27:67,
1963[Medline]
[Order article via Infotrieve]
13.
Lubsen NH,
Renwick JH,
Tsui LC,
Breitman ML,
Schoenmarkers JGG:
A locus for a human hereditary cataract is closely linked to the -crystallin gene family.
Proc Natl Acad Sci USA
84:489,
1987[Abstract/Free Full Text]
14.
Maumenee IH:
Classification of hereditary cataracts in children by linkage analysis.
Ophtalmology
86:1554,
1979[Medline]
[Order article via Infotrieve]
15.
Armitage MM,
Kivlin JD,
Ferrell RE:
A progressive early onset cataract gene maps to human chromosome 17q24.
Nat Genet
9:37,
1995[Medline]
[Order article via Infotrieve]
16.
Jain SK,
Barrett KJ,
Boyd D,
Favreau MF,
Crampton J,
Drysdale JW:
Ferritin H and L chains are derived from different multigene families.
J Biol Chem
260:11762,
1985[Abstract/Free Full Text]
17.
Kikinis Z,
Eisenstein RS,
Bettany AJE,
Munro HN:
Role of RNA secondary structure of the iron-responsive element in translational regulation of ferritin synthesis.
Nucleic Acids Res
23:4190,
1995[Abstract/Free Full Text]
18.
Henderson BR,
Kuhn LC:
Differential modulation of the RNA-binding proteins IRP-1 and IRP-2 in response to iron. IRP-2 inactivation requires translation of another protein.
J Biol Chem
270:20509,
1995[Abstract/Free Full Text]
19.
Sierzputowska-Gracz H,
McKenzie RA,
Theil EC:
The importance of a single G in the hairpin loop of the iron responsive element (IRE) in ferritin mRNA for structure: An NMR spectroscopy study.
Nucleic Acids Res
23:146,
1995[Abstract/Free Full Text]
20.
Butt J,
Kim HY,
Basilion JP,
Cohen S,
Iwai K,
Philpott CC,
Altschul S,
Klausner RD,
Rouault TA:
Differences in the RNA binding sites of iron regulatory proteins and potential target diversity.
Proc Natl Acad Sci USA
93:4345,
1996[Abstract/Free Full Text]
21.
Basilion JP,
Rouault TA,
Massinople CM,
Klausner RD,
Burgess WH:
The iron-responsive element-binding protein: Localization of the RNA-binding site to the aconitase active-site cleft.
Proc Natl Acad Sci USA
91:574,
1994[Abstract/Free Full Text]
22.
Moirand R,
Mortaji A,
Loréal O,
Paillard F,
Brissot P,
Deugnier Y:
Liver iron overload with normal transferrin saturation: A new syndrome.
Lancet
349:95,
1997[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
S. Cunat, M. Giansily-Blaizot, M. Bismuth, F. Blanc, O. Dereure, D. Larrey, A. L. Quellec, P. Pouderoux, C. Rose, I. Raingeard, et al.
Global Sequencing Approach for Characterizing the Molecular Background of Hereditary Iron Disorders
Clin. Chem.,
December 1, 2007;
53(12):
2060 - 2069.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. B. Bateman, L. Richter, P. Flodman, D. Burch, S. Brown, P. Penrose, O. Paul, D. D. Geyer, D. G. Brooks, and M. A. Spence
A new locus for autosomal dominant cataract on chromosome 19: linkage analyses and screening of candidate genes.
Invest. Ophthalmol. Vis. Sci.,
August 1, 2006;
47(8):
3441 - 3449.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K J H Robson, A T Merryweather-Clarke, E Cadet, V Viprakasit, M G Zaahl, J J Pointon, D J Weatherall, and J Rochette
Recent advances in understanding haemochromatosis: a transition state
J. Med. Genet.,
October 1, 2004;
41(10):
721 - 730.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Ghosh, S. Hevi, and S. L. Chuck
Regulated secretion of glycosylated human ferritin from hepatocytes
Blood,
March 15, 2004;
103(6):
2369 - 2376.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. E. Craig, J. B. Clark, J. L. McLeod, M. A. Kirkland, G. Grant, J. E. Elder, M. G. Toohey, L. Kowal, H. F. Savoia, C. Chen, et al.
Hereditary Hyperferritinemia-Cataract Syndrome: Prevalence, Lens Morphology, Spectrum of Mutations, and Clinical Presentations
Arch Ophthalmol,
December 1, 2003;
121(12):
1753 - 1761.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Hetet, I. Devaux, N. Soufir, B. Grandchamp, and C. Beaumont
Molecular analyses of patients with hyperferritinemia and normal serum iron values reveal both L ferritin IRE and 3 new ferroportin (slc11A3) mutations
Blood,
September 1, 2003;
102(5):
1904 - 1910.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. M. Torti and S. V. Torti
Regulation of ferritin genes and protein
Blood,
May 15, 2002;
99(10):
3505 - 3516.
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. G. Brooks, K. Manova-Todorova, J. Farmer, L. Lobmayr, R. B. Wilson, R. C. Eagle Jr, T. G. St. Pierre, and D. Stambolian
Ferritin Crystal Cataracts in Hereditary Hyperferritinemia Cataract Syndrome
Invest. Ophthalmol. Vis. Sci.,
April 1, 2002;
43(4):
1121 - 1126.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Ferreira, P. Santambrogio, M.-E. Martin, V. Andrieu, G. Feldmann, D. Henin, and C. Beaumont
H ferritin knockout mice: a model of hyperferritinemia in the absence of iron overload
Blood,
August 1, 2001;
98(3):
525 - 532.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Goralska, B. L. Holley, and M. C. McGahan
Overexpression of H- and L-Ferritin Subunits in Lens Epithelial Cells: Fe Metabolism and Cellular Response to UVB Irradiation
Invest. Ophthalmol. Vis. Sci.,
July 1, 2001;
42(8):
1721 - 1727.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Cremonesi, A. Fumagalli, N. Soriani, M. Ferrari, S. Levi, S. Belloli, G. Ruggeri, and P. Arosio
Double-Gradient Denaturing Gradient Gel Electrophoresis Assay for Identification of L-Ferritin Iron-responsive Element Mutations Responsible for Hereditary Hyperferritinemia-Cataract Syndrome: Identification of the New Mutation C14G
Clin. Chem.,
March 1, 2001;
47(3):
491 - 497.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Cazzola and R. C. Skoda
Translational pathophysiology: a novel molecular mechanism of human disease
Blood,
June 1, 2000;
95(11):
3280 - 3288.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. R. Allerson, M. Cazzola, and T. A. Rouault
Clinical Severity and Thermodynamic Effects of Iron-responsive Element Mutations in Hereditary Hyperferritinemia-Cataract Syndrome
J. Biol. Chem.,
September 10, 1999;
274(37):
26439 - 26447.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Balas, M. J. Aviles, F. Garcia-Sanchez, J. L. Vicario, and A. Cervera
Description of a New Mutation in the L-Ferritin Iron-Responsive Element Associated With Hereditary Hyperferritinemia-Cataract Syndrome in a Spanish Family
Blood,
June 1, 1999;
93(11):
4020 - 4021.
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. C. Barton, E. Beutler, and T. Gelbart
Coinheritance of Alleles Associated With Hemochromatosis and Hereditary Hyperferritinemia-Cataract Syndrome
Blood,
December 1, 1998;
92(11):
4480 - 4481.
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Levi, D. Girelli, F. Perrone, M. Pasti, C. Beaumont, R. Corrocher, A. Albertini, and P. Arosio
Analysis of Ferritins in Lymphoblastoid Cell Lines and in the Lens of Subjects With Hereditary Hyperferritinemia-Cataract Syndrome
Blood,
June 1, 1998;
91(11):
4180 - 4187.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract