|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 10 (May 15), 1998:
pp. 3574-3581
Genetic Polymorphisms in the Tumor Necrosis Factor Locus Influence
Non-Hodgkin's Lymphoma Outcome
By
Krzysztof Warzocha,
Patricia Ribeiro,
Jacques Bienvenu,
Pascal Roy,
Carole Charlot,
Dominique Rigal,
Bertrand Coiffier, and
Gilles Salles
From the Department of Hématologie, Laboratoire d'Immunologie
and Unité de Méthodologie en Cancérologie,
Université Claude Bernard (UPRES-JE 1879), and the Centre
Hospitalier Lyon-Sud, Hospices Civils de Lyon, Pierre-Bénite,
France; and the Etablissement de Transfusion Sanguine, Lyon, France.
 |
ABSTRACT |
Systemic release of tumor necrosis factor (TNF) and lymphotoxin-
(LT) has been found to contribute to the severity of non-Hodgkin's lymphoma (NHL). We investigated whether genetic polymorphisms in the
TNF locus, previously shown to influence TNF and LT genes expression, might contribute to these cytokines production and to the
clinical course of NHL. Genomic DNA from 273 lymphoma patients was
typed for TNF ( 308) polymorphism using an allele-specific polymerase
chain reaction (PCR) and for LT (+252) polymorphism with a
PCR-based restriction fragment length polymorphism. The presence of the
TNF allele involved in increased TNF gene transcription was associated
with higher plasma levels of this cytokine at the time of lymphoma
diagnosis ( 2 test, P = .013). An extended
haplotype analysis showed that the presence of at least two TNF or
LT high-producer alleles constituted a risk factor for first-line
treatment failure (2 test, P = .021), shorter
progression-free survival (log-rank test, P = .0007), and
overall survival (log-rank test, P = .012). In the subgroup
of 126 patients with diffuse large-cell lymphoma, the presence of two
or more TNF/LT high producing alleles contributed significantly to a
higher rate of relapse and progression (log-rank test, P = .045 and P = .027). In multivariate Cox regression models including the variables of the International Prognostic Index, the
TNF/LT haplotype status was found to be an independent risk factor
for progression-free survival (relative risk 2.33, 95% confidence
interval [1.17 to 4.64], P = .0053) and overall survival (relative risk 1.92, 95% confidence interval [0.63 to 5.80],
P = .081) of large-cell lymphoma patients. These results
indicate that genetic polymorphism leading to increased TNF production influences the outcome of NHL and suggest a pathophysiological role for
the genetic control of the immune response in lymphoid malignancies.
| |
INTRODUCTION |
TUMOR NECROSIS FACTOR (TNF) and
lymphotoxin- (LT) (formerly known as TNF- ) have been
identified to play an important role in the development and in the
function of normal lymphoid tissue.1-3 TNF is also known to
be one of the earliest cytokine produced in inflammatory processes,
generating a cytokine cascade that includes the production of
interleukin-1, interleukin-6, and other mediators, as well as TNF
itself.4,5 It has also been shown that patients with
malignant lymphomas have high circulating levels of both cytokines and
that higher plasma levels of TNF are associated with poor disease
outcome.6,7 Several studies showed that excessive TNF
production may influence the host status, including weight loss,
cachexia, modification of the immune response, and anemia, therefore
hampering the patient ability to tolerate his tumor and his treatment;
other experimental data indicate that TNF may promote the growth of
certain lymphoid cells.6-10
The TNF and LT genes lie within a 7-kb DNA locus in the class III
region of the major histocompatibility complex, telomeric to the class
II and centromeric to the class I region. Until now, four polymorphic
sites in the promoter of TNF gene and one polymorphic site within the
first intron of LT gene have been described.11-14 A
polymorphism that directly affects TNF expression in vitro was located
at nucleotide position 308. This genetic variation results in
two allelic forms, in which the presence of guanine (G) defines the
common variant TNF1 and the presence of adenine (A) defines the less
common variant TNF2.11 Interestingly, the presence of TNF1
allele defines a 10-bp sequence homologous to the consensus binding
site of activator protein-2 (AP-2), which is disrupted in the TNF2
variant.15 Functional assays demonstrated that AP-2 can
repress the activity of the TNF promoter in Jurkat T-cell line,
suggesting that the 308 polymorphism influences the TNF gene
expression.16 Transfection studies in human B-cell lines showed that the presence of TNF2 allele results in higher constitutive and inducible levels of TNF expression compared with TNF1 allele, confirming the importance of this site in the transcriptional regulation of the TNF gene.17
A polymorphism that affects LT expression was found in the first
intron of the gene at nucleotide position +252.14 Because this genetic variation results in the disappearance of a Nco I restriction site by replacing A by G, both allelic forms are referred to, respectively, as LT (5.5 kB) and LT (10.5 kB). This LT +252 polymorphism, conserved in both human and mice, is located within
a phorbol ester-responsive DNA element (TRE) with high affinity for the
AP-1, jun, and c-fos heterodimer transcription factor family. The
presence of LT (5.5 kB) allele was shown to result in significantly
higher LT production by phytohemagglutinin-stimulated peripheral
blood mononuclear cells due to increased LT gene
transcription.14
Several studies have demonstrated the linkage disequilibrium between
both TNF (308) and LT (+252) polymorphic sites and with other
allelic markers within the cluster of HLA gene.11,12,18 Both TNF2 and LT (5.5 kB) high-producer alleles are linked with the
extended haplotype HLA A1-B8-DR3-DQ2, which was found to be associated
with autoimmunity and rapid progression of HIV
infection.11,18,19 In patients with infectious and
autoimmune disorders, different studies reported a higher frequency of
the TNF2 allele in cases with severe disease, suggesting that genetic
variations within the TNF locus may be functionally relevant in
vivo.20-23
In the present study, we report that the genetic background inducing
increased TNF production influences treatment outcome, progression-free
survival, and overall survival of non-Hodgkin's lymphoma (NHL)
patients. These findings emphasize the contribution of innate immunity
in the pathophysiology of malignant disorders.
| |
MATERIALS AND METHODS |
Subjects.
The study comprised 273 patients with NHL and 96 unrelated healthy
controls who provided samples available for genetic analysis after
informed consent. Patients positive for human immunodeficiency virus
(HIV) testing were excluded from this study. The plasma of 85 of these
patients, without active infections and without any history of
autoimmune disease or steroid treatment, was tested at the time of
lymphoma diagnosis for TNF and LT levels (Medgenix Diagnostics
[Fleurus, Belgium] and R & D Systems [Minneapolis, MN],
respectively). All the specimens used in the study were coded, and the
patients' confidentiality was preserved according to the guidelines
for studies of human subjects.
Pathological confirmation of the diagnosis and clinical history were
available in every case. Histological diagnoses were classified
according to the International Lymphoma Study Group (Revised European
American Lymphoma classification).24 The initial medical
evaluation consisted of a complete history and physical examination;
chest radiographic examination; computed tomographic scan of the chest,
abdomen, and pelvis; and blood chemistry. The extent of disease and
presence of B symptoms were categorized according to the Ann Arbor
classification, and performance status was assessed using criteria of
the Eastern Cooperative Oncology Group (ECOG). Clinical characteristics
of the patients are shown in Table 1.
Treatment.
Therapeutic attitudes were defined according to the initial
histological subtypes and prognostic factors. Among the 126 patients with diffuse large-cell lymphoma, 53 received CHOP (cyclophosphamide, doxorubicin, vincristin, prednisone) or CHOP-like regimen, 66 received
ACVBP (doxorubicin, cyclophosphamide, vindesine, bleomycin, prednisone,
intrathecal metrotexate) or ACVBP-like high-dose regimen, and 7 older
patients received multiple drug combination chemotherapy without
anthracyclin. All patients were treated according to prospective trials, except for 3 that were referred to the department at the time
of their first progression. A complete treatment response was defined
as the disappearance of all disease manifestations and normalization of
all laboratory values. Progression-free survival was calculated from
onset of treatment until relapse, disease progression, or last
follow-up evaluation. Freedom from relapse survival was equal to
progression-free survival for patients that achieved a complete
remission after their first-line treatment. Overall survival was
measured as the time between the beginning of treatment and death or
the date of the last follow-up evaluation.
Genotyping analysis.
Genomic DNA from peripheral blood mononuclear cells or lymph nodes was
extracted with the QIAmp kit (QIAGEN Inc, Chatsworth, CA) or by the
standard phenol-chloroform method. The primer pairs F1
(5 TCTCGGTTTCTTCTCCATCG) and R1 (5
ATAGGTTTTGAGGGGCATGG) and F1-R2
(5ATAGGTTTTGAGGGGCATGA) were used to amplify a 184-bp fragment of the TNF gene, which includes the polymorphic site at the nucleotide position 308. Each sample was tested with both primers pairs (F1-R1 and F1-R2).
Primer pair F1-R3
(5GAGTCTCCGGGTCAGAATGA) was used to amplify a TNF gene's
fragment of 531 bp as an internal control in the allele-specific
polymerase chain reaction (ASPCR) and as a genomic DNA template for
sequencing. Primer R3 was also used as a competitor for the
primer pairs F1-R1 and
F1-R2 to improve the specificity of the ASPCR
assay25 (Fig 1A). After heating at 95°C for 10 minutes, PCR reactions were performed for 31 cycles consisting of heat denaturation (95°C for 90 seconds), annealing for 150 seconds (62°C for primer pair F1-R1
and 60°C for primer pair F1-R2 ), and
extension (72°C for 60 seconds).
View larger version (28K):
[in this window]
[in a new window]
| Fig 1.
Identification of the TNF (308) gene polymorphism with
ASPCR (A) and LT (+252) gene polymorphism with PCR-RFLP (B).
Genotypes were identified as homozygous, TNF1/1 or TNF2/2 if the single 184-bp fragment appeared exclusively in the
F1-R1 or F1-R2 primer sets' reactions (A, lanes 1 and 2 and 3 and 4, respectively). Genotypes were identified as heterozygous, TNF1/2, if the 184-bp fragment appeared in both F1-R1 and
F1-R2 primer sets' reactions (A, lanes 5 and
6). The 531-bp fragment, amplified with F1-R3 primers, served as an internal control and competitor for the ASPCR.
Lanes 1 through 3 on the (B) show the LT (+252) polymorphic genotypes. The 368-bp fragment cleaved with Nco I (133- and
235-bp fragments) represented the LT (5.5) allele, and that not
cleaved represented the LT (10.5) allele. Genotypes were identified
as homozygous for LT (10.5/10.5) if the single 368-bp fragment
appeared (B, lane 1) and homozygous for LT (5.5/5.5) if two 133- and
235-bp fragments were present (B, lane 2). The presence of noncleaved (368 bp) and cleaved fragments (133 and 235 bp) in the same sample identified the heterozygous genotype, LT (10.5/5.5) (B, lane 3).
|
|
A substitution of A to G at the nucleotide position +252 of LT gene
creates a Nco I restriction fragment length polymorphism (RFLP). With a PCR-based RFLP assay, DNA samples were analyzed for
Nco I restriction site that is present in the LT (5.5 kB) allele but not in the LT (10.5 kB) allele. PCR-amplified products of
368 bp were obtained with the use of forward
(5CTCCTGCACCTGCTGCCTGGATC) and reverse
(5GAAGAGACGTTCAGGTGGTGTCAT) primers. After heating at 95°C
for 10 minutes, PCR reactions were performed for 31 cycles consisting
of heat denaturation (96°C for 60 seconds), annealing (65°C for
60 seconds), and extension (72°C for 120 seconds). Then, PCR-amplified products were directly digested with 3 U of restriction enzyme. The band cleaved with Nco I (133- and 235-bp fragments) represented the LT (5.5 kB) allele, and the noncleaved (368 bp) band
represented the LT (10.5 kB) allele (Fig 1B).
To confirm the accuracy of the ASPCR and PCR-RFLP assays, amplification
products from 3 individuals homozygous for each given allele (n = 12 in
total) were purified from the gel, ligated into pGEM-T vector (Promega,
Madison, WI) and subcloned. Recombinant plasmid DNAs were sequenced
using Sequenase (Amersham, Braunchweig, Germany) with Cy5-labeled
primers and analyzed on an automated laser fluorescent sequencer
(ALF-Express; Pharmacia Biotech, Uppsala, Sweden).
Reproducibility of genotyping was obtained in every case.
Statistical analysis.
Distribution and allele frequency and their associations with other
variables were compared using the Yates corrected 2
test. The progression-free survival and overall survival of the patients were estimated by the Kaplan-Meier method, and statistical differences were assessed using the log-rank test. Multivariate regression analysis using the Cox model was performed to assess the
influence of TNF/LT polymorphic haplotype status on lymphoma outcome
along with prognostic variables validated by the International Prognostic Index.26 Statistical tests with a P
value smaller than 5% were considered significant in the whole
population. Statistical analysis were performed using the BMDP package
(Statistical Software, Los Angeles, CA).
| |
RESULTS |
Distribution and allele frequency of TNF(308) and LT (+252)
polymorphisms.
Distribution and allele frequency of TNF (308) and LT (+252)
polymorphisms among the 273 lymphoma patients were similar to those
observed in healthy controls (Table 2). In
both populations, an expected association was found between the
presence of allele TNF1 with LT (10.5) and allele TNF2 with LT
(5.5) (2 test, P < .0001). This translated into a
strong genotype association between the TNF1/1 and LT (10.5/10.5),
TNF1/2 and LT (10.5/5.5), and TNF2/2 with LT (5.5/5.5) haplotypes
(not shown).
View this table:
[in this window]
[in a new window]
|
Table 2.
Distribution and Allele Frequency of TNF (308) and
LT (+252) Polymorphisms Among 96 Healthy Controls and 273 Patients
With NHL, Including 85 Patients With Available Cytokines' Plasma
Levels at the Time of Diagnosis
|
|
When analysis was restricted to the 85 lymphoma patients available for
both enzyme-linked immunosorbent assay (ELISA) and genotyping assays at
the time of diagnosis, the frequency of allele TNF2 was found to be
higher among the patients with TNF higher plasma levels than the median
value compared with those with TNF plasma levels below this limit (0.17 v 0.06, 2 test, P = .013). Frequency of
allele LT (5.5) was also found to be higher in patients with TNF
higher levels (not shown, P = .037). No association was found
between the allelic frequency within LT (+252) polymorphism or TNF
(308) and LT initial plasma levels in lymphoma patients
(Table 2).
TNF/LT polymorphic haplotype status in lymphoma patients.
The strong association between TNF (308) and LT (+252)
polymorphic alleles and the possible contribution of both polymorphic sites in increased production of TNF led us to analyze these genetic markers as haplotypes rather than as individual alleles in a predictive model for the patients' outcome. The low-risk haplotype denoted therefore the presence of less than two alleles associated with increased TNF or LT production, including the haplotypes typed as TNF1/1 and LT (10.5/10.5), TNF1/1 and LT (5.5/10.5), or
TNF1/2 and LT (10.5/10.5). The high-risk haplotype denoted the
presence of two or more alleles associated with increased cytokines'
production, including haplotypes typed as TNF1/2 and LT (5.5/10.5),
TNF1/1 and LT (5.5/5.5), TNF2/2 and LT (10.5/10.5), TNF1/2 and
LT (5.5/5.5), TNF2/2 and LT (5.5/10.5), or TNF2/2 and LT
(5.5/5.5).
The differences in the frequency of the TNF/LT polymorphic extended
haplotypes between the case and the control group were not
statistically significant (not shown). No statistically significant association was found between the presence of a given TNF/LT haplotype status and prognostic variables such as age, performance status, disease stage, B symptoms, the number of extranodal sites of
disease, serum levels of lactate dehydrogenase (LDH),
albumin, and 2-microglobulin or with the categories of the
international prognostic index (not shown).
Although there were no statistically significant differences in TNF
haplotype distribution when all lymphoma histological subtypes were
considered, there were less patients with follicular lymphoma carrying
the high-risk haplotype (19% high-risk v 81% low-risk) when
compared with all other histology (31% high-risk v 69%
low-risk; 2 test, P = .02) or to the large-cell
lymphoma subgroup (33% high-risk v 67% low-risk; P = .023). Haplotype distribution in the large-cell lymphoma subgroup was
not different from the remaining patients with other subtypes than
follicular lymphoma (P = .9) or with the group of healthy
controls (69% v 31%, P = .75).
Outcome of lymphoma patients according to the risk groups defined by
TNF/LT polymorphic haplotype status.
Among 273 NHL patients, 161 (61%) achieved a complete response to
treatment, whereas 103 (39%) did not. Nine patients were not yet
available for therapy response. Of 273 patients, 153 (56%) patients
have experienced disease progression, whereas 120 (44%) have not, and
87 (32%) patients died. The median follow-up for the patients
remaining alive was 28 months.
The patients carrying low-risk haplotype achieved a complete response
to first-line therapy more frequently than the patients with high-risk
haplotype (66% v 49%; 2 test, P = .021). The estimated 2-year and 4-year progression-free survival rates
in the high-risk and low-risk groups were, respectively, 46% and 23%
versus 62% and 43% (log-rank test, P = .0007;
Table 3 and Fig
2A). The estimated 2-year and 4-year overall survival rates in the
groups of patients carrying high-risk and low-risk haplotypes were,
respectively, 74% and 59% versus 83% and 72% (log-rank test,
P = .012; Table 3 and Fig 2B). A higher rate of relapse from
complete remission was also observed in patients with the high-risk
haplotype (log-rank test, P = .027).
View larger version (16K):
[in this window]
[in a new window]
View larger version (15K):
[in this window]
[in a new window]
| Fig 2.
Progression-free survival (A) and overall survival (B) of
273 NHL patients according to the risk groups defined by TNF (308) and LT (+252) polymorphic haplotype status. The initial number of
patients at risk for disease progression or death was 197 for the
low-risk haplotype and 76 for the high-risk haplotype. The number of
patients remaining at risk is shown below each time point. P
denotes the log-rank test value.
|
|
Prognostic significance of TNF/LT polymorphism according to
histological subtypes.
Because large-cell lymphoma and follicular lymphoma patients
represented the largest homogeneous categories of patients, we determined the effects of TNF/LT haplotype status on lymphoma outcome in these two patients' subgroups.
Diffuse large-cell lymphoma patients carrying the high-risk haplotype
achieved complete remission after first-line treatment in 61% of the
cases versus 74% for those carrying the low-risk haplotype, a
difference that was not statistically significant (P = .22).
Progression-free survival was significantly shorter in diffuse
large-cell lymphoma patients (Table 3 and
Fig 3A) carrying the high-risk versus
low-risk haplotype (log-rank test, P = .027), but no
statistical difference in overall survival was observed (Table 3,
P = .27). Of note, patients with the high-risk haplotype also
relapsed more frequently from complete remission (log-rank test,
P = .045). To evaluate the importance of TNF/LT haplotype
status on lymphoma outcome, a multivariate regression analysis was
performed in this subgroup of 126 patients. The Cox model was tested by
introducing the TNF/LT haplotype status along with prognostic
variables of the International Prognostic Index, ie, age ( 60 years of
age v older), disease stage (I/II v III/IV), performance status (0 or 1 v 2 or more), serum LDH level
(normal v abnormal), and number of extranodal sites of disease
(0 or 1 v 2 or more). The TNF/LT polymorphic haplotype
status was found to be an independent risk factor for both
progression-free survival (relative risk 2.33, 95% confidence interval
[1.17 to 4.64], P = .0053; global 2 = 23.33, P < .0001) and overall survival (relative risk 1.92, 95%
confidence interval [0.63 to 5.80], P = .081; global
2 = 32.52, P < .0001).
View larger version (14K):
[in this window]
[in a new window]
View larger version (14K):
[in this window]
[in a new window]
| Fig 3.
Progression-free survival of 126 patients with diffuse
large-cell (A) and 96 patients with follicular (B) lymphoma according to the risk groups defined by TNF (308) and LT (+252)
polymorphic haplotype status. The initial number of patients at risk
for disease progression with diffuse large-cell lymphoma and carrying
low-risk haplotype was 84, whereas the number of those with high-risk
haplotype was 42. The initial number of patients at risk for disease
progression with follicular lymphoma and carrying low-risk haplotype
was 78, whereas the number of those with high-risk haplotype was 18. The number of patients remaining at risk is shown below each time point. P denotes the log-rank test value.
|
|
In follicular lymphoma patients, there were no significant differences
in terms of complete response rate (P = .13), progression-free survival (P = .218; Fig 3B), and overall survival (P = .40) according to the TNF/LT haplotype status.
| |
DISCUSSION |
We found that in lymphoma patients the presence of the rare TNF2 allele
involved in increased TNF gene transcription was associated with higher
TNF plasma levels at the time of diagnosis and that the presence of at
least two TNF or LT high-producer alleles constituted an independent
risk factor for first-line treatment failure, shorter progression-free
survival, and overall survival of the patients. These findings were
more significant in the larger subgroup of patients presenting diffuse
large-cell lymphoma. In patients with other histological subgroups,
this high-risk haplotype was not significantly associated with an
adverse outcome, although these observations could be limited by the
lower number of patients analyzed.
TNF (308) and LT (+252) allelic frequencies and genotype
distributions in the present cohort of healthy individuals were similar
to those previously reported in different ethnical
groups.20,27-29 Because they were also similar in NHL
patients, it is unlikely that polymorphic variations in the TNF locus
increase the susceptibility for lymphoma occurrence. The presence of
two alleles associated with increased TNF production seemed to be less
frequently found in follicular lymphoma patients than in other patients
or control individuals. Whether follicular lymphoma may develop in a
population of patients with this particular genotype in which high-risk
alleles are less represented needs to be investigated in larger
epidemiological studies.
The results of the present study and those described previously
demonstrating increased plasma levels of TNF and LT in a subset of
lymphoma patients with adverse outcome indicate that their excessive
production influence the clinical course of the disease.6,7
The higher frequency of TNF2 allele in NHL patients with elevated
plasma levels of TNF as well as the independent prognostic significance
of TNF/LT polymorphic haplotype status suggest that inherited
ability of the host to regulate these cytokines' production
contributes to this phenomenon. However, higher plasma levels of TNF
and LT but not their specific polymorphic alleles were also
associated in previous studies with numerous variables reflecting
increased tumor burden, including high serum values of
2-microglobulin and LDH, advanced disease stage, or large tumor
mass.6,7 This suggests that elevated TNF and LT plasma levels may also originate from their autonomous production by malignant
cells. In addition, TNF and LT activate the transcription factor
NF- B, which, in turn, may further perpetuate their production in an
autocrine fashion. Several factors, including proinflammatory cytokines, chemokines, and adhesion molecules, might modulate this
amplification loop and thus indirectly influence the overall TNF and
LT expression.5 It seems likely therefore that genetic variability in the TNF locus is important, although not the sole factor
that influences TNF and LT production in lymphoma patients.
These data raise some questions regarding how overproduction of TNF and
LT can influence the clinical course of NHL. It is coherent that
individuals who are genetically predisposed to increased TNF and LT
production are at higher risk for chronic immune activation upon tumor
challenge, which further results in the presence of systemic symptoms,
anemia, hypoalbuminemia, cachexia, and poor performance
status.6-9 All of these adverse conditions may affect the
ability of the host to tolerate treatment and consequently preclude
disease's poor outcome. Increased TNF and LT levels could also
impair the efficiency of antitumor cellular immune response.30,31 TNF has been shown in vitro to promote the
differentiation of dendritic cells,2 but its excessive
production may hamper their ability for effective antigen
presentation.32,33 It has also been demonstrated that
increased endogenous TNF production by tumor cells could contribute to
the chemotherapeutic drug resistance.34 Finally, TNF and
LT were also shown in some models to stimulate the growth of
malignant B cells.10,35 All of these biological observations can contribute to our findings that inherited
susceptibility to excessive TNF production increases the risk for
lymphoma patients to fail achieving a complete remission and to relapse
after remission. However, it is also possible that TNF/LT haplotype,
which is linked to other extended haplotypes such as the HLA
A1/2-B8-DR3-DQ2 alleles associated with autoimmunity and HIV disease
progression,11,19 is in linkage desequilibrium with other
genes that can influence lymphoma outcome. Other studies regarding the
influence of TNF polymorphism on the clinical course of autoimmune or
infectious diseases have also reported controversial
results,20-23,36-39 indicating that a single polymorphism
in a given gene cannot probably account for the variability of
disease's course.
In conclusion, this report indicates that genetic susceptibility to
increased TNF production contributes to the clinical course of
malignant lymphomas. Both TNF (308) and LT (+252) polymorphic markers may be considered as candidates to design new prognostic models
for NHL based on biological factors.40 They may also be
helpful in selecting the patients for whom new treatment approaches, especially those based on immunomodulation41 or TNF
inhibitors,42,43 could be advised.
| |
FOOTNOTES |
Submitted September 22, 1997;
accepted February 25, 1998.
Supported by the Hospices Civils de Lyon-PHRC (96.044) and by INSERM
(Paris, France). K.W. was supported by a grant founded by the Fondation
de France (Paris) and P.R. by the European Society for Medical Oncology
(ESMO, Lugano).
Address reprint requests to Gilles Salles, MD, PhD, Service
d'Hématologie, Centre Hospitalier Lyon-Sud, 69495 Pierre-Benite Cedex, France; e-mail: gs{at}hematologie.univ-lyon1.fr.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
The authors are indebted to Dr Margaret A. Shipp and Dr Gilbert M. Lenoir for their helpful comments.
| |
REFERENCES |
1.
Eugster HP,
Müller M,
Karrer U,
Car BD,
Schnyder B,
Eng VM,
Woerly G,
Le Hir M,
di Padova F,
Aguet M,
Zinkernagel R,
Bluethmann H,
Ryffel B:
Multiple immune abnormalities in tumor necrosis factor and lymphotoxin- double-deficient mice.
Int Immunol
8:23,
1996[Abstract/Free Full Text]
2.
Le Hir M,
Bluethmann H,
Kosco-Vilbois MH,
Muller M,
di Padova F,
Moore M,
Ryffel B,
Eugster HP:
Differentiation of follicular dendritic cells and full antibody responses require tumor necrosis factor receptor-1 signaling.
J Exp Med
183:2367,
1996[Abstract/Free Full Text]
3.
Pasparakis M,
Alexopoulou L,
Episkopou V,
Kollias G:
Immune and inflammatory responses in TNF-deficient mice: A critical requirement for TNF in the formation of primary B cell follicles, follicular dendritic networks and germinal centers, and in the maturation of the humoral immune response.
J Exp Med
184:1397,
1996[Abstract/Free Full Text]
4.
Bazzoni F,
Beutler B:
The tumor necrosis factor ligand and receptor families.
N Engl J Med
334:1717,
1996[Free Full Text]
5.
Barnes PJ,
Karin M:
Nuclear factor-kappaB: A pivotal transcription factor in chronic inflammatory diseases.
N Engl J Med
336:1066,
1996[Free Full Text]
6.
Salles G,
Bienvenu J,
Bastion Y,
Barbier Y,
Doche C,
Warzocha K,
Gutowski MC,
Rieux C,
Coiffier B:
Elevated circulating levels of TNF and its p55 soluble receptor are associated with an adverse prognosis in lymphoma patients.
Br J Haematol
93:352,
1996[Medline]
[Order article via Infotrieve]
7.
Warzocha K,
Salles G,
Bienvenu J,
Bastion Y,
Dumontet C,
Renard N,
Neidhardt EM,
Coiffier B:
The tumor necrosis factor ligand-receptor system can predict treatment outcome in lymphoma patients.
J Clin Oncol
15:499,
1997[Abstract/Free Full Text]
8.
Cordingley FT,
Hoffbrand AV,
Heslop HE,
Turner M,
Bianchi A,
Reittie JE,
Vyakarnam A,
Meager A,
Brenner MK:
Tumour necrosis factor as an autocrine tumour growth factor for chronic B-cell malignancies.
Lancet
1:969,
1988[Medline]
[Order article via Infotrieve]
9.
Tracey KJ,
Wei H,
Manogue KR,
Fong Y,
Hesse DG,
Nguyen HT,
Kuo GC,
Beutler B,
Cotran RS,
Cerami A:
Cachectin/tumor necrosis factor induces cachexia, anemia, and inflammation.
J Exp Med
167:1211,
1988[Abstract/Free Full Text]
10.
Tracey KJ:
TNF and Mae West or: Death from too much of a good thing.
Lancet
345:75,
1995[Medline]
[Order article via Infotrieve]
11.
Wilson AG,
de Vries N,
Pociot F,
di Giovine FS,
van der Putte LB,
Duff GW:
An allelic polymorphism within the human tumor necrosis factor alpha promoter region is strongly associated with HLA A1, B8, and DR3 alleles.
J Exp Med
177:557,
1993[Abstract/Free Full Text]
12.
Hamann A,
Mantzoros C,
Vidal-Puig A,
Flier JS:
Genetic variability in the TNF- promoter is not associated with type II diabetes mellitus (NIDDM).
Biochem Biophys Res Commun
211:833,
1995[Medline]
[Order article via Infotrieve]
13.
D'Alfonso SD,
Richiardi PM:
A polymorphic variation in a putative regulation box of the TNF promoter region.
Immunogenetics
39:150,
1994[Medline]
[Order article via Infotrieve]
14.
Messer G,
Spengler U,
Jung MC,
Honold G,
Blömer K,
Pape GR,
Riethmüller G,
Weiss EH:
Polymorphic structure of the tumor necrosis factor (TNF) locus: An NcoI polymorphism in the first intron of the human TNF-beta gene correlates with a variant amino acid in position 26 and a reduced level of TNF-beta production.
J Exp Med
173:209,
1991[Abstract/Free Full Text]
15.
Takashiba S,
Shapira L,
Amar S,
Van Dyke TE:
Cloning and characterization of human TNF promoter region.
Gene
131:307,
1993[Medline]
[Order article via Infotrieve]
16.
Kroeger KM,
Abraham LJ:
Identification of an AP-2 element in the 323 to 285 region of the TNF-alpha gene.
Biochem Mol Biol Int
40:43,
1996[Medline]
[Order article via Infotrieve]
17.
Wilson AG,
Symons JA,
McDowell TL,
McDevitt HO,
Duff GW:
Effects of a polymorphism in the human tumor necrosis factor alpha promoter on transcriptional activation.
Proc Natl Acad Sci USA
94:3195,
1997[Abstract/Free Full Text]
18.
Pociot F,
Briant L,
Jongeneel CV,
Molvig J,
Worsaae H,
Abbal M,
Thomsen M,
Nerup J,
Cambon-Thomsen A:
Association of tumor necrosis factor (TNF) and class II major histocompatibility complex alleles with the secretion of TNF-alpha and TNF-beta by human mononuclear cells: A possible link to insulin-dependent diabetes mellitus.
Eur J Immunol
23:224,
1993[Medline]
[Order article via Infotrieve]
19.
Kaslow RA,
Carrington M,
Apple R,
Park L,
Munoz A,
Saah AJ,
Goedert JJ,
Winkler C,
O'Brien SJ,
Rinaldo C,
Detels R,
Blattner W,
Phair J,
Erlich H,
Mann DL:
Influence of combinations of human major histocompatibility complex genes on the course of HIV-1 infection.
Nature Med
2:405,
1996[Medline]
[Order article via Infotrieve]
20.
McGuire W,
Hill AV,
Allsopp CE,
Greenwood BM,
Kwiatkowski D:
Variation in the TNF-alpha promoter region associated with susceptibility to cerebral malaria.
Nature
371:508,
1994[Medline]
[Order article via Infotrieve]
21.
Booy R,
Nadel S,
Hibberd M,
Levin M,
Newport MJ:
Genetic influence on cytokine production in meningococcal disease.
Lancet
349:1176,
1997[Medline]
[Order article via Infotrieve]
22.
Jacob CO,
Fronek Z,
Lewis GD,
Koo M,
Hansen JA,
McDevitt HO:
Heritable major histocompatibility complex class II-associated differences in production of tumor necrosis factor alpha: relevance to genetic predisposition to systemic lupus erythematosus.
Proc Natl Acad Sci USA
87:1233,
1990[Abstract/Free Full Text]
23.
Mulcahy B,
Waldron-Lynch F,
McDermott MF,
Adams C,
Amos CI,
Zhu DK,
Ward RH,
Clegg DO,
Shanahan F,
Molloy MG,
O'Gara F:
Genetic variability in the tumor necrosis factor-lymphotoxin region influences susceptibility to rheumatoid arthritis.
Am J Hum Genet
59:676,
1996[Medline]
[Order article via Infotrieve]
24.
International Lymphoma Study Group:
A revised European-American Classification of lymphoid neoplasms: A proposal from the International Lymphoma Study Group.
Blood
84:1361,
1994[Free Full Text]
25.
Zhu KY,
Clark JM:
Addition of a competitive primer can dramatically improve the specificity of PCR amplification of specific alleles.
Biotechniques
21:586,
1996[Medline]
[Order article via Infotrieve]
26.
The International Non-Hodgkin's Lymphoma Prognostic Factor Project:
A predictive model for aggressive non-Hodgkin's lymphoma.
N Engl J Med
329:987,
1993[Abstract/Free Full Text]
27.
Webb GC,
Chaplin DD:
Genetic variability at the human tumor necrosis factor loci.
J Immunol
145:1278,
1990[Abstract]
28.
Peruccio D,
D'Alfonso S,
Borelli I,
Amoroso A,
Mazzola G,
Marsico D,
Bersanti M,
Richiardi P:
Distribution of tumor necrosis factor alleles (NcoI RFLP) and their relationship to HLA haplotypes in an Italian population.
Hum Hered
43:103,
1993[Medline]
[Order article via Infotrieve]
29.
Bouma G,
Crusius JB,
Oudkerk Pool M,
Kolkman JJ,
von Blomberg BM,
Kostense PJ,
Giphart MJ,
Schreuder GM,
Meuwissen SG,
Pena AS:
Secretion of tumour necrosis factor alpha and lymphotoxin alpha in relation to polymorphism in the TNF genes and HLA-DR alleles. Relevance for inflammatory bowel disease.
Scan J Immunol
43:456,
1996 [Medline]
[Order article via Infotrieve]
30.
Ross ME,
Caligiuri MA:
Cytokine-induced apoptosis of human natural killer cells identifies a novel mechanism to regulate the innate immune response.
Blood
89:910,
1997[Abstract/Free Full Text]
31.
Zheng L,
Fisher G,
Miller RE,
Peschon J,
Lynch DH,
Lenardo MJ:
Induction of apoptosis in mature T cells by tumour necrosis factor.
Nature
377:348,
1995[Medline]
[Order article via Infotrieve]
32.
Sallusto F,
Cella M,
Danieli C,
Lanzavecchia A:
Dendritic cells use macropinocytosis and the mannose receptor to concentrate macromolecules in the major histocompatibility complex class II compartment: Downregulation by cytokines and bacterial products.
J Exp Med
182:389,
1995[Abstract/Free Full Text]
33.
Sallusto F,
Nicolo C,
De Maria R,
Corinti S,
Testi R:
Ceramide inhibits antigen uptake and presentation by dendritic cells.
J Exp Med
184:2411,
1996[Abstract/Free Full Text]
34.
Kobayashi D,
Watanabe N,
Yamauchi N,
Tsuji N,
Sato T,
Niitsu Y:
Endogenous tumor necrosis factor as a predictor of doxorubicin sensitivity in leukemic patients.
Blood
89:2472,
1997[Abstract/Free Full Text]
35.
Trentin L,
Zambello R,
Agostini C,
Siviero F,
Adami F,
Marcolongo R,
Raimondi R,
Chisesi T,
Pizzolo G,
Semenzato G:
Expression and functional role of tumor necrosis factor receptors on leukemic cells from patients with type B chronic lymphoproliferative disorders.
Blood
81:752,
1993[Abstract/Free Full Text]
36.
Rudwaleit M,
Tikly M,
Khamashta M,
Gibson K,
Klinke J,
Hughes G,
Wordsworth P:
Interethnic differences in the association of tumor necrosis factor promoter polymorphisms with systemic lupus erythematosus.
J Rheumatol
23:1725,
1996[Medline]
[Order article via Infotrieve]
37.
Brinkman BM,
Huizinga TW,
Kurban SS,
van der Velde EA,
Schreuder GM,
Hazes JM,
Breedveld FC,
Verweij CL:
Tumour necrosis factor alpha gene polymorphisms in rheumatoid arthritis: Association with susceptibility to, or severity of, disease?
Br J Rheumatol
36:516,
1997[Abstract/Free Full Text]
38.
Mordmuller BG,
Metzger WG,
Juillard P,
Brinkman BM,
Verweij CL,
Grau GE,
Kremsner PG:
Tumor necrosis factor in Plasmodium falciparum malaria: High plasma level is associated with fever, but high production capacity is associated with rapid fever clearance.
Eur Cytokine Netw
8:29,
1997[Medline]
[Order article via Infotrieve]
39.
Brinkman BM,
Keet IP,
Miedema F,
Verweij CL,
Klein MR:
Polymorphisms within the human tumor necrosis factor-alpha promoter region in human immunodeficiency virus type 1-seropositive persons.
J Infect Dis
175:188,
1997[Medline]
[Order article via Infotrieve]
40. (suppl 1)
Shipp MA:
Can we improve upon the International Index?
Ann Oncol
8:43,
1997
41.
Auphan N,
DiDonato JA,
Rosette C,
Helmberg A,
Karin M:
Immunosupression by glucocorticoids: Inhibition of NF-B activity through induction of IB synthesis.
Science
270:286,
1995[Abstract/Free Full Text]
42.
Elliott MJ,
Maini RN,
Feldmann M,
Kalden JR,
Antoni C,
Smolen JS,
Leeb B,
Breedveld FC,
Macfarlane JD,
Bijl H:
Randomised double-blind comparison of chimeric monoclonal antibody to tumour necrosis factor alpha (cA2) versus placebo in rheumatoid arthritis.
Lancet
344:1105,
1994[Medline]
[Order article via Infotrieve]
43.
Stack WA,
Mann SD,
Roy AJ,
Heath P,
Sopwith M,
Freeman J,
Holmes G,
Long R,
Forbes A,
Kamm MA:
Randomised controlled trial of CDP571 antibody to tumour necrosis factor-alpha in Crohn's disease.
Lancet
349:521,
1997[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
A. J. Novak, S. L. Slager, Z. S. Fredericksen, A. H. Wang, M. M. Manske, S. Ziesmer, M. Liebow, W. R. Macon, S. R. Dillon, T. E. Witzig, et al.
Genetic Variation in B-Cell-Activating Factor Is Associated with an Increased Risk of Developing B-Cell Non-Hodgkin Lymphoma
Cancer Res.,
May 15, 2009;
69(10):
4217 - 4224.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. Tronchon, F. Vialard, M. El Sirkasi, H. Dechaud, J. Rollet, M. Albert, M. Bailly, P. Roy, C. Mauduit, P. Fenichel, et al.
Tumor necrosis factor-alpha -308 polymorphism in infertile men with altered sperm production or motility
Hum. Reprod.,
December 1, 2008;
23(12):
2858 - 2866.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. A. Anderson, R. M. Pfeiffer, J. S. Rapkin, G. Gridley, L. Mellemkjaer, K. Hemminki, M. Bjorkholm, N. E. Caporaso, and O. Landgren
Survival Patterns Among Lymphoma Patients With a Family History of Lymphoma
J. Clin. Oncol.,
October 20, 2008;
26(30):
4958 - 4965.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. M. Habermann, S. S. Wang, M. J. Maurer, L. M. Morton, C. F. Lynch, S. M. Ansell, P. Hartge, R. K. Severson, N. Rothman, S. Davis, et al.
Host immune gene polymorphisms in combination with clinical and demographic factors predict late survival in diffuse large B-cell lymphoma patients in the pre-rituximab era
Blood,
October 1, 2008;
112(7):
2694 - 2702.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y.-f. Cheung, G.-y. Huang, S.-b. Chen, X.-q. Liu, L. Xi, X.-c. Liang, M.-r. Huang, S. Chen, L.-s. Huang, X.-q. Liu, et al.
Inflammatory Gene Polymorphisms and Susceptibility to Kawasaki Disease and Its Arterial Sequelae
Pediatrics,
September 1, 2008;
122(3):
e608 - e614.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. R. Cerhan, S. M. Ansell, Z. S. Fredericksen, N. E. Kay, M. Liebow, T. G. Call, A. Dogan, J. M. Cunningham, A. H. Wang, W. Liu-Mares, et al.
Genetic variation in 1253 immune and inflammation genes and risk of non-Hodgkin lymphoma
Blood,
December 15, 2007;
110(13):
4455 - 4463.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. R. Cerhan, S. Wang, M. J. Maurer, S. M. Ansell, S. M. Geyer, W. Cozen, L. M. Morton, S. Davis, R. K. Severson, N. Rothman, et al.
Prognostic significance of host immune gene polymorphisms in follicular lymphoma survival
Blood,
June 15, 2007;
109(12):
5439 - 5446.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. C. Gray-Schopfer, M. Karasarides, R. Hayward, and R. Marais
Tumor Necrosis Factor-{alpha} Blocks Apoptosis in Melanoma Cells when BRAF Signaling Is Inhibited
Cancer Res.,
January 1, 2007;
67(1):
122 - 129.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
W. M. Howell and M. J. Rose-Zerilli
Cytokine Gene Polymorphisms, Cancer Susceptibility, and Prognosis
J. Nutr.,
January 1, 2007;
137(1):
194S - 199S.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Liu, Y. Berthier-Schaad, L. Plantinga, N. E. Fink, R. P. Tracy, W. H. Kao, M. J. Klag, M. W. Smith, and J. Coresh
Functional Variants in the Lymphotoxin-{alpha} Gene Predict Cardiovascular Disease in Dialysis Patients
J. Am. Soc. Nephrol.,
November 1, 2006;
17(11):
3158 - 3166.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. S. Wang, J. R. Cerhan, P. Hartge, S. Davis, W. Cozen, R. K. Severson, N. Chatterjee, M. Yeager, S. J. Chanock, and N. Rothman
Common Genetic Variants in Proinflammatory and Other Immunoregulatory Genes and Risk for Non-Hodgkin Lymphoma
Cancer Res.,
October 1, 2006;
66(19):
9771 - 9780.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Seidemann, M. Zimmermann, M. Book, U. Meyer, B. Burkhardt, K. Welte, A. Reiter, and M. Stanulla
Tumor Necrosis Factor and Lymphotoxin Alfa Genetic Polymorphisms and Outcome in Pediatric Patients With Non-Hodgkin's Lymphoma: Results From Berlin-Frankfurt-Munster Trial NHL-BFM 95
J. Clin. Oncol.,
November 20, 2005;
23(33):
8414 - 8421.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Bilolikar, A. R. Nam, M. Rosenthal, J. C. Davies, D. C. Henderson, and I. M. Balfour-Lynn
Tumour necrosis factor gene polymorphisms and childhood wheezing
Eur. Respir. J.,
October 1, 2005;
26(4):
637 - 646.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M.J. BISSELL, P.A. KENNY, and D.C. RADISKY
Microenvironmental Regulators of Tissue Structure and Function Also Regulate Tumor Induction and Progression: The Role of Extracellular Matrix and Its Degrading Enzymes
Cold Spring Harb Symp Quant Biol,
January 1, 2005;
70(0):
343 - 356.
[Abstract]
[PDF]
|
|
|
|
|
|
|
S. Rollinson, J. M. Allan, G. R. Law, P. L. Roddam, M. T. Smith, C. Skibola, A. G. Smith, M. S. Forrest, K. Sibley, R. Higuchi, et al.
High-Throughput Association Testing on DNA Pools to Identify Genetic Variants that Confer Susceptibility to Acute Myeloid Leukemia
Cancer Epidemiol. Biomarkers Prev.,
May 1, 2004;
13(5):
795 - 800.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Lech-Maranda, L. Baseggio, J. Bienvenu, C. Charlot, F. Berger, D. Rigal, K. Warzocha, B. Coiffier, and G. Salles
Interleukin-10 gene promoter polymorphisms influence the clinical outcome of diffuse large B-cell lymphoma
Blood,
May 1, 2004;
103(9):
3529 - 3534.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Majetschak, U. Obertacke, F. U. Schade, M. Bardenheuer, G. Voggenreiter, B. Bloemeke, and M. Heesen
Tumor Necrosis Factor Gene Polymorphisms, Leukocyte Function, and Sepsis Susceptibility in Blunt Trauma Patients
Clin. Vaccine Immunol.,
November 1, 2002;
9(6):
1205 - 1211.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Juszczynski, E. Kalinka, J. Bienvenu, G. Woszczek, M. Borowiec, T. Robak, M. Kowalski, E. Lech-Maranda, L. Baseggio, B. Coiffier, et al.
Human leukocyte antigens class II and tumor necrosis factor genetic polymorphisms are independent predictors of non-Hodgkin lymphoma outcome
Blood,
September 26, 2002;
100(8):
3037 - 3040.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Tsukasaki, C. W. Miller, T. Kubota, S. Takeuchi, T. Fujimoto, S. Ikeda, M. Tomonaga, and H. P. Koeffler
Tumor Necrosis Factor {{alpha}} Polymorphism Associated with Increased Susceptibility to Development of Adult T-Cell Leukemia/Lymphoma in Human T-lymphotropic Virus Type 1 Carriers
Cancer Res.,
May 1, 2001;
61(9):
3770 - 3774.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
P. Colombat, G. Salles, N. Brousse, P. Eftekhari, P. Soubeyran, V. Delwail, E. Deconinck, C. Haioun, C. Foussard, C. Sebban, et al.
Rituximab (anti-CD20 monoclonal antibody) as single first-line therapy for patients with follicular lymphoma with a low tumor burden: clinical and molecular evaluation
Blood,
January 1, 2001;
97(1):
101 - 106.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J.-P. Mira, A. Cariou, F. Grall, C. Delclaux, M.-R. Losser, F. Heshmati, C. Cheval, M. Monchi, J.-L. Teboul, F. Riche, et al.
Association of TNF2, a TNF-{alpha} Promoter Polymorphism, With Septic Shock Susceptibility and Mortality: A Multicenter Study
JAMA,
August 11, 1999;
282(6):
561 - 568.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Kumar, J. Short, and J. E. Parrillo
Genetic Factors in Septic Shock
JAMA,
August 11, 1999;
282(6):
579 - 581.
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract