Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Garderet, L.
Right arrow Articles by Toubert, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Garderet, L.
Right arrow Articles by Toubert, A.
Related Collections
Right arrow Transplantation
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 91 No. 1 (January 1), 1998: pp. 340-346

The Umbilical Cord Blood alpha beta T-Cell Repertoire: Characteristics of a Polyclonal and Naive but Completely Formed Repertoire

By Laurent Garderet, Nicolas Dulphy, Corinne Douay, Nathalie Chalumeau, Véronique Schaeffer, Marie-Thérèse Zilber, Annick Lim, Jos Even, Nuala Mooney, Catherine Gelin, Eliane Gluckman, Dominique Charron, and Antoine Toubert

From the Laboratoire d'Immunogénétique Humaine, INSERM U.396, Institut Biomédical des Cordeliers et Centre G. Hayem, Hôpital Saint-Louis; and the Unité de Biologie Moléculaire du Gène, INSERM U.277, Institut Pasteur and the Service d'Hématologie-Greffe de Moelle Osseuse, Hôpital Saint-Louis, Paris, France.


    ABSTRACT
Abstract
Introduction
Methods
Results
Discussion
References

Umbilical cord blood (CB) constitutes a promising alternative to bone marrow for allogeneic transplantation and is increasingly used because of the reduced severity of graft-versus-host disease after CB transplantation. We have compared the T-cell receptor beta chain (TCRB) diversity of CB lymphocytes with that of adult lymphocytes by analyzing the complementarity determining region 3 (CDR3) size heterogeneity. In marked contrast to adult samples, we observed bell-shaped profiles in all of the 22 functional beta -chain variable (BV) subfamilies that reflect the lack of prior antigenic stimulation in CB samples. However, the mean CDR3 size and BV usage were comparable between CB and adult samples. BJ2 (65%) segments were used preferentially to BJ1 (35%), especially BJ2S7, BJ2S5, BJ2S3, and BJ2S1, in both CB and in adult lymphocytes. We therefore conclude that although naive as reflected by the heterogeneity of the CDR3 size, the TCRBV repertoire appears fully constituted at birth. The ability to expand TCRB subfamilies was confirmed by stimulation with staphylococcal superantigens toxic shock syndrome toxin-1 and staphylococcal enterotoxin A. This study provides the basis for future analysis of the T-cell repertoire reconstitution following umbilical CB transplantation.

    INTRODUCTION
Abstract
Introduction
Methods
Results
Discussion
References

UMBILICAL CORD blood (CB) has been used successfully since 1988 as a source of hematopoietic stem cells for transplantation involving sibling donors1 and, more recently, unrelated recipients.2,3 CB transplantation has been associated with a reduced risk of developing severe graft-versus-host disease (GVHD), even when cells from partially major histocompatibility complex (MHC)-mismatched donors are used.3 The maximum degree of HLA disparity that will still allow engraftment has yet to be determined, but in contrast with HLA-mismatched bone marrow transplantation, even unrelated 1 or 2 antigen mismatched CB transplants result in an acceptable grade of acute GVHD.4

The lower risk of GVHD associated with the use of CB transplants is thought to be caused by the functional immaturity of lymphocytes at birth. Phenotypically, a lower expression of the CD45RO marker of memory T cells has been shown in newborns.5 The expression of class II molecules on antigen presenting cells is decreased in CB B cells, and these molecules are predominantly empty.6 Alloantigens or superantigens can induce strong initial proliferative responses of CB as well as of adult T cells, but a state of unresponsiveness is induced on restimulation in CB.7,8 Many abnormalities of lymphokine production have been described on activation, such as a decreased production of interferon-gamma or tumor necrosis factor-alpha after phytohemagglutinin, anti-CD3, or allogeneic stimulation.9 On the whole, these data indicate a relatively unstimulated state of CB lymphocytes at least under in vitro conditions.

At birth, most of the T cells express an alpha beta T-cell receptor (TCR) heterodimer. gamma delta T cells are rare and express a diverse array of TCR.10 The TCR beta -chain is produced by the combination of V, D, J, and C gene segments.11,12 In addition, this combinatorial diversity is increased by the nibbling of germline nucleotides and addition of N- and P-residues at the V-D-J junction sites. The complementarity determining region 3 (CDR3) encompassing the V-D-J junction displays the most extensive diversity and is thought to contact the antigenic peptide.13 Most T-cell repertoire studies used beta -chain variable (BV)-specific monoclonal antibodies (MoAbs) or polymerase chain reaction (PCR) methods to evaluate the expression level of the various BV segments.14,15 A method called "Immunoscope" has been developed to determine the size of CDR3 regions in transcripts of whole BV families or in given BV-BJ combinations with the help of an automated DNA sequencer.16,17 This approach is particularly valuable in defining the diversity of alpha beta CB T cells for several reasons. First, it can give a global picture of the repertoire in all presently known functional BV subfamilies without being limited by the availability of specific MoAbs. Second, it allows a comparison of several parameters of the alpha beta T-cell repertoire between adults and newborns (clonality of the BV families, size of the CDR3 regions, and semiquantitative analysis of the BV and BJ usage). Herein we have defined the overall picture of the alpha beta T-cell repertoire in CB lymphocytes and its modification on stimulation with bacterial superantigens toxic shock syndrome toxin-1 (TSST-1) and the staphylococcal enterotoxin A (SEA) in comparison with adult donors.

    MATERIALS AND METHODS
Abstract
Introduction
Methods
Results
Discussion
References

CB samples.   Umbilical CB samples were obtained at delivery from full-term healthy pregnancies after the mother's consent (Dr Brossard, Hôpital Saint-Vincent-de-Paul, Paris, France). Nine peripheral blood leucocyte (PBL) samples from healthy adult individuals were studied as controls.

RNA extraction and cDNA synthesis.   Cells were obtained by gradient density centrifugation (Ficoll/Hypaque). Pellets were frozen in liquid nitrogen before RNA extraction by lysis in guanidium thiocyanate buffer.18 The first cDNA strand was prepared starting from 5 to 10 µg total RNA and avian myeloblastosis virus (AMV) reverse transcriptase as recommended by the manufacturer (cDNA cycle kit; Invitrogen, The Netherlands).

Oligonucleotides and PCR amplification.   The primers used have been described in Puisieux et al19 with modifications for BV6 (5'-CTCTGAAGATCCAGCGCACAGAGC-3') and BV21 (5'-TCCAGCCTGCAAAGCTTGAGGACT-3'). Fluorescent primers for BC and BJ were labeled at the 5' end with the Fam fluorophore (Applied Biosystems, Foster City, CA). Aliquots of the cDNA synthesis reaction (corresponding to 250 ng of total RNA) were amplified in 50 µL reactions with one of the BV-specific oligonucleotides as the 5' primer and the BC oligonucleotide as the 3' primer. The final concentration was 0.5 mmol/L for each primer, dNTP 0.2 mmol/L, MgCl2 2 mmol/L in Taq polymerase buffer (Promega, Madison, WI) in the presence of 1 unit of Taq polymerase (Promega) on a DNA thermal cycler (Perkin Elmer 9600, Norwalk, CT). The PCR cycle profile was denaturation at 94°C for 30 seconds, annealing at 60°C for 45 seconds, primer extension at 72°C for 45 seconds for 40 cycles, and a final polymerization step of 10 minutes at 72°C. Aliquots from each BV-BC PCR product (2 µL) were copied in 4- to 6-cycle run-off reactions primed with a fluorophore-labeled BC- or BJ-specific oligonucleotide as described.19 The run-off reactions were loaded on 4.25% acrylamide sequencing gels (377A DNA sequencer, Applied Biosystems) for size and fluorescence intensity determination. Fluorescent size markers were 80, 145, 210, 270, and 350 bp long or the Genescan-500 size marker (Perkin Elmer). The raw data were analyzed with the help of the Immunoscope software.16 The CDR3 region was defined to include residues 95-106.17 Since the position of the BV and the BC primers are fixed, the length distribution observed in the PCR fluorescent BV-BC products only depends on the size of the V-D-J junctions. Statistical analysis was performed to determine whether or not a profile could be considered as gaussian; a profile was not considered to be gaussian if one peak was excluded from the 95% confidence interval of peak level intensities. TCRB subfamilies BV10 and BV19 were omitted from this analysis because they are pseudogenes in most individuals.20

Vbeta and Jbeta gene usage.   A competitive PCR was used to quantify the TCR transcripts in each sample. A deleted (4 bp) delta -chain plasmid of the CD3 complex and CD3 primers (CD3-3' TGTCTGAGAGCAGTGTTCCCAC and CD3-5' CCAGGCTGATAGTTCGGTGACC) was used.17 The cDNA sample and the deleted delta -chain plasmid were amplified together for 25 cycles in the same conditions as described above. About 3 × 106 copies of cDNA from each sample were then amplified for 30 cycles with the BV primers and an internal fluorescent BC primer. The percentage of representation of each BV family was calculated and presented as histograms. BJ usage was defined after run-off reactions of the unlabeled BV-BC amplification product and is quantitative because the fluorescent primers have comparable amplification efficiencies.17 The fluorescence intensity in each BJ family was expressed as the relative percentage of total signals from the 13 BJ subfamilies and represented as histograms. Statistical comparisons between samples from adults and newborns were done by the Mann-Whitney test.

Cell culture of CB and adult PBL with superantigens.   Umbilical CB cells and adult mononuclear cells were cultured at 2 × 106 cells/mL for 4 days in RPMI 1640 medium (Seromed, Biochrom, KG, Berlin) supplemented with 2 mmol/L glutamine, 10 U/mL penicillin, 10 mg/mL streptomycin (GIBCO, Paisley, UK), and 10% heat-inactivated fetal calf serum (FCS; Seromed). Cultures were stimulated with the lowest concentration of superantigen giving an optimal response: SEA and TSST-1 (Toxin Technology, Madison, WI) at 1 ng/mL. Culture flasks (25 cm2) were incubated at 37°C in 5% CO2. Simultaneously, proliferation assays using 3H thymidine uptake were performed to check for proliferation after 4 days of culture. Quantification of the TCR complex-specific RNA and BV usage analysis were performed as described above.

Flow cytometry analysis.   Phenotypic analysis was performed by flow cytometry using a FACScan flow cytometer (Becton Dickinson, Mountain View, CA). MoAbs used were CD3-phycoerythrin conjugated (PE), CD4-PE, CD8-PE, and CD25-PE (Caltag Laboratories, San Francisco, CA). 158-4D3 and UCHL1 MoAbs, specific respectively for CD45RA and CD45RO molecules, were provided during the Vth International Workshop on Human Differentiation Antigens.21 After being washed, cells stained with unlabeled MoAbs were incubated with a 1:100 dilution of fluorescein isothiocyanate-conjugated goat anti-mouse F(ab)2' fragment (Immunotech, Marseilles, France). Results are expressed as percentages of cells staining above background.

    RESULTS
Abstract
Introduction
Methods
Results
Discussion
References

Clonality of umbilical CB lymphocytes and CDR3 size analysis.   In adults, six to eight peaks spaced by three nucleotides corresponding to in-frame transcripts of the TCR beta -chain CDR3 region are usually found for each BV-BC combination (Fig 1).The area under each peak is proportional to the amount of transcripts of the corresponding CDR3 size in the sample.22 Each peak corresponding to a given CDR3 length usually contains multiple distinct sequences. An increase in the height and area of a peak that modifies the bell-shaped CDR3 size distribution indicates oligoclonal or monoclonal expansions occurring on immunological stimulations. Statistical analysis allowed to define a profile as gaussian or not. Sequence analysis has previously been used to confirm the clonality of such expansions in healthy adults.23 In the samples from our healthy adult control group, oligoclonal expansions were detected in at least 5 BV families, BV3, BV7, BV9, BV15, and BV23 in Fig 1A. This was markedly different from the aspect observed in nine different umbilical CB samples showing a reproducible gaussian profile in each BV family (Fig 1B). This profile displayed a size distribution of 8 to 10 identifiable peaks spaced by 3 nucleotides corresponding to in-frame transcripts as previously described in adults.17 CDR3 lengths varied between 5 and 14 amino acids, with a mean length of 9 or 10 amino acids. Two BV families, BV20 and BV4, had a shorter mean CDR3 length of 8 amino-acids (aa) (Fig 1). The bell-shaped profile of the BV-BC amplifications was modified in only 5 out of 220 cases; therefore, we examined these cases for a possible oligoclonal expansion. An in-depth analysis of these BV families with BJ run-off revealed a polyclonal profile in each of the 13 BJ families. Because the majority of expansions occurring in young healthy adults have been described in the CD8+ lymphocyte subpopulation,24 we selected CD4+ and CD8+ lymphocytes in three different CB samples. Similar gaussian profiles and CDR3 lengths were found in both subpopulations (data not shown). We concluded from these data that the umbilical CB T-cell repertoire is definitely polyclonal.


View larger version (36K):
[in this window]
[in a new window]
 
Fig 1. TCR beta -chain transcript CDR3 size distribution patterns from a representative adult (A) and CB (B) sample. cDNA was amplified in PCR reactions primed by one BV subfamily and the BC specific primer. The amplification products were copied in run-off reaction primed by a nested fluorescent BC specific primer, and the labeled DNA copies were analyzed on a sequencing gel in an automated DNA sequencer.

Vbeta and Jbeta usage in umbilical CB cells.   A semiquantitative analysis of the BV usage is possible after a prior quantification of the delta -chain of the CD3/TCR complex. Nine different umbilical CB samples have been analyzed, and the usage of the various BV families compared with adults is shown in Fig 2A. Three groups could be distinguished arbitrarily: highly expressed BV families with more than 6% each of the total expression (BV2; BV3; BV4; BV6; BV22); poorly expressed families with less than 3% (BV7; BV11; BV12; BV14; BV15; BV16; BV17; BV18; BV20; BV23; BV24); and BV families with an intermediate expression level between 3% and 6% (BV1; BV5; BV8; BV9; BV13; BV21). In parallel, nine samples from healthy adult donors were studied under identical experimental conditions (Fig 2B). The pattern of BV expression was not markedly different between newborns and adults. There was not a significant difference between the highly expressed families of CB versus adult, taking P < .01 as a cut-off. We then focused our study on the usage of the 13 BJ segments in family BV13 (10 different CB samples), family BV6 (n = 7), and family BV12 (n = 4) previously studied in adults.25,26 The BJ profile is shown for these 3 BV families in Fig 3. The BJ2 family was always expressed more than BJ1 (65% v 35%), and three representative groups could also be distinguished (Fig 3): well-expressed families accounted for more than 8% each of the total BJ representation (BJ2S7; BJ2S1; BJ1S1; BJ2S3; BJ2S5); moderately expressed families between 3% and 8% (BJ1S2; BJ1S5; BJ2S2; BJ1S6); and poorly expressed families with less than 3% (BJ1S4; BJ2S6; BJ1S3; BJ2S4). This nonrandom use of BJ subfamilies was found also in other BV families analyzed, such as BV3, BV5, BV14, BV15, and BV16. A histogram of the mean BJ representation in all the BV families analyzed is shown in Fig 3.


View larger version (21K):
[in this window]
[in a new window]
 
Fig 2. BV usage in nine different CB samples (A). After quantification, cDNA was amplified for 30 cycles directly with one of the BV primers and the fluorescent BC primer. The peak values for each BV subfamily were added, and the sum was expressed as the relative percentages of the total of all the peak intensities (mean ± SD). A similar analysis was conducted for nine samples from healthy adult individuals (B).


View larger version (23K):
[in this window]
[in a new window]
 
Fig 3. BJ usage in CB T cells. Histograms were calculated as in Fig 2 and indicate the relative percentage of each BJ segment (mean ± SD) in BV subfamilies BV13, BV6, and BV12 and the mean BJ expression.

CB T-cell repertoire under superantigenic activation.   Previous studies have shown that Staphylococcus aureus enterotoxins, including TSST-1 and SEA, are powerful stimulators of T cells.27 Using this technique we analyzed the effect of toxins TSST-1 and SEA on CB and adult PBL. Cells were cultured for 4 days in the same conditions with controls, including culture in medium alone. Strong proliferation in response to superantigenic stimulations was observed for adult (n = 30) as well as CB (n = 10) samples (data not shown). T-cell activation markers CD25 and CD45RO analyzed by flow cytometry (Table 1) markedly increased on stimulation of CB with either toxin. CD45RO marker of memory T cells was very low in CB-unstimulated cells as has been previously reported.5,8,28 We have verified that a nonspecific polyclonal activation with an anti-CD3 MoAb did not change the Immunoscope profiles and BV subfamilies distribution (data not shown). A quantitative study of the BV family usage in CB (n = 4) and adult PBL (n = 4) samples was performed. One representative experiment of CB is shown in Fig 4. After TSST-1 stimulation, we observed a marked expansion of the BV2 family in CB samples, as high as 75% of the total TCRBV repertoire. The BJ usage within BV2 families of samples activated by TSST-1 from one newborn and one adult donor was not different from the representation shown in Fig 3 (data not shown). Activation with SEA resulted in the expansion of several BV families in CB as well as in adult PBL. Therefore, in each type of stimulation the profile of the BV family remained strictly polyclonal. Table 2 presents data for BV families modified on SEA stimulation and for BV1, a previously reported SEA expanded family.29 Families BV6, BV18, BV22, and BV24 were expanded in almost all individuals up to eightfold in SEA-stimulated samples in comparison with cultures in medium only. BV18 and BV24, which are poorly expressed without stimulation, became notably expanded in adults and in newborns. BV5, BV7, BV9, and BV21 families were expanded in some individuals and not in others. The BV1 family was not expanded by SEA stimulation under our experimental conditions.

 
View this table:
[in this window] [in a new window]
 
Table 1. Activation of Adult or CB Lymphocytes With Bacterial Toxins


View larger version (20K):
[in this window]
[in a new window]
 
Fig 4. BV usage after activation by superantigens TSST-1 and SEA in a representative CB sample. Cell suspensions were cultured for 4 days in the presence of TSST-1 (1 ng/mL), SEA (1 ng/mL), or culture medium only. The semiquantitative analysis of BV family usage was performed and the results expressed as in Fig 2.

 
View this table:
[in this window] [in a new window]
 
Table 2. Analysis of BV Subfamily Frequencies Under SEA Stimulation of Adult and CB Lymphocytes

    DISCUSSION
Abstract
Introduction
Methods
Results
Discussion
References

This is the first detailed characterization of the TCR beta -chain diversity in CB and its capacity to undergo expansion, although a previous study provided some insight into the TCR beta -chain CDR3 length distribution in CD4 and CD8 lymphocyte subpopulations.24 Some characteristics of the CB T-cell repertoire are close to those described in healthy adults using either the same or other methodologies.15,17,30,31 All BV subfamilies were expressed in newborns and adults with comparable differences in the BV and BJ usage. This nonrandom usage is not a function of the number or location of genes,32 and its significance remains unknown. Genetic factors could be responsible for the variations in the BV expression levels as shown in the case of the BV3 subfamily33 and could be reflected by the standard deviation values of BV expression seen in Fig 2. Other studies have concerned the diversity of the early fetal TCRBV repertoire.25,34,35 The preferential usage of BJ2 elements has been shown in human fetal tissue as early as after 13 weeks of gestation.34 Mean CDR3 length in the different BV families was similar to that reported in adults, which suggests that the variability of the CDR3 length is not notably modified after birth in humans in contrast to the early human fetal repertoire25,33 and to observations made in mice.16 This is also in agreement with previous beta -chain CDR3 sequencing data obtained from one CB sample.36 We could therefore conclude that the T-cell repertoire is fully constituted at birth. This also appears to be the case for CB B-cell repertoire.37

As an example of in vitro-induced modifications of this repertoire, we have looked at stimulation with superantigens. We did not observe significant differences in the levels of proliferative responses to stimulation between the adult and the CB lymphocytes. Staphylococcal toxin TSST-1 is known to specifically induce the expansion of BV2-expressing T cells.27 The heterogeneity of the CDR3 length in the BV2 family on TSST-1 stimulation has been recently shown in adults by TCR spectratyping.38 The global Immunoscope analysis was especially appropriate in the case of SEA, because several different BV families could be stimulated. MoAbs are presently not available for all of the BV families; BV24 and poorly expressed families would otherwise have been difficult to evaluate. Some BV families expanded by SEA stimulation in adults have been reported29,39; BV6, BV7, BV9, BV18, and BV22 specificities were confirmed in this study. BV24 is one of the most poorly expressed families in adults and in newborns, but its expansion was clearly detected in this study. BV6, BV18, BV22, and BV24 were consistently expanded on stimulation, whereas other families (BV5, BV7, BV9, BV21) were expanded more variably. We did not observe notable differences in the SEA-induced modification of the TCRBV repertoire between adults and newborns.

The major difference between the adult and the CB T-cell repertoire lies in the distribution of the CDR3 size, which reflects the clonality of the T-cell population (polyclonal v oligoclonal or monoclonal profiles). The polyclonal profiles observed in CB support the notion that these cells have not been previously exposed to antigenic stimulation. In healthy adults, oligoclonal expansions can be seen in different BV subfamilies and are the hallmark of the antigenic stimuli received throughout life. These have been reported to occur mainly in the memory CD8+CD45RO+ lymphocyte subpopulations,24 but they have also been reported in CD4+CD45RO+ T cells in elderly humans.23 Alterations of the repertoire have been observed in pathological conditions,17 such as autoimmune diseases, tumors,19 or GVHD.40,41 Mature T cells constitute the main reservoir for T-cell repopulation during the first year after bone marrow engraftment.42 Expanded populations of antigen-specific mature T lymphocytes cotransfused with adult stem cells could participate in the triggering of GVHD caused by cross-reactive recognition of alloantigens in the recipient. By using spectratyping, another method based on the CDR3 size analysis, modifications of the T-cell repertoire during the immune reconstitution after bone marrow transplantation have been documented42-44 and linked to GVHD or infectious complications. The absence of clonal expansions of alloreactive cells in CB could have a crucial role in the lower incidence of GVHD observed after CB transplantation. The evaluation of the T-cell repertoire reconstitution after graft from CB hematopoietic stem cells in parallel with the clinical status, GVHD, and the quality of immune responses will be needed to assess these points. Furthermore, the polyclonal profile of the CB T-cell repertoire constantly observed here will facilitate detection of T-cell expansions during follow-up of these grafts in comparison with grafts from adult donors.

    FOOTNOTES

   Submitted April 14, 1997; accepted August 26, 1997.
   L.G. and N.D. contributed equally to this work.
   Supported in part by the Etablissement Français des Greffes (EFG), the Fondation de France contre la Leucémie, and EUROCORD Concerted Action Biomed II.
   Address reprint requests to Antoine Toubert, MD, Laboratoire d'Immunogénétique Humaine, INSERM U.396, Centre G. Hayem, Hôpital Saint-Louis, 1, Av Claude Vellefaux, 75475, Paris Cedex 10, France.
   The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

    ACKNOWLEDGMENT

The authors thank Dr M. Busson for help in the statistical analysis and Drs P. Kourilsky and D. Przepiorka for critical reading of the manuscript.

    REFERENCES
Abstract
Introduction
Methods
Results
Discussion
References

1. Wagner JE, Kernan NA, Steinbuch M, Broxmeyer HE, Gluckman E: Allogeneic sibling umbilical-cord-blood transplantation in children with malignant and non-malignant disease. Lancet 346:214, 1995[Medline] [Order article via Infotrieve]

2. Kurtzberg J, Laughlin M, Graham ML, Smith C, Olson JF, Halperin EC, Ciocci G, Carrier C, Stevens CE, Rubinstein P: Placental blood as a source of hematopoietic stem cells for transplantation into unrelated recipients. N Engl J Med 335:157, 1996[Abstract/Free Full Text]

3. Wagner JE, Rosenthal J, Sweetman R, Shu XO, Davies SM, Ramsay NKC, McGlave PB, Sender L, Cairo MS: Successful transplantation of HLA-matched and HLA-mismatched umbilical cord blood from unrelated donors: Analysis of engraftment and acute graft-versus-host disease. Blood 88:795, 1996[Abstract/Free Full Text]

4. Gluckman E, Rocha V, Boyer Chammard A, Locatelli F, Arcese W, Souillet G, for Eurocord Transplant Group: Results of cord blood transplants in Europe. Blood 88:485a, 1996 (abstr)

5. Harris DT, Schumacher MJ, Locascio J, Besencon FJ, Olson GB, DeLuca D, Shenker L, Bard J, Boyse EA: Phenotypic and functional immaturity of human umbilical cord blood T lymphocytes. Proc Natl Acad Sci USA 89:10006, 1992[Abstract/Free Full Text]

6. Garban F, Ericson M, Roucard C, Rabian-Herzog C, Teisserenc H, Sauvanet E, Charron D, Mooney N: Detection of empty HLA class II molecules on cord blood B cells. Blood 87:3970, 1996[Abstract/Free Full Text]

7. Ridson G, Gaddy J, Horie M, Broxmeyer HE: Alloantigen priming induces a state of unresponsiveness in human umbilical cord blood T cells. Proc Natl Acad Sci USA 92:2413, 1995[Abstract/Free Full Text]

8. Takahashi N, Imanishi K, Nishida H, Uchiyama T: Evidence for immunologic immaturity of cord blood T cells. Cord blood T cells are susceptible to tolerance induction to in vitro stimulation with a superantigen. J Immunol 155:5213, 1995[Abstract]

9. Harris DT, LoCascio J, Besencon FJ: Analysis of the alloreactive capacity of human umbilical cord blood: Implications for graft-versus-host disease. Bone Marrow Transplant 14:545, 1994

10. Morita CT, Parker CM, Brenner MB, Band H: TCR usage and functional capabilities of human gamma delta T cells at birth. J Immunol 153:3979, 1994[Abstract]

11. Wei S, Charmley P, Robinson MA, Concannon P: The extent of the human germline T-cell receptor V beta gene segment repertoire. Immunogenetics 40:27, 1994[Medline] [Order article via Infotrieve]

12. LaRocque R, Robinson MA: Diversity in the human T cell receptor beta chain. Hum Immunol 48:3, 1996[Medline] [Order article via Infotrieve]

13. Garcia KC, Degano M, Stanfield RL, Brunmark A, Jackson MR, Peterson PA, Teyton L, Wilson IA: An alpha beta T cell receptor structure at 2.5 A and its orientation in the TCR-MHC complex. Science 274:209, 1996[Abstract/Free Full Text]

14. Panzara MA, Oksenberg JR, Steinman L: The polymerase chain reaction for detection of T cell antigen receptor expression. Curr Opin Immunol 4:205, 1992[Medline] [Order article via Infotrieve]

15. Genevee C, Farace F, Chung V, Diu A, Raffoux C, Charron D, Hercend T, Triebel F: Influence of Human Leukocyte Antigen genes on TCR V gene segment frequencies. Int Immunol 6:1497, 1994[Abstract/Free Full Text]

16. Pannetier C, Cochet M, Darche S, Casrouge A, Zöller M, Kourilsky P: The sizes of the CDR3 hypervariable regions of the murine T-cell receptor beta chains vary as a function of the recombined germ-line segment. Proc Natl Acad Sci USA 90:4319, 1993[Abstract/Free Full Text]

17. Even J, Lim A, Puisieux I, Ferradini L, Dietrich PY, Toubert A, Hercend T, Triebel F, Pannetier C, Kourilsky P: T-cell repertoires in healthy and diseased human tissues analysed by T-cell receptor beta -chain size determination: Evidence for oligoclonal expansions in tumours and inflammatory diseases. Res Immunol 146:65, 1995[Medline] [Order article via Infotrieve]

18. Chomczynski P, Saachi N: Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156, 1987[Medline] [Order article via Infotrieve]

19. Puisieux I, Even J, Pannetier C, Jotereau F, Favrot M, Kourilsky P: Oligoclonality of tumor-infiltrating lymphocytes from human melanomas. J Immunol 153:2807, 1994[Abstract]

20. Currier JR, Yassai M, Robinson MA, Gorski J: Molecular defects in TCRBV genes preclude thymic selection and limit the expressed TCR repertoire. J Immunol 157:170, 1996[Abstract]

21. Boumsell L: T-cell antigen report, in Schlossman SF, Boumsell L, Gilks W, Harlan JM, Kishimoto T, Morimoto C, Ritz J, Shaw S, Silverstein R, Springer T, Tedder T, Todd R (eds): Leucocyte Typing V. Proceedings of the Fifth International Workshop. Oxford, Great Britain, Oxford University Press, 1995

22. Cochet M, Pannetier C, Regnault A, Darche S, Leclerc C, Kourilsky P: Molecular detection and in vivo analysis of the specific T cell response to a protein antigen. Eur J Immunol 22:2639, 1992[Medline] [Order article via Infotrieve]

23. Schwab R, Szabo P, Manavalan JS, Weksler ME, Posnett DN, Pannetier C, Kourilsky P, Even J: Expanded CD4+ and CD8+ T cell clones in elderly humans. J Immunol 158:4493, 1997[Abstract]

24. Hingorani R, Choi IH, Akolkar P, Gulwani-Akolkar B, Pergolizzi R, Silver J, Gregersen PK: Clonal predominance of T cell receptors within the CD8+ CD45RO+ subset in normal human subjects. J Immunol 151:5762, 1993[Abstract]

25. Raaphorst FM, Kaijzel EL, van Tol MJD, Vossen JM, van den Elsen PJ: Non-random employment of Vbeta 6 and Jbeta gene elements and conserved amino acid usage profiles in CDR3 regions of human fetal and adult TCR beta chain rearrangements. Int Immunol 6:1, 1993[Abstract/Free Full Text]

26. Quiros Roldan E, Sottini A, Bettinardi A, Albertini A, Imberti L, Primi D: Different TCRBV genes generate biased patterns of V-D-J diversity in human T cells. Immunogenetics 41:91, 1995[Medline] [Order article via Infotrieve]

27. Kappler J, Kotzin B, Herron L, Gelfand EW, Bigler RD, Boylston A, Carrel S, Posnett DN, Choi Y, Marrack P: V beta-specific stimulation of human T cells by staphylococcal toxins. Science 224:811, 1989

28. Bofill M, Akbar AN, Salmon M, Robinson M, Burford G, Janossy G: Immature CD45RAlowROlow T cells in the human cord blood. J Immunol 152:5613, 1994[Abstract]

29. Newton DW, Dohlsten M, Olsson C, Segren S, Lundin KEA, Lando PA, Kalland T, Kotb M: Mutations in the MHC class II binding domains of staphylococcal enterotoxin A differentially affect T cell receptor Vbeta specificity. J Immunol 157:3988, 1996[Abstract]

30. Rosenberg WMC, Moss PAH, Bell JI: Variation in human T cell receptor Vbeta and Jbeta repertoire: Analysis using anchor polymerase chain reaction. Eur J Immunol 22:541, 1992[Medline] [Order article via Infotrieve]

31. Rieux-Laucat F, LeDeist F, Selz F, Fischer A, de Villartay JP: Normal T cell receptor Vbeta usage in a primary immunodeficiency associated with HLA class II deficiency. Eur J Immunol 23:928, 1993[Medline] [Order article via Infotrieve]

32. Robinson MA: Usage of human T cell receptor Vbeta , Jbeta , Cbeta , and Valpha gene segments is not proportional to gene number. Hum Immunol 35:60, 1992[Medline] [Order article via Infotrieve]

33. Donahue JP, Ricalton NS, Behrendt CE, Ritterhaus C, Calaman S, Marrack P, Kappler JW, Kotzin BL: Genetic analysis of low Vbeta 3 expression in humans. J Exp Med 179:1701, 1994[Abstract/Free Full Text]

34. George JF, Schroeder HW: Developmental regulation of Dbeta reading frame and junctional diversity in T cell receptor-beta transcripts from human thymus. J Immunol 148:1230, 1992[Abstract]

35. Raaphorst FM, van Bergen J, Langlois van den Bergh R, van der Keur M, de Krijger R, Bruining J, van Tol JD, Vossen JM, van den Elsen P: Usage of TCRAV and TCRBV gene families in human fetal and adult TCR rearrangements. Immunogenetics 39:343, 1994[Medline] [Order article via Infotrieve]

36. Moss PAH, Bell JI: Sequence analysis of the human alpha beta T-cell receptor CDR3 region. Immunogenetics 42:10, 1995[Medline] [Order article via Infotrieve]

37. Mortari F, Wang JY, Schroeder HW: Human cord blood antibody repertoire. Mixed population of Vh gene segments and CDR3 distribution in the expressed Calpha and Cgamma repertoires. J Immunol 150:1348, 1993[Abstract]

38. Currier JR, Deulofeut H, Barron KS, Kehn PJ, Robinson MA: Mitogens, superantigens and nominal antigens elicit distinctive patterns of TCRB CDR3 diversity. Hum Immunol 48:39, 1996[Medline] [Order article via Infotrieve]

39. Hudson KR, Robinson H, Fraser JD: Two adjacent residues in staphylococcal enterotoxins A and E determine T cell receptor Vbeta specificity. J Exp Med 177:175, 1993[Abstract/Free Full Text]

40. Dietrich PY, Caignard A, Lim A, Chung V, Pico J, Pannetier C, Kourilsky P, Hercend T, Even J, Triebel F: In vivo T-cell clonal amplification at time of acute graft-versus-host disease. Blood 84:2815, 1994[Abstract/Free Full Text]

41. Gaschet J, Lim A, Liem L, Vivien R, Hallet MM, Harousseau JL, Even J, Goulmy E, Bonneville M, Milpied N, Vie H: Acute graft versus host disease due to T lymphocytes recognizing a single HLA-DPB1*0501 mismatch. J Clin Invest 98:100, 1996[Medline] [Order article via Infotrieve]

42. Roux E, Helg C, Dumont-Girard F, Chapuis B, Jeannet M, Roosnek E: Analysis of T-cell repopulation after allogeneic bone marrow transplantation: Significant differences between recipients of T-cell depleted and unmanipulated grafts. Blood 87:3984, 1996[Abstract/Free Full Text]

43. Liu X, Chesnokova V, Forman SJ, Diamond DJ: Molecular analysis of T-cell receptor repertoire in bone marrow transplant recipients: Evidence for oligoclonal T-cell expansion in graft-versus-host disease lesions. Blood 87:3032, 1996[Abstract/Free Full Text]

44. Gorski J, Yassai M, Zhu X, Kissella B, Keever C, Flomenberg N: Circulating T cell repertoire complexity in normal individuals and bone marrow recipients analyzed by CDR3 size spectratyping. J Immunol 152:5109, 1994[Abstract]


© 1998 by The American Society of Hematology.
 
0006-4971/98/91-0033$3.00/0

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
NeoReviewsHome page
D. A. Randolph
The Neonatal Adaptive Immune System
NeoReviews, October 1, 2005; 6(10): e454 - e462.
[Full Text] [PDF]


Home page
J. Immunol.Home page
A. Zippelius, G. Bioley, F.-A. Le Gal, N. Rufer, M. Brandes, P. Batard, M. De Smedt, J. Plum, D. E. Speiser, J.-C. Cerottini, et al.
Human Thymus Exports Naive CD8 T Cells That Can Home to Nonlymphoid Tissues
J. Immunol., March 1, 2004; 172(5): 2773 - 2777.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
P. Jullien, R. Q. Cron, K. Dabbagh, A. Cleary, L. Chen, P. Tran, P. Stepick-Biek, and D. B. Lewis
Decreased CD154 expression by neonatal CD4+ T cells is due to limitations in both proximal and distal events of T cell activation
Int. Immunol., December 1, 2003; 15(12): 1461 - 1472.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
M. Salio, N. Dulphy, J. Renneson, M. Herbert, A. McMichael, A. Marchant, and V. Cerundolo
Efficient priming of antigen-specific cytotoxic T lymphocytes by human cord blood dendritic cells
Int. Immunol., October 1, 2003; 15(10): 1265 - 1273.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. S. Grewal, J. N. Barker, S. M. Davies, and J. E. Wagner
Unrelated donor hematopoietic cell transplantation: marrow or umbilical cord blood?
Blood, June 1, 2003; 101(11): 4233 - 4244.
[Full Text] [PDF]


Home page
BloodHome page
E. Hermann, C. Truyens, C. Alonso-Vega, J. Even, P. Rodriguez, A. Berthe, E. Gonzalez-Merino, F. Torrico, and Y. Carlier
Human fetuses are able to mount an adultlike CD8 T-cell response
Blood, August 28, 2002; 100(6): 2153 - 2158.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Talvensaari, E. Clave, C. Douay, C. Rabian, L. Garderet, M. Busson, F. Garnier, D. Douek, E. Gluckman, D. Charron, et al.
A broad T-cell repertoire diversity and an efficient thymic function indicate a favorable long-term immune reconstitution after cord blood stem cell transplantation