|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 1 (January 1), 1998:
pp. 340-346
The Umbilical Cord Blood  T-Cell Repertoire:
Characteristics of a Polyclonal and Naive but Completely Formed
Repertoire
By
Laurent Garderet,
Nicolas Dulphy,
Corinne Douay,
Nathalie Chalumeau,
Véronique Schaeffer,
Marie-Thérèse Zilber,
Annick Lim,
Jos Even,
Nuala Mooney,
Catherine Gelin,
Eliane Gluckman,
Dominique Charron, and
Antoine Toubert
From the Laboratoire d'Immunogénétique Humaine, INSERM
U.396, Institut Biomédical des Cordeliers et Centre G. Hayem,
Hôpital Saint-Louis; and the Unité de Biologie
Moléculaire du Gène, INSERM U.277, Institut Pasteur and the
Service d'Hématologie-Greffe de Moelle Osseuse, Hôpital
Saint-Louis, Paris, France.
 |
ABSTRACT |
Umbilical cord blood (CB) constitutes a promising alternative to
bone marrow for allogeneic transplantation and is increasingly used
because of the reduced severity of graft-versus-host disease after CB
transplantation. We have compared the T-cell receptor chain (TCRB)
diversity of CB lymphocytes with that of adult lymphocytes by analyzing
the complementarity determining region 3 (CDR3) size heterogeneity. In
marked contrast to adult samples, we observed bell-shaped profiles in
all of the 22 functional -chain variable (BV) subfamilies
that reflect the lack of prior antigenic stimulation in CB
samples. However, the mean CDR3 size and BV usage were comparable
between CB and adult samples. BJ2 (65%) segments were used
preferentially to BJ1 (35%), especially BJ2S7, BJ2S5, BJ2S3, and
BJ2S1, in both CB and in adult lymphocytes. We therefore conclude that
although naive as reflected by the heterogeneity of the CDR3 size, the
TCRBV repertoire appears fully constituted at birth. The ability to
expand TCRB subfamilies was confirmed by stimulation with
staphylococcal superantigens toxic shock syndrome toxin-1 and
staphylococcal enterotoxin A. This study provides the basis for future
analysis of the T-cell repertoire reconstitution following umbilical CB
transplantation.
 |
INTRODUCTION |
UMBILICAL CORD blood (CB) has been used
successfully since 1988 as a source of hematopoietic stem cells for
transplantation involving sibling donors1 and, more
recently, unrelated recipients.2,3 CB transplantation has
been associated with a reduced risk of developing severe
graft-versus-host disease (GVHD), even when cells from partially major
histocompatibility complex (MHC)-mismatched donors are
used.3 The maximum degree of HLA disparity that will still
allow engraftment has yet to be determined, but in contrast with
HLA-mismatched bone marrow transplantation, even unrelated 1 or 2
antigen mismatched CB transplants result in an acceptable grade of
acute GVHD.4
The lower risk of GVHD associated with the use of CB transplants is
thought to be caused by the functional immaturity of lymphocytes at
birth. Phenotypically, a lower expression of the CD45RO marker of
memory T cells has been shown in newborns.5 The expression
of class II molecules on antigen presenting cells is decreased in CB B
cells, and these molecules are predominantly empty.6
Alloantigens or superantigens can induce strong initial proliferative
responses of CB as well as of adult T cells, but a state of
unresponsiveness is induced on restimulation in CB.7,8 Many
abnormalities of lymphokine production have been described on
activation, such as a decreased production of interferon- or tumor
necrosis factor- after phytohemagglutinin, anti-CD3, or allogeneic
stimulation.9 On the whole, these data indicate a
relatively unstimulated state of CB lymphocytes at least under in vitro
conditions.
At birth, most of the T cells express an  T-cell receptor (TCR)
heterodimer.  T cells are rare and express a diverse array of
TCR.10 The TCR -chain is produced by the combination of
V, D, J, and C gene segments.11,12 In addition, this
combinatorial diversity is increased by the nibbling of germline
nucleotides and addition of N- and P-residues at the V-D-J junction
sites. The complementarity determining region 3 (CDR3) encompassing the
V-D-J junction displays the most extensive diversity and is thought to
contact the antigenic peptide.13 Most T-cell repertoire
studies used -chain variable (BV)-specific monoclonal
antibodies (MoAbs) or polymerase chain reaction (PCR) methods to
evaluate the expression level of the various BV
segments.14,15 A method called "Immunoscope" has been
developed to determine the size of CDR3 regions in transcripts of whole
BV families or in given BV-BJ combinations with the help of an
automated DNA sequencer.16,17 This approach is particularly
valuable in defining the diversity of  CB T cells for several
reasons. First, it can give a global picture of the repertoire in all
presently known functional BV subfamilies without being limited by the
availability of specific MoAbs. Second, it allows a comparison of
several parameters of the  T-cell repertoire between adults and
newborns (clonality of the BV families, size of the CDR3 regions, and
semiquantitative analysis of the BV and BJ usage). Herein we have
defined the overall picture of the  T-cell repertoire in CB
lymphocytes and its modification on stimulation with bacterial
superantigens toxic shock syndrome toxin-1 (TSST-1) and the
staphylococcal enterotoxin A (SEA) in comparison with adult donors.
 |
MATERIALS AND METHODS |
CB samples.
Umbilical CB samples were obtained at delivery from full-term healthy
pregnancies after the mother's consent (Dr Brossard, Hôpital
Saint-Vincent-de-Paul, Paris, France). Nine peripheral blood leucocyte
(PBL) samples from healthy adult individuals were studied as controls.
RNA extraction and cDNA synthesis.
Cells were obtained by gradient density centrifugation
(Ficoll/Hypaque). Pellets were frozen in liquid nitrogen before RNA
extraction by lysis in guanidium thiocyanate buffer.18 The
first cDNA strand was prepared starting from 5 to 10 µg total RNA and
avian myeloblastosis virus (AMV) reverse transcriptase as recommended
by the manufacturer (cDNA cycle kit; Invitrogen, The
Netherlands).
Oligonucleotides and PCR amplification.
The primers used have been described in Puisieux et al19
with modifications for BV6 (5 -CTCTGAAGATCCAGCGCACAGAGC-3 ) and BV21
(5 -TCCAGCCTGCAAAGCTTGAGGACT-3 ). Fluorescent primers for BC and BJ
were labeled at the 5 end with the Fam fluorophore (Applied
Biosystems, Foster City, CA). Aliquots of the cDNA synthesis reaction
(corresponding to 250 ng of total RNA) were amplified in 50 µL
reactions with one of the BV-specific oligonucleotides as the 5 primer
and the BC oligonucleotide as the 3 primer. The final concentration
was 0.5 mmol/L for each primer, dNTP 0.2 mmol/L, MgCl2 2
mmol/L in Taq polymerase buffer (Promega, Madison, WI) in the presence
of 1 unit of Taq polymerase (Promega) on a DNA thermal cycler (Perkin
Elmer 9600, Norwalk, CT). The PCR cycle profile was denaturation at
94°C for 30 seconds, annealing at 60°C for 45 seconds, primer
extension at 72°C for 45 seconds for 40 cycles, and a final
polymerization step of 10 minutes at 72°C. Aliquots from each BV-BC
PCR product (2 µL) were copied in 4- to 6-cycle run-off reactions
primed with a fluorophore-labeled BC- or BJ-specific oligonucleotide as
described.19 The run-off reactions were loaded on 4.25%
acrylamide sequencing gels (377A DNA sequencer, Applied Biosystems) for
size and fluorescence intensity determination. Fluorescent size markers
were 80, 145, 210, 270, and 350 bp long or the Genescan-500 size marker
(Perkin Elmer). The raw data were analyzed with the help of
the Immunoscope software.16 The CDR3 region
was defined to include residues 95-106.17 Since the
position of the BV and the BC primers are fixed, the length
distribution observed in the PCR fluorescent BV-BC products only
depends on the size of the V-D-J junctions. Statistical analysis was
performed to determine whether or not a profile could be considered as
gaussian; a profile was not considered to be gaussian if one peak was
excluded from the 95% confidence interval of peak level intensities.
TCRB subfamilies BV10 and BV19 were omitted from this analysis because
they are pseudogenes in most individuals.20
V and J gene usage.
A competitive PCR was used to quantify the TCR transcripts in each
sample. A deleted (4 bp) -chain plasmid of the CD3 complex and CD3
primers (CD3-3 TGTCTGAGAGCAGTGTTCCCAC and CD3-5
CCAGGCTGATAGTTCGGTGACC) was used.17 The cDNA sample and the
deleted -chain plasmid were amplified together for 25 cycles in the
same conditions as described above. About 3 × 106 copies
of cDNA from each sample were then amplified for 30 cycles with the BV
primers and an internal fluorescent BC primer. The percentage of
representation of each BV family was calculated and presented as
histograms. BJ usage was defined after run-off reactions of the
unlabeled BV-BC amplification product and is quantitative because the
fluorescent primers have comparable amplification
efficiencies.17 The fluorescence intensity in each BJ
family was expressed as the relative percentage of total signals from
the 13 BJ subfamilies and represented as histograms. Statistical
comparisons between samples from adults and newborns were done by the
Mann-Whitney test.
Cell culture of CB and adult PBL with superantigens.
Umbilical CB cells and adult mononuclear cells were cultured at 2 ×
106 cells/mL for 4 days in RPMI 1640 medium (Seromed,
Biochrom, KG, Berlin) supplemented with 2 mmol/L glutamine, 10 U/mL
penicillin, 10 mg/mL streptomycin (GIBCO, Paisley, UK), and 10%
heat-inactivated fetal calf serum (FCS; Seromed). Cultures were
stimulated with the lowest concentration of superantigen giving an
optimal response: SEA and TSST-1 (Toxin Technology, Madison, WI) at 1
ng/mL. Culture flasks (25 cm2) were incubated at 37°C in
5% CO2. Simultaneously, proliferation assays using
3H thymidine uptake were performed to check for
proliferation after 4 days of culture. Quantification of the TCR
complex-specific RNA and BV usage analysis were performed as described
above.
Flow cytometry analysis.
Phenotypic analysis was performed by flow cytometry using a FACScan
flow cytometer (Becton Dickinson, Mountain View, CA). MoAbs used were
CD3-phycoerythrin conjugated (PE), CD4-PE, CD8-PE, and CD25-PE (Caltag
Laboratories, San Francisco, CA). 158-4D3 and UCHL1 MoAbs, specific
respectively for CD45RA and CD45RO molecules, were provided during the
Vth International Workshop on Human Differentiation
Antigens.21 After being washed, cells stained with
unlabeled MoAbs were incubated with a 1:100 dilution of fluorescein
isothiocyanate-conjugated goat anti-mouse F(ab)2 fragment
(Immunotech, Marseilles, France). Results are expressed as percentages
of cells staining above background.
 |
RESULTS |
Clonality of umbilical CB lymphocytes and CDR3 size analysis.
In adults, six to eight peaks spaced by three nucleotides corresponding
to in-frame transcripts of the TCR -chain CDR3 region are usually
found for each BV-BC combination (Fig 1).The area under each peak is proportional to the amount of transcripts
of the corresponding CDR3 size in the sample.22 Each peak
corresponding to a given CDR3 length usually contains multiple distinct
sequences. An increase in the height and area of a peak that modifies
the bell-shaped CDR3 size distribution indicates oligoclonal or
monoclonal expansions occurring on immunological stimulations.
Statistical analysis allowed to define a profile as gaussian or not.
Sequence analysis has previously been used to confirm the clonality of
such expansions in healthy adults.23 In the samples from
our healthy adult control group, oligoclonal expansions were detected
in at least 5 BV families, BV3, BV7, BV9, BV15, and BV23 in Fig 1A.
This was markedly different from the aspect observed in nine different
umbilical CB samples showing a reproducible gaussian profile in each BV
family (Fig 1B). This profile displayed a size distribution of 8 to 10
identifiable peaks spaced by 3 nucleotides corresponding to in-frame
transcripts as previously described in adults.17 CDR3
lengths varied between 5 and 14 amino acids, with a mean length of 9 or
10 amino acids. Two BV families, BV20 and BV4, had a shorter mean CDR3
length of 8 amino-acids (aa) (Fig 1). The bell-shaped profile of the
BV-BC amplifications was modified in only 5 out of 220 cases;
therefore, we examined these cases for a possible oligoclonal
expansion. An in-depth analysis of these BV families with BJ run-off
revealed a polyclonal profile in each of the 13 BJ families. Because
the majority of expansions occurring in young healthy adults have been
described in the CD8+ lymphocyte
subpopulation,24 we selected CD4+ and
CD8+ lymphocytes in three different CB samples. Similar
gaussian profiles and CDR3 lengths were found in both subpopulations
(data not shown). We concluded from these data that the umbilical CB
T-cell repertoire is definitely polyclonal.

View larger version (36K):
[in this window]
[in a new window]
| Fig 1.
TCR -chain transcript CDR3 size distribution patterns
from a representative adult (A) and CB (B) sample. cDNA was amplified
in PCR reactions primed by one BV subfamily and the BC specific primer.
The amplification products were copied in run-off reaction primed by a
nested fluorescent BC specific primer, and the labeled DNA copies were
analyzed on a sequencing gel in an automated DNA sequencer.
|
|
V and J usage in umbilical CB cells.
A semiquantitative analysis of the BV usage is possible after a prior
quantification of the -chain of the CD3/TCR complex. Nine different
umbilical CB samples have been analyzed, and the usage of the various
BV families compared with adults is shown in Fig
2A. Three groups could be distinguished
arbitrarily: highly expressed BV families with more than 6% each of
the total expression (BV2; BV3; BV4; BV6; BV22); poorly expressed
families with less than 3% (BV7; BV11; BV12; BV14; BV15; BV16; BV17;
BV18; BV20; BV23; BV24); and BV families with an intermediate
expression level between 3% and 6% (BV1; BV5; BV8; BV9; BV13; BV21).
In parallel, nine samples from healthy adult donors were studied under
identical experimental conditions (Fig 2B). The pattern of BV
expression was not markedly different between newborns and adults.
There was not a significant difference between the highly expressed
families of CB versus adult, taking P < .01 as a cut-off. We
then focused our study on the usage of the 13 BJ segments in family
BV13 (10 different CB samples), family BV6 (n = 7), and family BV12
(n = 4) previously studied in adults.25,26 The BJ profile
is shown for these 3 BV families in Fig 3. The BJ2 family was
always expressed more than BJ1 (65%
v 35%), and three representative groups could also be
distinguished (Fig 3): well-expressed families accounted for more than
8% each of the total BJ representation (BJ2S7; BJ2S1; BJ1S1; BJ2S3;
BJ2S5); moderately expressed families between 3% and 8% (BJ1S2;
BJ1S5; BJ2S2; BJ1S6); and poorly expressed families with less than 3%
(BJ1S4; BJ2S6; BJ1S3; BJ2S4). This nonrandom use of BJ subfamilies was
found also in other BV families analyzed, such as BV3, BV5, BV14, BV15,
and BV16. A histogram of the mean BJ representation in all the BV
families analyzed is shown in Fig 3.

View larger version (21K):
[in this window]
[in a new window]
| Fig 2.
BV usage in nine different CB samples (A). After
quantification, cDNA was amplified for 30 cycles directly with one of
the BV primers and the fluorescent BC primer. The peak values for each
BV subfamily were added, and the sum was expressed as the relative
percentages of the total of all the peak intensities (mean ± SD). A
similar analysis was conducted for nine samples from healthy adult
individuals (B).
|
|

View larger version (23K):
[in this window]
[in a new window]
| Fig 3.
BJ usage in CB T cells. Histograms were calculated as in
Fig 2 and indicate the relative percentage of each BJ segment
(mean ± SD) in BV subfamilies BV13, BV6, and BV12 and the mean BJ
expression.
|
|
CB T-cell repertoire under superantigenic activation.
Previous studies have shown that Staphylococcus aureus
enterotoxins, including TSST-1 and SEA, are powerful stimulators of T
cells.27 Using this technique we analyzed the effect of
toxins TSST-1 and SEA on CB and adult PBL. Cells were cultured for 4
days in the same conditions with controls, including culture in medium
alone. Strong proliferation in response to superantigenic stimulations
was observed for adult (n = 30) as well as CB (n = 10) samples
(data not shown). T-cell activation markers CD25 and CD45RO analyzed by
flow cytometry (Table 1) markedly increased
on stimulation of CB with either toxin. CD45RO marker of memory T cells
was very low in CB-unstimulated cells as has been previously
reported.5,8,28 We have verified that a nonspecific
polyclonal activation with an anti-CD3 MoAb did not change the
Immunoscope profiles and BV subfamilies distribution (data not shown).
A quantitative study of the BV family usage in CB (n = 4) and adult
PBL (n = 4) samples was performed. One representative experiment of
CB is shown in Fig 4. After TSST-1
stimulation, we observed a marked expansion of the BV2 family in CB
samples, as high as 75% of the total TCRBV repertoire. The BJ usage
within BV2 families of samples activated by TSST-1 from one newborn and
one adult donor was not different from the representation shown in Fig
3 (data not shown). Activation with SEA resulted in the expansion of
several BV families in CB as well as in adult PBL. Therefore, in each
type of stimulation the profile of the BV family remained strictly
polyclonal. Table 2 presents data for BV
families modified on SEA stimulation and for BV1, a previously reported
SEA expanded family.29 Families BV6, BV18, BV22, and BV24
were expanded in almost all individuals up to eightfold in
SEA-stimulated samples in comparison with cultures in medium only. BV18
and BV24, which are poorly expressed without stimulation, became
notably expanded in adults and in newborns. BV5, BV7, BV9, and BV21
families were expanded in some individuals and not in others. The BV1
family was not expanded by SEA stimulation under our experimental
conditions.

View larger version (20K):
[in this window]
[in a new window]
| Fig 4.
BV usage after activation by superantigens TSST-1 and SEA
in a representative CB sample. Cell suspensions were cultured for 4
days in the presence of TSST-1 (1 ng/mL), SEA (1 ng/mL), or culture
medium only. The semiquantitative analysis of BV family usage was
performed and the results expressed as in Fig 2.
|
|
 |
DISCUSSION |
This is the first detailed characterization of the TCR -chain
diversity in CB and its capacity to undergo expansion, although a
previous study provided some insight into the TCR -chain CDR3 length
distribution in CD4 and CD8 lymphocyte subpopulations.24
Some characteristics of the CB T-cell repertoire are close to those
described in healthy adults using either the same or other
methodologies.15,17,30,31 All BV subfamilies were expressed
in newborns and adults with comparable differences in the BV and BJ
usage. This nonrandom usage is not a function of the number or location
of genes,32 and its significance remains unknown. Genetic
factors could be responsible for the variations in the BV expression
levels as shown in the case of the BV3 subfamily33 and
could be reflected by the standard deviation values of BV expression
seen in Fig 2. Other studies have concerned the diversity of the early
fetal TCRBV repertoire.25,34,35 The preferential usage of
BJ2 elements has been shown in human fetal tissue as early as after 13
weeks of gestation.34 Mean CDR3 length in the different BV
families was similar to that reported in adults, which suggests that
the variability of the CDR3 length is not notably modified after birth
in humans in contrast to the early human fetal
repertoire25,33 and to observations made in
mice.16 This is also in agreement with previous -chain
CDR3 sequencing data obtained from one CB sample.36 We
could therefore conclude that the T-cell repertoire is fully
constituted at birth. This also appears to be the case for CB B-cell
repertoire.37
As an example of in vitro-induced modifications of this repertoire, we
have looked at stimulation with superantigens. We did not observe
significant differences in the levels of proliferative responses to
stimulation between the adult and the CB lymphocytes. Staphylococcal
toxin TSST-1 is known to specifically induce the expansion of
BV2-expressing T cells.27 The heterogeneity of the CDR3
length in the BV2 family on TSST-1 stimulation has been recently shown
in adults by TCR spectratyping.38 The global Immunoscope
analysis was especially appropriate in the case of SEA, because several
different BV families could be stimulated. MoAbs are presently not
available for all of the BV families; BV24 and poorly expressed
families would otherwise have been difficult to evaluate. Some BV
families expanded by SEA stimulation in adults have been
reported29,39; BV6, BV7, BV9, BV18, and BV22 specificities
were confirmed in this study. BV24 is one of the most poorly expressed
families in adults and in newborns, but its expansion was clearly
detected in this study. BV6, BV18, BV22, and BV24 were consistently
expanded on stimulation, whereas other families (BV5, BV7, BV9, BV21)
were expanded more variably. We did not observe notable differences in
the SEA-induced modification of the TCRBV repertoire between adults and
newborns.
The major difference between the adult and the CB T-cell repertoire
lies in the distribution of the CDR3 size, which reflects the clonality
of the T-cell population (polyclonal v oligoclonal or
monoclonal profiles). The polyclonal profiles observed in CB support
the notion that these cells have not been previously exposed to
antigenic stimulation. In healthy adults, oligoclonal expansions can be
seen in different BV subfamilies and are the hallmark of the antigenic
stimuli received throughout life. These have been reported to occur
mainly in the memory CD8+CD45RO+ lymphocyte
subpopulations,24 but they have also been reported in
CD4+CD45RO+ T cells in elderly
humans.23 Alterations of the repertoire have been observed
in pathological conditions,17 such as autoimmune diseases,
tumors,19 or GVHD.40,41 Mature T cells
constitute the main reservoir for T-cell repopulation during the first
year after bone marrow engraftment.42 Expanded populations
of antigen-specific mature T lymphocytes cotransfused with adult stem
cells could participate in the triggering of GVHD caused by
cross-reactive recognition of alloantigens in the recipient. By using
spectratyping, another method based on the CDR3 size analysis,
modifications of the T-cell repertoire during the immune reconstitution
after bone marrow transplantation have been documented42-44
and linked to GVHD or infectious complications. The absence of clonal
expansions of alloreactive cells in CB could have a crucial role in the
lower incidence of GVHD observed after CB transplantation. The
evaluation of the T-cell repertoire reconstitution after graft from CB
hematopoietic stem cells in parallel with the clinical status, GVHD,
and the quality of immune responses will be needed to assess these
points. Furthermore, the polyclonal profile of the CB T-cell repertoire
constantly observed here will facilitate detection of T-cell expansions
during follow-up of these grafts in comparison with grafts from adult
donors.
 |
FOOTNOTES |
Submitted April 14, 1997;
accepted August 26, 1997.
L.G. and N.D. contributed equally to this work.
Supported in part by the Etablissement Français des Greffes
(EFG), the Fondation de France contre la Leucémie, and EUROCORD
Concerted Action Biomed II.
Address reprint requests to Antoine Toubert, MD,
Laboratoire d'Immunogénétique Humaine, INSERM U.396,
Centre G. Hayem, Hôpital Saint-Louis, 1, Av Claude Vellefaux,
75475, Paris Cedex 10, France.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section 1734 solely
to indicate this fact.
 |
ACKNOWLEDGMENT |
The authors thank Dr M. Busson for help in the statistical analysis and
Drs P. Kourilsky and D. Przepiorka for critical reading of the
manuscript.
 |
REFERENCES |
1.
Wagner JE,
Kernan NA,
Steinbuch M,
Broxmeyer HE,
Gluckman E:
Allogeneic sibling umbilical-cord-blood transplantation in children with malignant and non-malignant disease.
Lancet
346:214,
1995[Medline]
[Order article via Infotrieve]
2.
Kurtzberg J,
Laughlin M,
Graham ML,
Smith C,
Olson JF,
Halperin EC,
Ciocci G,
Carrier C,
Stevens CE,
Rubinstein P:
Placental blood as a source of hematopoietic stem cells for transplantation into unrelated recipients.
N Engl J Med
335:157,
1996[Abstract/Free Full Text]
3.
Wagner JE,
Rosenthal J,
Sweetman R,
Shu XO,
Davies SM,
Ramsay NKC,
McGlave PB,
Sender L,
Cairo MS:
Successful transplantation of HLA-matched and HLA-mismatched umbilical cord blood from unrelated donors: Analysis of engraftment and acute graft-versus-host disease.
Blood
88:795,
1996[Abstract/Free Full Text]
4. Gluckman E, Rocha V, Boyer Chammard A, Locatelli F, Arcese W,
Souillet G, for Eurocord Transplant Group: Results of cord blood
transplants in Europe. Blood 88:485a, 1996 (abstr)
5.
Harris DT,
Schumacher MJ,
Locascio J,
Besencon FJ,
Olson GB,
DeLuca D,
Shenker L,
Bard J,
Boyse EA:
Phenotypic and functional immaturity of human umbilical cord blood T lymphocytes.
Proc Natl Acad Sci USA
89:10006,
1992[Abstract/Free Full Text]
6.
Garban F,
Ericson M,
Roucard C,
Rabian-Herzog C,
Teisserenc H,
Sauvanet E,
Charron D,
Mooney N:
Detection of empty HLA class II molecules on cord blood B cells.
Blood
87:3970,
1996[Abstract/Free Full Text]
7.
Ridson G,
Gaddy J,
Horie M,
Broxmeyer HE:
Alloantigen priming induces a state of unresponsiveness in human umbilical cord blood T cells.
Proc Natl Acad Sci USA
92:2413,
1995[Abstract/Free Full Text]
8.
Takahashi N,
Imanishi K,
Nishida H,
Uchiyama T:
Evidence for immunologic immaturity of cord blood T cells. Cord blood T cells are susceptible to tolerance induction to in vitro stimulation with a superantigen.
J Immunol
155:5213,
1995[Abstract]
9. Harris DT, LoCascio J, Besencon FJ: Analysis of the alloreactive
capacity of human umbilical cord blood: Implications for
graft-versus-host disease. Bone Marrow Transplant 14:545, 1994
10.
Morita CT,
Parker CM,
Brenner MB,
Band H:
TCR usage and functional capabilities of human  T cells at birth.
J Immunol
153:3979,
1994[Abstract]
11.
Wei S,
Charmley P,
Robinson MA,
Concannon P:
The extent of the human germline T-cell receptor V beta gene segment repertoire.
Immunogenetics
40:27,
1994[Medline]
[Order article via Infotrieve]
12.
LaRocque R,
Robinson MA:
Diversity in the human T cell receptor beta chain.
Hum Immunol
48:3,
1996[Medline]
[Order article via Infotrieve]
13.
Garcia KC,
Degano M,
Stanfield RL,
Brunmark A,
Jackson MR,
Peterson PA,
Teyton L,
Wilson IA:
An  T cell receptor structure at 2.5 A and its orientation in the TCR-MHC complex.
Science
274:209,
1996[Abstract/Free Full Text]
14.
Panzara MA,
Oksenberg JR,
Steinman L:
The polymerase chain reaction for detection of T cell antigen receptor expression.
Curr Opin Immunol
4:205,
1992[Medline]
[Order article via Infotrieve]
15.
Genevee C,
Farace F,
Chung V,
Diu A,
Raffoux C,
Charron D,
Hercend T,
Triebel F:
Influence of Human Leukocyte Antigen genes on TCR V gene segment frequencies.
Int Immunol
6:1497,
1994[Abstract/Free Full Text]
16.
Pannetier C,
Cochet M,
Darche S,
Casrouge A,
Zöller M,
Kourilsky P:
The sizes of the CDR3 hypervariable regions of the murine T-cell receptor chains vary as a function of the recombined germ-line segment.
Proc Natl Acad Sci USA
90:4319,
1993[Abstract/Free Full Text]
17.
Even J,
Lim A,
Puisieux I,
Ferradini L,
Dietrich PY,
Toubert A,
Hercend T,
Triebel F,
Pannetier C,
Kourilsky P:
T-cell repertoires in healthy and diseased human tissues analysed by T-cell receptor -chain size determination: Evidence for oligoclonal expansions in tumours and inflammatory diseases.
Res Immunol
146:65,
1995[Medline]
[Order article via Infotrieve]
18.
Chomczynski P,
Saachi N:
Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156,
1987[Medline]
[Order article via Infotrieve]
19.
Puisieux I,
Even J,
Pannetier C,
Jotereau F,
Favrot M,
Kourilsky P:
Oligoclonality of tumor-infiltrating lymphocytes from human melanomas.
J Immunol
153:2807,
1994[Abstract]
20.
Currier JR,
Yassai M,
Robinson MA,
Gorski J:
Molecular defects in TCRBV genes preclude thymic selection and limit the expressed TCR repertoire.
J Immunol
157:170,
1996[Abstract]
21. Boumsell L: T-cell antigen report, in Schlossman SF, Boumsell L,
Gilks W, Harlan JM, Kishimoto T, Morimoto C, Ritz J, Shaw S,
Silverstein R, Springer T, Tedder T, Todd R (eds): Leucocyte Typing V.
Proceedings of the Fifth International Workshop. Oxford, Great Britain,
Oxford University Press, 1995
22.
Cochet M,
Pannetier C,
Regnault A,
Darche S,
Leclerc C,
Kourilsky P:
Molecular detection and in vivo analysis of the specific T cell response to a protein antigen.
Eur J Immunol
22:2639,
1992[Medline]
[Order article via Infotrieve]
23.
Schwab R,
Szabo P,
Manavalan JS,
Weksler ME,
Posnett DN,
Pannetier C,
Kourilsky P,
Even J:
Expanded CD4+ and CD8+ T cell clones in elderly humans.
J Immunol
158:4493,
1997[Abstract]
24.
Hingorani R,
Choi IH,
Akolkar P,
Gulwani-Akolkar B,
Pergolizzi R,
Silver J,
Gregersen PK:
Clonal predominance of T cell receptors within the CD8+ CD45RO+ subset in normal human subjects.
J Immunol
151:5762,
1993[Abstract]
25.
Raaphorst FM,
Kaijzel EL,
van Tol MJD,
Vossen JM,
van den Elsen PJ:
Non-random employment of V 6 and J gene elements and conserved amino acid usage profiles in CDR3 regions of human fetal and adult TCR chain rearrangements.
Int Immunol
6:1,
1993[Abstract/Free Full Text]
26.
Quiros Roldan E,
Sottini A,
Bettinardi A,
Albertini A,
Imberti L,
Primi D:
Different TCRBV genes generate biased patterns of V-D-J diversity in human T cells.
Immunogenetics
41:91,
1995[Medline]
[Order article via Infotrieve]
27.
Kappler J,
Kotzin B,
Herron L,
Gelfand EW,
Bigler RD,
Boylston A,
Carrel S,
Posnett DN,
Choi Y,
Marrack P:
V beta-specific stimulation of human T cells by staphylococcal toxins.
Science
224:811,
1989
28.
Bofill M,
Akbar AN,
Salmon M,
Robinson M,
Burford G,
Janossy G:
Immature CD45RAlowROlow T cells in the human cord blood.
J Immunol
152:5613,
1994[Abstract]
29.
Newton DW,
Dohlsten M,
Olsson C,
Segren S,
Lundin KEA,
Lando PA,
Kalland T,
Kotb M:
Mutations in the MHC class II binding domains of staphylococcal enterotoxin A differentially affect T cell receptor V specificity.
J Immunol
157:3988,
1996[Abstract]
30.
Rosenberg WMC,
Moss PAH,
Bell JI:
Variation in human T cell receptor V and J repertoire: Analysis using anchor polymerase chain reaction.
Eur J Immunol
22:541,
1992[Medline]
[Order article via Infotrieve]
31.
Rieux-Laucat F,
LeDeist F,
Selz F,
Fischer A,
de Villartay JP:
Normal T cell receptor V usage in a primary immunodeficiency associated with HLA class II deficiency.
Eur J Immunol
23:928,
1993[Medline]
[Order article via Infotrieve]
32.
Robinson MA:
Usage of human T cell receptor V , J , C , and V gene segments is not proportional to gene number.
Hum Immunol
35:60,
1992[Medline]
[Order article via Infotrieve]
33.
Donahue JP,
Ricalton NS,
Behrendt CE,
Ritterhaus C,
Calaman S,
Marrack P,
Kappler JW,
Kotzin BL:
Genetic analysis of low V 3 expression in humans.
J Exp Med
179:1701,
1994[Abstract/Free Full Text]
34.
George JF,
Schroeder HW:
Developmental regulation of D reading frame and junctional diversity in T cell receptor- transcripts from human thymus.
J Immunol
148:1230,
1992[Abstract]
35.
Raaphorst FM,
van Bergen J,
Langlois van den Bergh R,
van der Keur M,
de Krijger R,
Bruining J,
van Tol JD,
Vossen JM,
van den Elsen P:
Usage of TCRAV and TCRBV gene families in human fetal and adult TCR rearrangements.
Immunogenetics
39:343,
1994[Medline]
[Order article via Infotrieve]
36.
Moss PAH,
Bell JI:
Sequence analysis of the human  T-cell receptor CDR3 region.
Immunogenetics
42:10,
1995[Medline]
[Order article via Infotrieve]
37.
Mortari F,
Wang JY,
Schroeder HW:
Human cord blood antibody repertoire. Mixed population of Vh gene segments and CDR3 distribution in the expressed C and C repertoires.
J Immunol
150:1348,
1993[Abstract]
38.
Currier JR,
Deulofeut H,
Barron KS,
Kehn PJ,
Robinson MA:
Mitogens, superantigens and nominal antigens elicit distinctive patterns of TCRB CDR3 diversity.
Hum Immunol
48:39,
1996[Medline]
[Order article via Infotrieve]
39.
Hudson KR,
Robinson H,
Fraser JD:
Two adjacent residues in staphylococcal enterotoxins A and E determine T cell receptor V specificity.
J Exp Med
177:175,
1993[Abstract/Free Full Text]
40.
Dietrich PY,
Caignard A,
Lim A,
Chung V,
Pico J,
Pannetier C,
Kourilsky P,
Hercend T,
Even J,
Triebel F:
In vivo T-cell clonal amplification at time of acute graft-versus-host disease.
Blood
84:2815,
1994[Abstract/Free Full Text]
41.
Gaschet J,
Lim A,
Liem L,
Vivien R,
Hallet MM,
Harousseau JL,
Even J,
Goulmy E,
Bonneville M,
Milpied N,
Vie H:
Acute graft versus host disease due to T lymphocytes recognizing a single HLA-DPB1*0501 mismatch.
J Clin Invest
98:100,
1996[Medline]
[Order article via Infotrieve]
42.
Roux E,
Helg C,
Dumont-Girard F,
Chapuis B,
Jeannet M,
Roosnek E:
Analysis of T-cell repopulation after allogeneic bone marrow transplantation: Significant differences between recipients of T-cell depleted and unmanipulated grafts.
Blood
87:3984,
1996[Abstract/Free Full Text]
43.
Liu X,
Chesnokova V,
Forman SJ,
Diamond DJ:
Molecular analysis of T-cell receptor repertoire in bone marrow transplant recipients: Evidence for oligoclonal T-cell expansion in graft-versus-host disease lesions.
Blood
87:3032,
1996[Abstract/Free Full Text]
44.
Gorski J,
Yassai M,
Zhu X,
Kissella B,
Keever C,
Flomenberg N:
Circulating T cell repertoire complexity in normal individuals and bone marrow recipients analyzed by CDR3 size spectratyping.
J Immunol
152:5109,
1994[Abstract]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
D. A. Randolph
The Neonatal Adaptive Immune System
NeoReviews,
October 1, 2005;
6(10):
e454 - e462.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Zippelius, G. Bioley, F.-A. Le Gal, N. Rufer, M. Brandes, P. Batard, M. De Smedt, J. Plum, D. E. Speiser, J.-C. Cerottini, et al.
Human Thymus Exports Naive CD8 T Cells That Can Home to Nonlymphoid Tissues
J. Immunol.,
March 1, 2004;
172(5):
2773 - 2777.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Jullien, R. Q. Cron, K. Dabbagh, A. Cleary, L. Chen, P. Tran, P. Stepick-Biek, and D. B. Lewis
Decreased CD154 expression by neonatal CD4+ T cells is due to limitations in both proximal and distal events of T cell activation
Int. Immunol.,
December 1, 2003;
15(12):
1461 - 1472.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Salio, N. Dulphy, J. Renneson, M. Herbert, A. McMichael, A. Marchant, and V. Cerundolo
Efficient priming of antigen-specific cytotoxic T lymphocytes by human cord blood dendritic cells
Int. Immunol.,
October 1, 2003;
15(10):
1265 - 1273.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. S. Grewal, J. N. Barker, S. M. Davies, and J. E. Wagner
Unrelated donor hematopoietic cell transplantation: marrow or umbilical cord blood?
Blood,
June 1, 2003;
101(11):
4233 - 4244.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Hermann, C. Truyens, C. Alonso-Vega, J. Even, P. Rodriguez, A. Berthe, E. Gonzalez-Merino, F. Torrico, and Y. Carlier
Human fetuses are able to mount an adultlike CD8 T-cell response
Blood,
August 28, 2002;
100(6):
2153 - 2158.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Talvensaari, E. Clave, C. Douay, C. Rabian, L. Garderet, M. Busson, F. Garnier, D. Douek, E. Gluckman, D. Charron, et al.
A broad T-cell repertoire diversity and an efficient thymic function indicate a favorable long-term immune reconstitution after cord blood stem cell transplantation
Blood,
February 15, 2002;
99(4):
1458 - 1464.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Benveniste, P. Cherin, T. Maisonobe, R. Merat, O. Chosidow, L. Mouthon, L. Guillevin, A. Flahault, M.-C. Burland, D. Klatzmann, et al.
Severe Perturbations of the Blood T Cell Repertoire in Polymyositis, But Not Dermatomyositis Patients
J. Immunol.,
September 15, 2001;
167(6):
3521 - 3529.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Guilherme, N. Dulphy, C. Douay, V. Coelho, E. Cunha-Neto, S. E. Oshiro, R. V Assis, A. C. Tanaka, P. M. Alberto Pomerantzeff, D. Charron, et al.
Molecular evidence for antigen-driven immune responses in cardiac lesions of rheumatic heart disease patients
Int. Immunol.,
July 1, 2000;
12(7):
1063 - 1074.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Rocha, J. E. Wagner, K. A. Sobocinski, J. P. Klein, M.-J. Zhang, M. M. Horowitz, E. Gluckman, and The Eurocord and International Bone Marrow Transpl
Graft-Versus-Host Disease in Children Who Have Received a Cord-Blood or Bone Marrow Transplant from an HLA-Identical Sibling
N. Engl. J. Med.,
June 22, 2000;
342(25):
1846 - 1854.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Verfuerth, K. Peggs, P. Vyas, L. Barnett, R. J. O'Reilly, and S. Mackinnon
Longitudinal monitoring of immune reconstitution by CDR3 size spectratyping after T-cell-depleted allogeneic bone marrow transplant and the effect of donor lymphocyte infusions on T-cell repertoire
Blood,
June 15, 2000;
95(12):
3990 - 3995.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Dulphy, M.-A. Peyrat, V. Tieng, C. Douay, C. Rabian, R. Tamouza, S. Laoussadi, F. Berenbaum, A. Chabot, M. Bonneville, et al.
Common Intra-Articular T Cell Expansions in Patients with Reactive Arthritis: Identical {beta}-Chain Junctional Sequences and Cytotoxicity Toward HLA-B27
J. Immunol.,
April 1, 1999;
162(7):
3830 - 3839.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Than, M. Kharbanda, V. Chitnis, S. Bakshi, P. K. Gregersen, and S. Pahwa
Clonal Dominance Patterns of CD8 T Cells in Relation to Disease Progression in HIV-Infected Children
J. Immunol.,
March 15, 1999;
162(6):
3680 - 3686.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Ciubotariu, A. I. Colovai, G. Pennesi, Z. Liu, D. Smith, P. Berlocco, R. Cortesini, and N. Suciu-Foca
Specific Suppression of Human CD4+ Th Cell Responses to Pig MHC Antigens by CD8+CD28- Regulatory T Cells
J. Immunol.,
November 15, 1998;
161(10):
5193 - 5202.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|