|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 10 (May 15), 1998:
pp. 3693-3701
Delayed Targeting of Cytokine-Nonresponsive Human Bone Marrow
CD34+ Cells With Retrovirus-Mediated Gene Transfer Enhances
Transduction Efficiency and Long-Term Expression of Transduced
Genes
By
Ponnazhagan Veena,
Christie M. Traycoff,
David A. Williams,
Jon McMahel,
Susan Rice,
Ken Cornetta, and
Edward F. Srour
From the Division of Hematology/Oncology and Indiana Elks Cancer
Research Center, Department of Medicine, Department of Pediatrics,
Herman B Wells Center for Pediatric Research, Howard Hughes Medical
Institute, and Department of Microbiology and Immunology, Indiana
University School of Medicine, Indianapolis, IN.
 |
ABSTRACT |
Primitive hematopoietic progenitor cells (HPCs) are potential
targets for treatment of numerous hematopoietic diseases using retroviral-mediated gene transfer (RMGT). To achieve high efficiency of
gene transfer into primitive HPCs, a delicate balance between cellular
activation and proliferation and maintenance of hematopoietic potential
must be established. We have demonstrated that a subpopulation of human
bone marrow (BM) CD34+ cells, highly enriched for primitive
HPCs, persists in culture in a mitotically quiescent state due to their
cytokine-nonresponsive (CNR) nature, a characteristic that may prevent
efficient RMGT of these cells. To evaluate and possibly circumvent
this, we designed a two-step transduction protocol using
neoR-containing vectors coupled with flow
cytometric cell sorting to isolate and examine transduction efficiency
in different fractions of cultured CD34+ cells. BM
CD34+ cells stained on day 0 (d0) with the membrane dye
PKH2 were prestimulated for 24 hours with stem cell factor (SCF),
interleukin-3 (IL-3), and IL-6, and then transduced on fibronectin with
the retroviral vector LNL6 on d1. On d5, half of the cultured cells
were transduced with the retroviral vector G1Na and sorted on d6 into
cytokine-responsive (d6 CR) cells (detected via their loss of PKH2
fluorescence relative to d0 sample) and d6 CNR cells that had not
divided since d0. The other half of the cultured cells were first
sorted on d5 into d5 CR and d5 CNR cells and then infected separately
with G1Na. Both sets of d5 and d6 CR and CNR cells were cultured in
secondary long-term cultures (LTCs) and assayed weekly for transduced
progenitor cells. Significantly higher numbers of G418-resistant
colonies were produced in cultures initiated with d5 and d6 CNR cells
compared with respective CR fractions (P < .05). At week 2, transduction efficiency was comparable between d5 and d6 transduced CR
and CNR cells (P > .05). However, at weeks 3 and 4, d5 and
d6 CNR fractions generated significantly higher numbers of
neoR progenitor cells relative to the respective CR
fractions (P < .05), while no difference in transduction
efficiency between d5 and d6 CNR cells could be demonstrated.
Polymerase chain reaction (PCR) analysis of the origin of transduced
neoR gene in clonogenic cells demonstrated that
mature progenitors (CR fractions) contained predominantly LNL6
sequences, while more primitive progenitor cells (CNR fractions) were
transduced with G1Na. These results demonstrate that prolonged
stimulation of primitive HPCs is essential for achieving efficient RMGT
into cells capable of sustaining long-term in vitro hematopoiesis. These findings may have significant implications for the development of
clinical gene therapy protocols.
| |
INTRODUCTION |
HEMATOPOIETIC STEM CELLS, due to their
long-term engraftment potential, are the target cells of choice in
somatic gene therapy for malignant and nonmalignant bone marrow (BM)
disorders.1-3 Retroviral-mediated gene transfer (RMGT)
remains the most attractive means of reliably delivering genetic
material to cells possessing high proliferative
potential.4-6 The major limitation of RMGT is the
requirement for cell division before stable integration of the
retroviral vector into the target cell genome.7 Since "true" stem cells represent a relatively quiescent population of
hematopoietic cells,8-11 transduction efficiency into these cells without cytokine stimulation is low. However, cytokine
stimulation of primitive hematopoietic progenitor cells (HPCs) may
compromise the hematopoietic potential of these cells, since in vitro
activation of HPCs is normally associated with progressive loss of
self-renewal capacity and increased lineage
commitment.12-16 Nevertheless, cytokine stimulation has
been shown to increase gene transduction efficiency into human
committed BM progenitors.17,18 In addition, stable engraftment of retrovirally marked human BM cells in immunodeficient mice19,20 or in clinical gene-marking
studies21,22 suggests transfer of foreign genetic material
into human stem cells.
Recently, our laboratory documented the persistence of a cytokine
nonresponsive (CNR) population of HPCs in short-term cultures and
demonstrated the ability of these cells to sequentially enter the cell
cycle and proliferate.23,24 Furthermore, human CNR cells
were shown to be enriched for long-term hematopoietic
culture-initiating cells,23 and in the murine system were
capable of repopulating the hematopoietic system of lethally irradiated
recipients.25 The identification of CNR
cells,23 which resemble those described by Berardi et
al26 as a group of cells highly enriched for primitive HPCs, raises the question of whether prestimulation of human
CD34+ cells for a relatively short period pre-RMGT
facilitates gene transduction into mature elements of the progenitor
pool but not into the more primitive, mitotically dormant cells. In
support of this contention are the recent studies by Larochelle et
al,20 which demonstrated that although high-efficiency gene
transfer into mature and primitive clonogenic cells was achieved by a
short prestimulation of CD34+ cells followed by RMGT over
recombinant fragments of the extracellular matrix component,
fibronectin, gene transfer into more primitive NOD/SCID repopulating
cells was inefficient.20
Given these observations regarding the nature of CNR cells and the
relative inefficiency of transducing primitive HPCs, we reasoned that
RMGT into cells capable of sustaining prolonged in vitro hematopoiesis
may be enhanced if CNR cells were specifically targeted via prolonged
cytokine stimulation and delayed transduction. In this study, we
transduced BM CD34+ cells at 1, 5, and 6 days after
cytokine stimulation in short-term culture and examined the
contribution of each transduction cycle to gene transfer efficiency in
CNR cells and to the persistence of long-term expression of transduced
genes. We report here that transduction on day 5 (d5) or d6, but not on
d1, resulted in efficient gene transfer into CNR cells, and that only
this fraction of cultured cells was capable of supporting the
production of transduced progenitors for up to 5 weeks. These results
suggest that efficient RMGT into hematopoietic cells may be best
realized by delayed targeting of quiescent primitive HPCs. Furthermore,
our findings define fractions of ex vivo manipulated CD34+
cells that may be responsible for long-term expression of transduced genetic material and offer potential alternatives for improving somatic
gene transfer into hematopoietic stem cells.
| |
MATERIALS AND METHODS |
BM collection and fractionation.
Human BM aspirates were collected from normal adult subjects after
obtaining informed consent according to guidelines established by the
Investigational Review Board of Indiana University School of Medicine.
Low-density BM cells were recovered by Ficoll-Hypaque (Pharmacia,
Piscataway, NJ) density centrifugation. Cells were fractionated by
immunomagnetic selection to obtain CD34+ cells as
previously described.23,27 All reagents for the
immunomagnetic separation procedure were kindly provided by Baxter
Healthcare (Irvine, CA).
Immunofluorescence staining and flow cytometric cell sorting.
Immunomagnetically enriched BM CD34+ cells were stained on
ice for 20 minutes with fluorescein isothiocyanate (FITC)-conjugated anti-CD34 (Becton Dickinson Immunocytometry Systems [BDIS], San Jose,
CA). Control monoclonal antibodies consisted of
fluorochrome-conjugated, isotype-matched, nonspecific myeloma proteins.
Cells were washed and resuspended for flow cytometric cell sorting in
phosphate-buffered saline (PBS) supplemented with 1% human serum
albumin and were immediately sorted as previously
described23,28 on a FACStarplus flow cytometer
(BDIS). Viability and purity of sorted cells always exceeded 98% and
90%, respectively.
PKH2 staining.
Sorted CD34+ cells were stained with PKH2 (Sigma
ImmunoChemicals, St Louis, MO) before use in short-term culture, per
the manufacturer's instructions and as previously
described.23 Briefly, cells were suspended in 1 mL diluent
(Sigma Immuno Chemical) and immediately transferred into a
polypropylene tube containing 1 mL 4 × 10 6-mol/L PKH2
in diluent at room temperature. After 5 minutes of incubation with
frequent agitation, 2 mL fetal calf serum ([FCS] Hyclone, Logan, UT)
was added to the suspension for 1 minute. The total volume was brought
to 8 mL with Iscove's modified Dulbecco's medium (IMDM) supplemented
with 10% FCS, L-Glutamine, and antibiotics (complete
medium), and the cells were washed three times in complete medium. All
of the complete medium ingredients (except FCS) were obtained from
BioWhitaker (Walkersville, MD). Antibiotics consisted of penicillin and
streptomycin at 100 U/mL and 100 mg/mL, respectively. After the last
wash, cells were suspended in complete medium and cultured with
cytokines as described later. The validity of the PKH2 staining method
on human BM cells has been previously established.29
Preparation of fibronectin-coated dishes.
Non-tissue culture-grade culture dishes were coated with fibronectin
according to Moritz et al.30 Briefly, the wells were coated
for 2 hours at room temperature with a 30/35-kD protein fragment at a
concentration of 10 µg/cm2 in PBS. Excess protein
solution was aspirated, and the remaining free sites were blocked with
0.5 mL 2% fibronectin-free bovine serum albumin (BSA) in PBS for 20 minutes at room temperature. Excess BSA solution was aspirated, and the
wells were washed with Hanks' balanced salt solution supplemented with
HEPES buffer.
Retroviral vectors.
The two recombinant retroviral vectors used in these studies were LNL6
and G1Na, both of which contained the gene for neomycin resistance
(neoR). The LNL6 vector, which is amphotropically
packaged in the PA317 cell line and has a titer of 1 to 2 × 106 colony-forming units (CFU)/mL, was developed by Bender
et al.31 The G1Na vector was developed by Genetic Therapy
(Gaithersburg, MD) and is packaged in the PA317 cell line.
Similar to LNL6, G1Na also has a titer of 1 to 2 × 106 CFU/mL. Both vectors were negative for
replication-competent retrovirus when tested in the
S+/L assay.32 Fresh filtered
(0.45 µm) supernatant was used for each assay.
Retroviral transduction.
PKH2-stained BM CD34+ cells were incubated overnight at
37°C in 5% CO2 with 100 ng/mL each of stem cell factor
(SCF), interleukin-3 (IL-3), and IL-6. Cells were transduced the next
day (d1) by incubating overnight with LNL6 or G1Na viral supernatant at
a multiplicity of infection (moi) greater than 10:1 on plates coated
with fibronectin, in the presence of 8 µg/mL Polybrene and cytokines.
Following infection, nonadherent cells were collected in IMDM
supplemented with 20% fetal bovine serum while the adherent cells were
treated with 0.5% trypsin-EDTA. Cells were washed twice with medium
and replated with cytokines in tissue culture-grade flat-bottomed 48-well plates in the absence of fibronectin. On d5, cells were harvested and split into two parts. Half of the cells were washed and
stained with phycoerythrin-conjugated CD34 and sorted to yield CD34+ PKH2bright (CNR) and CD34+
PKH2dim (cytokine-responsive [CR]) cells as previously
demonstrated.23 A sample fixed in 1% formaldehyde on d0
immediately after staining of fresh sorted CD34+ cells with
PKH2 was used to establish PKH2 fluorescence corresponding to
nondividing cells. Stringent selection of CNR cells based on PKH2
fluorescence was performed according to previously established procedures.23,28,29 Fractions isolated on d5 are referred to as d5 CNR and d5 CR fractions (Fig 1). These fractions were cultured
overnight in the presence of SCF, IL3, and IL6 and were then transduced
on d6 with G1Na or LNL6 supernatant (using whichever vector was not
used on d1) on fibronectin-coated dishes (plus Polybrene) overnight as
on d1. These cells were subsequently washed and plated in individual
wells of a 48-well plate with SCF, IL-3, and IL-6. The remaining half
of the cells were transduced on day 5 with G1Na or LNL6 supernatant
(using whichever vector was not used on day 1) on fibronectin-coated
dishes plus Polybrene overnight, and then trypsinized, harvested,
washed, and stained with phycoerythrin-conjugated anti-CD34 on d6. The
same strategy used on d5 was applied again to isolate CD34+
PKH2bright (CNR) and CD34+ PKH2dim
(CR) cells. Since these fractions were isolated on d6, they are referred to as d6 CNR and d6 CR fractions (Fig
1). After isolation, d6 CNR and d6 CR cells
were plated in individual wells of a 48-well plate with SCF, IL-3, and
IL-6.
View larger version (17K):
[in this window]
[in a new window]
| Fig 1.
Schema of the experimental design used for transducing
CNR cells on d5 and d6. A total of 6 experiments were performed for these studies. In 4, the retroviral vector LNL6 was used on d1 and the
vector G1Na on d5 and d6. In the other 2 experiments, the sequence was
reversed. The schema presented here depicts the sequence of
experimental steps used when cells were transduced with LNL6 on d1 and
with G1Na on d5 and d6.
|
|
Control long-term cultures (LTCs) maintained along with those
established with d5 and d6 CNR and CR cells included the following: a
control LTC established on d1 with unmanipulated, mock-infected CD34+ cells to evaluate the effect of gene transfer on the
ability of normal CD34+ cells to sustain in vitro
hematopoiesis; a primary transduction control (1° TC) LTC initiated
with cells transduced on d1 and not subjected to any further
fractionation on d5 or d6; and a secondary transduction control (2°
TC) culture initiated with a sample of total CD34+ cells
removed after d5 transduction and before further fractionation of these
cells on d6 (Fig 1).
LTC.
Secondary LTCs of the fractions (control and transduced) were
established in 1 mL complete medium in flat-bottomed 48-well plates as
described previously.13,23 Secondary cultures were supplemented at initiation and every 48 hours thereafter with 100 ng/mL
each of SCF, IL-3, and IL-6. At weekly intervals, cultures were
demidepopulated and the remaining cells were replenished with fresh
medium and cytokines. Collected cells were used in HPC assays. For ease
of data presentation, results obtained from cultures established with
control, 1° TC, and 2° TC cells will not be presented in every
figure.
HPC assay.
A total of 103 fresh CD34+ cells or between 2 and 8 × 103 cultured cells were suspended in 35-mm tissue
culture dishes in 1 mL containing 30% FCS, 5 × 105
mol/L 2-mercaptoethanol, 100 ng/mL SCF, 10 ng/mL IL-3, 10 ng/mL IL-6, 5 ng/mL granulocyte-macrophage colony-stimulating factor, 2 U/mL
erythropoietin, and 1.1% methylcellulose in IMDM. All cytokines used
in these studies were a kind gift from Amgen (Thousand Oaks, CA).
Duplicate cultures with and without G418 (Sigma) prepared at 1 mg/mL
(active compound) were established. Cultures were incubated in 100%
humidified 5% CO2 in air at 37°C. Burst forming
units-erythroid, CFU-granulocyte-macrophage, or
CFU-granulocyte-erythroid-macrophage-megakaryocyte detected in the
presence or absence of G418 were enumerated on d14 using an inverted
microscope. Between 7 and 15 G418-resistant individual hematopoietic
colonies were plucked aseptically and analyzed for the presence of the
neoR gene by polymerase chain reaction (PCR).
Transduction efficiency was defined as (no. of G418-resistant
colonies/no. of cells plated in G418) × (no. of cells plated without
G418 × 100/no. of unselected colonies).
PCR analysis.
Individual colonies were identified and isolated into microcentrifuge
tubes containing 500 mL PBS. DNA from each colony was extracted as
follows. Cells were pelleted at 2,000g for 7 to 8 minutes at
4°C. All of the supernatant was removed, and the cells were suspended
in 40 µL water. Samples were incubated initially for 10 minutes at
94°C, then at 55°C for 1 hour after addition of 20 µg proteinase
K (Sigma), and finally at 94°C for 15 minutes. DNA extracted from
each colony was split into two parts and tested for the presence of the
neoR gene with two sets of primers specific for
PA317/LNL6 and PA317/G1Na to distinguish the source of the
neoR sequence. The neomycin phosphotransferase gene
from vector G1Na was amplified using the primers 5
GAATTCGCGGCCGCTACAAT 3 and 5 GATAGAAGGCGATGCGCTGC 3 while the same
gene from the LNL6 vector was amplified using the primers 5
GGTTGGGCTTCGGAATCGTT 3 and 5 TCTACACTGGCTCGATGGAG 3. DNA
amplification was performed with a Perkin-Elmer (Norwalk, CT) thermal
cycler for 30 cycles at 94°C for 1 minute, 65°C for 1 minute, and
72°C for 1 minute. PCR products were separated on 1.7% agarose gels
(GIBCO-BRL, Gaithersburg, MD), transferred to nylon membranes (Midwest
Scientific, St Louis, MO), and hybridized to a 32P-labeled
EcoRI-Sal I fragment of pLNL6 DNA. Prehybridization, hybridization, and posthybridization washes were performed according to
the manufacturer's recommendations.
Statistical analysis.
Where applicable, data are presented as the mean ± SE. In some
figures and for clarity of presentation, only the positive SE is
depicted. Statistical comparison between paired data from different
groups was performed using a two-tailed t-test.
| |
RESULTS |
Evaluation of gene transfer efficiency of LNL6 and G1Na.
To follow retroviral-marked cells in culture, we selected the LNL6 and
G1Na vectors that contain the neoR gene. The
structure of the vectors is similar except for the noncoding region 3
to the neoR gene. This sequence difference permits
the design of vector-specific PCR primers capable of distinguishing the
respective vectors. Since the LNL6 and G1Na producer cell lines
generate vector at similar titers (1 to 2 × 106
CFU/mL), these vectors are predicted to transduce target cells at
similar efficiencies. It was therefore essential to compare and confirm
the transduction efficiency of both vectors. BM CD34+ cells
prestimulated overnight were transduced on d1 with fresh G1Na and LNL6
viral supernatants. Transduction efficiencies of both groups of
transduced CD34+ cells were similar (19.6% and 22.5% for
G1Na and LNL6, respectively, n = 2) indicating that G1Na and LNL6
were equally capable of transducing primary BM CD34+ cells.
Susceptibility of different fractions of cultured CD34+
cells to G1Na and LNL6.
Since the experimental design involved transduction of different
fractions of ex vivo-expanded CD34+ cells with G1Na or
LNL6 at different time points, we investigated the susceptibility of
these cell fractions to both retroviruses. Total BM CD34+
cells were stained with PKH2 and cultured with SCF, IL3, and IL6, and
on d1, d5, d6, d8, or d9 were transduced with G1Na or LNL6 supernatant.
To distinguish between the susceptibility of fractions of cultured
cells to transduction before and after fractionation, two different
approaches were taken. In the first, cultured CD34+ cells
were separated on d5 and d8 into CNR and CR cells (based on residual
PKH2 fluorescence) and both CNR and CR cells were split into two
fractions, each of which was then transduced with one of the two
retroviral vectors. In the second, cultured CD34+ cells
were first transduced on d6 and d9 and then fractionated into CNR and
CR cells. The data presented in Table 1demonstrate that at any given time point, all groups of cells were
equally transduced with either G1Na or LNL6. It is evident that
regardless of whether cells were exposed to vector before or after
fractionation into CR and CNR cells, these fractions were equally
susceptible to transduction with G1Na and LNL6, and that the highest
degree of gene transfer occurred on d5 and d6 (Table 1). It is
important to point out that on d8 and d9, CNR fractions produced a
higher number of total and G418-resistant colonies compared with their respective CR counterparts, suggesting that targeting CNR fractions may
be essential to achieve efficient RMGT in cells enriched for enhanced
progenitor cell production capacity and possibly primitive hematopoietic potential.
Targeting of CNR cells with RMGT.
Based on the preliminary data shown in Table 1, it was reasoned that
effective gene transfer into CNR cells could be achieved after 5 to 6 days of in vitro prestimulation. Experiments designed to examine this
possibility and to investigate whether transduced CNR cells could
support the long-term production of marked progenitor cells in vitro
were performed according to the schema outlined in Fig 1. A total of
six experiments were performed. In four, LNL6 was used on d1 and G1Na
on d5 and d6, while the sequence was reversed in the other two
experiments. All resulting groups of cells were maintained in
suspension LTC, and the production of total and G418-resistant
clonogenic progenitor cells was assessed.
As previously demonstrated in prior reports from our
laboratory,23,24,33 the overall production of assayable
progenitor cells in cultures initiated with d5 or d6 CNR cells exceeded
that detected in cultures initiated at the same time points with CR cells or transduction control cultures (2° TC) established on d5 (Fig
2A). Not only did LTCs initiated with d5
CNR and d6 CNR cells produce significantly more (P < .05)
clonogenic cells at weeks 3 and 4 than cultures initiated with cells
from other groups (d5 CR, d6 CR, and 2° TC), production of CFU in
these cultures was sustained for a longer period than in other cultures
(Fig 2A). Of interest is that the peak production of assayable
progenitors and the magnitude of CFU production at every time point
analyzed were matched closely in cultures established with d5 CNR and
d6 CNR cells, suggesting that differences in the sequence of
experimental steps used to isolate these two groups of cells had no
adverse effects on their hematopoietic potential.
View larger version (22K):
[in this window]
[in a new window]
| Fig 2.
Total assayable (A) and G418-resistant (B) progenitor
cells produced in long-term hematopoietic cultures initiated with 5 groups of transduced CD34+ cells as outlined in Fig 1.
Cells isolated as d5 CR ( ), d5 CNR ( ), d6 CR ( ), or d6 CNR
( ) or maintained as 2° TC ( ) were used to establish LTCs
supplemented with cytokines. Cultures were demidepopulated every week,
followed by replenishment of half of the medium and cytokines.
Harvested cells were used for clonogenic assays in the presence or
absence of G418. For clarity and ease of presentation, data from each
of the 5 groups of cells are presented as the mean ± SE of assayable
and G418-resistant clonogenic cells detected at the indicated time
points in 6 separate LTCs initiated with BM cells from 6 different
normal donors. Values were normalized to represent data obtained from
cultures initiated with 104 cells. In 4 experiments, LNL6
was used on d1 and G1Na on d5 and d6, while the reverse order was used
in the remaining 2 experiments. *P < .05, the indicated CNR
group v the respective CR group. At weeks 3 and 4, d5 CNR and
d6 CNR values (in A and B) were also statistically different
(P < .05) from those observed in 2° TC. No significant
differences were detected between d5 and d6 CNR cells.
|
|
Similarly, production of G418-resistant CFU was highest in LTCs
initiated with either d5 CNR or d6 CNR cells (Fig 2B). Also of interest
is that the peak production of G418-resistant progenitor cells (Fig 2B)
coincided with the peak production of clonogenic cells (Fig 2A). At
week 3, a slightly higher but statistically insignificant number of
transduced progenitors were detected in d5 CNR cultures compared with
d6 CNR cultures (Fig 2B). Only those two LTCs contained transduced
progenitors at week 5, albeit in small numbers. None of the LTCs that
sustained in vitro hematopoiesis beyond week 5 contained any transduced
progenitors at week 6.
Transduction efficiency.
Due to the large number of transduced cells required for assay in the
presence of G418 and to the limited number of cells available at the
end of week 1, we opted not to examine any of the infected groups of
cells at this time point. However, transduction efficiency in all of
the groups analyzed was highest at week 2, yet at this time point, no
significant differences (P > .05) in transduction
efficiency between d5 and d6 CNR fractions and their CR counterparts
could be established (Fig 3). As predicted from the production of
transduced clonogenic cells (Fig 2B), transduction efficiency in
cultures established with d5 CR, d6 CR, or 2° TC cells declined
drastically by weeks 3 and 4. In contrast, only a slight decline in
transduction efficiency was observed between weeks 2 and 3 in cultures
established with d5 and d6 CNR cells. This initial maintenance of
transduction efficiency in these cultures was followed by a rapid
decrease between weeks 3 and 5 (Fig 3). During weeks 3 and 4, transduction efficiency was significantly higher in d5 and d6
CNR cultures (P < .05) compared with their respective CR
counterparts and 2° TC cultures. Again, of interest are the analogous
transduction efficiencies observed in cultures initiated with either d5
CNR or d6 CNR cells, suggesting that differences in the methodology
used in isolating these cells did not negatively affect the
hematopoietic function of either fraction.
View larger version (14K):
[in this window]
[in a new window]
| Fig 3.
Transduction efficiency detected in long-term
hematopoietic cultures initiated with 5 groups of transduced
CD34+ cells as outlined in Fig 1. Cells isolated as d5 CR
(), d5 CNR (), d6 CR (), and d6 CNR () or maintained as
2° TC () were used to establish LTCs supplemented with cytokines.
Cultures were demidepopulated every week, followed by replenishment of
half of the medium and cytokines. Harvested cells were used for
clonogenic assays in the presence or absence of G418. For every time
point, transduction efficiency was calculated as (no. of G418-resistant colonies/no. of cells plated in G418) × (no. of cells plated without G418 × 100/no. of unselected colonies). For clarity and ease of presentation, data from each of the 5 groups of cells are presented as
the mean ± SE of transduction efficiency calculated at each indicated
time point in 6 separate LTCs initiated with BM cells from 6 different
normal donors. *P < .05, the indicated CNR group v
the respective CR group. At weeks 3 and 4, d5 CNR and d6 CNR values
were also statistically different (P < .05) from those observed in 2° TC. No significant differences were detected between d5 and d6 CNR cells at any time point.
|
|
PCR analysis of G418-resistant colonies.
The design of these experiments necessitated that the primers used to
amplify LNL6 and G1Na sequences be specific for their respective
retroviral vectors and capable of determining the origin of the
neoR gene in transduced cells. DNA extracted from
individual hematopoietic colonies was amplified with G1Na-specific and
LNL6-specific primer pairs separately or together. Only DNAs amplified
by the appropriate primer sets were detected, thus confirming the
specificity of the primers used (Fig
4). We next examined the
fidelity of our PCR assay by investigating whether PCR analysis of
cells exposed to both LNL6 and G1Na at different time points was
capable of identifying the origin of the transduced
neoR gene. Figure 5demonstrates that HPCs successfully transduced with both vectors
displayed the two vector-specific sequences, while those successfully
transduced with only one of the two vectors contained sequences
corresponding to the appropriate vector.
View larger version (33K):
[in this window]
[in a new window]
| Fig 4.
PCR amplification of genomic DNA isolated from individual
neoR hematopoietic colonies transduced with G1Na
(lanes 3, 4, and 6) and LNL6 (lanes 8, 9, and 11) vectors. Samples were
subjected to 30 cycles of amplification using primer pairs specific for G1Na (lanes 4 and 8), LNL6 (lanes 3 and 9), or both (lanes 6 and 11).
Ethidium bromide-stained products of 829-bp and 481-bp DNA sequences
indicate specific amplification by G1Na- and LNL6-specific primers,
respectively. Molecular weight markers were loaded in lane 1, and lanes
2, 5, 7, and 10 were blank.
|
|
View larger version (67K):
[in this window]
[in a new window]
| Fig 5.
PCR analysis of hematopoietic progenitor colonies
transduced with G1Na and LNL6 retroviral vectors. DNA samples isolated
at week 2 posttransduction from 10 representative
neoR hematopoietic colonies (lanes 2 through 11)
from human BM CD34+ cells transduced with G1Na on d1
followed by LNL6 on d5 were subjected to PCR analysis using
G1Na-specific (a) or LNL6-specific (b) primer pairs. The products of
PCR amplification were electrophoresed on 2% agarose gel and
visualized on Southern blots using 32P-labeled
neo-specific sequences. While 4 colonies (lanes 2, 4, 5, and 6)
showed the presence of both retroviral vectors, 2 colonies each (lanes
7 and 9 and lanes 10 and 11), respectively, showed sequences specific
for either LNL6 or G1Na vectors alone. Lane 1 is a negative control.
PCR amplification of DNA obtained from 2 colonies (lanes 3 and 8) was
not successful.
|
|
Individual colonies obtained from the progenitor cell assays performed
weekly on all fractions maintained in LTC were used for PCR analysis to
test for the presence and determine the origin of the transduced
neoR gene. Figure 6depicts PCR analysis results from individual colonies obtained from one
experiment in which CD34+ cells were transduced on d1 with
G1Na supernatant and on d5 and d6 with LNL6 supernatant. Figure 6
demonstrates that only cultures initiated with d5 CNR or d6 CNR cells
contained a significant number of G418-resistant progenitors at weeks 3 and 4. PCR analyses for determination of the origin of the
neoR gene in individual colonies showed that cells
isolated from colonies produced in cultures initiated with 1° TC
cells contained G1Na sequences only (Fig 6). At weeks 3 and 4, the
highest transduction efficiency was detected in cultures established
with d5 or d6 CNR cells. Close analysis of the origin of
neoR sequences showed that the majority of
progenitors were transduced on d5 or d6 with the LNL6 vector (Fig 6).
However, a sizable fraction of transduced progenitors in d5 and d6 CNR
cultures expressed both G1Na and LNL6 sequences. By week 5, only d5 CNR
and d6 CNR cultures contained any transduced progenitor cells, albeit
at a substantially low frequency relative to that recorded at weeks 3 and 4.
View larger version (18K):
[in this window]
[in a new window]
| Fig 6.
PCR analysis from 1 representative long-term
hematopoietic culture initiated with all 7 groups of transduced and
untransduced CD34+ cells outlined in Fig 1. In this
experiment, cells were transduced on d1 with G1Na and with LNL6 on d5
and d6. LTCs were initiated on d0, d1, d5, or d6 with the indicated
cell group and maintained with cytokines. Cultures were demidepopulated
every week, followed by replenishment of half of the medium and
cytokines. Harvested cells were used for clonogenic assays in the
presence or absence of G418. Values were normalized to represent data
obtained from cultures initiated with 104 cells. The origin
of the neoR gene detected in single colonies at
weeks 2, 3, 4, and 5 is indicated. Each bar is divided into 3 sections
reflecting the percentage of colonies at each time point containing
G1Na sequences, LNL6 sequences, or both. For every data point, between
7 and 15 colonies were analyzed. Numbers on top of each bar indicate
the transduction efficiency. Similar results were obtained in 1 additional experiment using this sequence of transduction.
|
|
Data from all experiments in this study were analyzed collectively and
are summarized in Fig 7. In this analysis,
whichever vector was used on d1 was designated as vector 1, while that
used on d5 and d6 was designated vector 2. Similar to the results
presented in Fig 6, analysis of the origin of neoR
sequences in clonogenic cells derived from d5 and d6 CNR cells indicated that the long-term persistence of the
neoR gene was due to the vector used on d5 and d6
(vector 2). Interestingly, at week 2, progenitors expressing
neoR sequences derived from vector 1 appear to
sequester among CR cells, while those acquired during d5 and d6
transduction (vector 2) segregate mostly among CNR cells. In fact, at
weeks 3 and 4, a greater percentage of HPCs from d5 and d6 CNR cultures
expressed vector 2 as compared with vector 1 sequences
(P < .05). These results indicate that cells capable of
sustaining long-term in vitro hematopoiesis, ie, CNR cells, are best
transduced after 5 or 6 days of prestimulation. In addition, a
substantial fraction of transduced progenitor cells derived from CNR
cells expressed both G1Na and LNL6 sequences, indicating the
possibility of transducing individual progenitor cells with two
different vectors.
View larger version (27K):
[in this window]
[in a new window]
| Fig 7.
Summary of PCR analysis of single colonies isolated from
LTCs at weeks 2, 3, 4, and 5. Each bar represents the transduction efficiency calculated for a particular group of cells at a given time
point calculated as the mean of 3 to 6 values detected in 6 separate
experiments initiated with BM cells from 6 different normal donors.
Whichever vector was used on d1 is designated vector 1, and that used
on d5 and d6 is designated vector 2. Each bar is divided into 3 sections reflecting the percentage of colonies at each time point
containing vector 1 sequences, vector 2 sequences, or both as defined
in the legend. For every data point, between 26 and 59 colonies were
analyzed. *P < .05, percentage of progenitor cells expressing
vector 1-derived v vector 2-derived neoR
sequences within the same group. The percentage of progenitors expressing both sequences was not considered for this analysis. #Not significant.
|
|
| |
DISCUSSION |
In this study, we investigated the results of early versus delayed RMGT
into human BM CD34+ cells and evaluated the fate of
transduced cells in two cell fractions discernible in culture based on
their proliferative history. Whereas more mitotically active CR cells
displayed a limited ability to produce assayable progenitors, cells
resistant to immediate cytokine stimulation, here termed CNR cells,
were responsible for the maintenance of long-term in vitro
hematopoiesis and continued expression of transduced
neoR genes, demonstrating successful gene transfer
into primitive HPCs. Recent studies by Larochelle et al20
demonstrated that exposure of human CD34+ cells to
retroviral vectors efficiently transduced clonogenic progenitors and
LTC-initiating cells, but not the more primitive SCID repopulating
cells. These investigators20 transduced CD34+
cells after 24 hours of prestimulation with SCF, IL-3, and IL-6 using a
protocol that required up to 48 hours of additional in vitro incubation
during which the cells were exposed to the retroviral vector. Among the
possible explanations as to why SCID repopulating cells were not
genetically marked is the possibility that these cells were not induced
to proliferate during the 72 hours of in vitro manipulation, an event
previously demonstrated to be essential for successful
RMGT.7,34 This study20 and others35
suggest that RMGT into quiescent primitive HPCs is not efficient if
cells are exposed to the retroviral vector within 72 hours of in vitro stimulation. The failure to effectively transduce long-term marrow repopulating cells using a 3-day or shorter transduction protocol has
been previously documented by several investigators.36-39
CNR23,24,28 and similar cells identified by other
groups26,40,41 may remain dormant in culture for up to 10 days. In cultures of PKH2-stained CD34+ cells, CNR cells
can be identified as soon as the more CR cells begin to proliferate and
lose their PKH2 fluorescence. However, the relative size of the CNR
cell population decreases with time. It was therefore logical to
identify, isolate, and transduce CNR cells as soon as feasible to
obtain the largest number of cells for these studies. In addition,
preliminary results (Table 1) demonstrated that the highest
transduction efficiency of total CD34+ cells and the CR and
CNR fractions was possible on d5 or d6. We have previously
demonstrated29 that the rate of proliferation of CR cells,
measured as the percentage of cells detected in the S and
G2 + M phases of the cell cycle, decreases with every
additional division, suggesting that the decline in transduction
efficiency observed on d8 and d9 may be the result of increased mitotic
quiescence.
Of interest is that CNR cells, whether isolated from culture and then
infected or infected while in culture with other cell fractions, were
equally susceptible to transduction on d5 or d6. Since CNR cells most
likely remained quiescent until after isolation from short-term
cultures, these results suggest it is possible to achieve efficient
gene transfer into quiescent cells provided these targets enter into
active phases of the cell cycle within a relatively short period
following delivery of foreign genetic material. This may explain the
somewhat unexpected observation that CNR cells, which are more
quiescent than CR cells, were more efficiently transduced on d5 and d6
than the latter group of cells. Recent evidence from our laboratory
suggests that transduction of CD34+ cells residing in the
G0 phase of the cell cycle is possible if G0
cells are transduced just prior to cell-cycle activation and
proliferation (E.F. Srour, unpublished observations, October 1997). This suggests a possible explanation for the long
recognized inefficiency of gene transfer into primitive human
HPCs:36,38,39 If the earliest human progenitor cells are in
a state of deep dormancy, then transduction of these cells after 24 to
48 hours of cytokine prestimulation may introduce the transduced
genetic material into these cells long before they are ready to enter active phases of the cell cycle and begin the process of integration of
transduced genes into cellular DNA. In fact, Emmons et al42 recently demonstrated the possibility of transducing human
CD34+ cells without growth factors, only to recognize poor
marking when these cells were transplanted in vivo and monitored for a period of 18 months posttransplant. This, in turn, may explain why
transduction of murine stem cells is more efficient than transduction of their human counterparts, since murine stem cells have been recently
reported to be continuously cycling.43
Although it has been previously demonstrated that cytokine
prestimulation increases transduction efficiency,19,44,45
it appears from our studies that the rate of recruitment of primitive HPCs into active phases of the cell cycle and therefore precise timing
of transduction is essential for efficient and sustained gene transfer.
In a recent study, Boezeman et al46 demonstrated that
differences in the rate of hematopoietic colony outgrowth from
differentiated (CD34+ CD13+ CD33+)
versus more primitive (CD34+ CD13+
CD33) progenitors are based on a delay in growth
initiation by cells of the latter group. In these
studies,46 the delay in growth initiation was 2.6 to 3.1 days, suggesting that transduction of CNR cells on d5 or d6 may have
allowed ample time for initiation of proliferation of primitive HPCs.
Based on data presented in this report, it becomes clear that delayed
transduction of cultured cells till after d4 may favor efficient gene
transfer only because of concomitant cell-cycle activation of primitive
HPCs and retroviral infection of these cells. On the other hand,
prolonged exposure of CD34+ cells, including CNR cells, to
cytokines raises the concern that prestimulation may induce
differentiation of stem cells such that the observed level of gene
transfer into CNR cells may not reflect efficient gene transfer into
stem cells. This is especially true in view of our previously published
observations demonstrating that although CNR cells are relatively
enriched for primitive HPCs, the hematopoietic potential of these cells
is usually compromised relative to freshly isolated CD34+
cells.23,25,33 Evidence for the negative effects of
exposure of human CD34+ cells to in vitro cytokine
stimulation for more than 3 to 4 days can be gleaned from studies in
which ex vivo-expanded cells were transplanted into
NOD/SCID47 or bnx35 mice to assess the
marrow-repopulating potential. Bhatia et al47 reported that
although a modest increase in SCID-repopulating cells was possible
after 4 days of culture of cord blood hematopoietic cells, all such
activity was lost following 9 days of ex vivo expansion. Similarly,
CD34+ cells transduced for 3 days in the presence of
exogenous cytokines but in the absence of stromal cells failed to
successfully engraft bnx mice.48 In a more recent report,
the same group of investigators49 questioned whether
self-renewing divisions of hematopoietic stem cells can be achieved in
vitro and associated the lack of such an event with the low level of
gene transfer efficiency into human marrow-repopulating cells. A
somewhat unexpected observation was the degree of double labeling of
individual progenitors with vector 1 on d1 followed by vector 2 (Fig
7). It is conceivable that an actively proliferating cell may divide
several times during a 6-day period, allowing for the integration of
both neoR genes delivered by each of the two
vectors.
In conclusion, we demonstrate in this communication the feasibility of
transducing the more primitive HPCs contained within total BM
CD34+ cells as assessed by the ability of these cells to
sustain long-lived in vitro hematopoiesis and the continued expression
of the transduced genetic material. Furthermore, our results indicate
that primitive HPCs can be successfully transduced when present among
more mature progenitors, thus excluding the need to purify and isolate
these cells before transduction. These studies may have important
implications in the design of clinical gene therapy protocols.
| |
FOOTNOTES |
Submitted October 27, 1997;
accepted December 31, 1997.
Supported by National Institutes of Health Grant No. RO1 HL55716, Grant
No. PO1 CA59348 from the National Cancer Institute, and a research
award from the Phi Beta Psi Sorority (E.F.S.). Herman B Wells Center
for Pediatric Research is a Center for Excellence in Molecular
Hematology (NIDDK P50 DK49218).
Address reprint requests to Edward F. Srour, PhD, Indiana University
School of Medicine, 1044 W Walnut St, R4-202, Indianapolis, IN
46202-5121.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
REFERENCES |
1.
Williams DA:
Expression of introduced genetic sequences in hematopoietic cells following retroviral-mediated gene transfer.
Hum Gene Ther
1:229,
1990[Medline]
[Order article via Infotrieve]
2.
Apperley JF:
Gene therapy: Current status and future directions.
B J Haemat
75:148,
1990
3.
Krauss JC:
Hematopoietic stem cell gene replacement therapy.
Biochim Biophys Acta
1114:193,
1992[Medline]
[Order article via Infotrieve]
4.
Anderson WF:
Human gene therapy.
Science
256:808,
1992[Abstract/Free Full Text]
5.
Miller AD:
Human gene therapy comes of age.
Nature
357:455,
1992[Medline]
[Order article via Infotrieve]
6.
Mulligan RC:
The basic science of gene therapy.
Science
260:926,
1993[Abstract/Free Full Text]
7.
Miller DG,
Mohammed AA,
Miller AD:
Gene transfer by retrovirus vectors occurs only in cells that are actively replicating at the time of infection.
Mol Cell Biol
10:4239,
1990[Abstract/Free Full Text]
8.
Hodgson GS,
Bradley TR:
Properties of haemopoietic stem cells surviving 5-fluorouracil treatment: Evidence for a pre-CFU-S cell?
Nature
281:381,
1979[Medline]
[Order article via Infotrieve]
9.
Lerner C,
Harrison DE:
5-Fluorouracil spares hemopoietic stem cells responsible for long-term repopulation.
Exp Hematol
18:114,
1990[Medline]
[Order article via Infotrieve]
10.
Li C,
Johnson G:
Rhodamine 123 reveals heterogeneity within murine lin, Sca-1+ hemopoietic stem cells.
J Exp Med
175:1443,
1992[Abstract/Free Full Text]
11.
Van Zant G,
Scott-Micus K,
Thompson BP,
Fleischman RA,
Perkins S:
Stem cell quiescence/activation is reversible by serial transplantation and is independent of stromal cell genotype in mouse aggregation chimeras.
Exp Hematol
20:470,
1992[Medline]
[Order article via Infotrieve]
12. (editorial)
Williams DA:
Ex vivo expansion of hematopoietic stem and progenitor cells Robbing Peter to pay Paul?
Blood
81:3169,
1993[Free Full Text]
13.
Srour EF,
Brandt JE,
Briddell RA,
Grigsby S,
Leemhuis T,
Hoffman R:
Long-term generation and expansion of human primitive hematopoietic progenitor cells in vitro.
Blood
81:661,
1993[Abstract/Free Full Text]
14.
Haylock DN,
To LB,
Dowse TL,
Juttner CA,
Simmons PJ:
Ex vivo expansion and maturation of peripheral blood CD34+ cells into the myeloid lineage.
Blood
80:1405,
1992[Abstract/Free Full Text]
15. (suppl)
Sutherland HJ,
Hogge DE,
Eaves CJ:
Growth factor regulation of the maintenance and differentiation of human long-term culture-initiating cells (LTC-IC).
Leukemia
7:S122,
1993
16.
Koller MR,
Palsson MA,
Manchel I,
Palsson BO:
Long-term culture-initiating cell expansion is dependent on frequent medium exchange combined with stromal and other accessory cell effects.
Blood
86:1784,
1995[Abstract/Free Full Text]
17.
Nolta JA,
Kohn DB:
Comparison of the effects of growth factors on retroviral vector-mediated gene transfer and the proliferative status of human hematopoietic progenitor cells.
Hum Gene Ther
1:257,
1990[Medline]
[Order article via Infotrieve]
18.
Hughes PF,
Thacker JD,
Hogge D,
Sutherland HJ,
Thomas TE,
Lansdorp PM,
Eaves CJ,
Humphries RK:
Retroviral gene transfer to primitive normal and leukemic hematopoietic cells using clinically applicable procedures.
J Clin Invest
89:1817,
1992
19.
Dick JE,
Kamel-Reid S,
Murdoch B,
Doedens M:
Gene transfer into normal human hematopoietic cells using in vitro and in vivo assays.
Blood
78:624,
1991[Abstract/Free Full Text]
20.
Larochelle A,
Vormoor J,
Hanenberg H,
Wang JC,
Bhatia M,
Lapidot T,
Moritz T,
Murdoch B,
Xiao XL,
Kato I,
Williams DA,
Dick JE:
Identification of primitive human hematopoietic cells capable of repopulating NOD/SCID mouse bone marrow: Implications for gene therapy.
Nat Med
2:1329,
1996[Medline]
[Order article via Infotrieve]
21.
Brenner MK,
Rill DR,
Moen RC,
Krance RA,
Mirro J Jr,
Anderson WF,
Ihle JN:
Gene-marking to trace origin of relapse after autologous bone-marrow transplantation.
Lancet
341:85,
1993[Medline]
[Order article via Infotrieve]
22.
Brenner MK,
Rill DR,
Holladay MS,
Heslop HE,
Moen RC,
Buschle M,
Krance RA,
Santana VM,
Anderson WF:
Gene marking to determine whether autologous marrow infusion restores long-term haematopoiesis in cancer patients.
Lancet
342:1134,
1993[Medline]
[Order article via Infotrieve]
23.
Traycoff CM,
Kosak ST,
Grigsby S,
Srour EF:
Evaluation of ex vivo expansion potential of cord blood and bone marrow hematopoietic progenitor cells using cell tracking and limiting dilution analysis.
Blood
85:2059,
1995[Abstract/Free Full Text]
24.
Srour E,
Bregni M,
Traycoff C,
Aguero B,
Kosak S,
Hoffman R,
Siena S,
Gianni A:
Long-term hematopoietic culture-initiating cells are more abundant in mobilized peripheral blood grafts than in bone marrow but have a more limited ex vivo expansion potential.
Blood Cells Mol Dis
22:68,
1996[Medline]
[Order article via Infotrieve]
25.
Traycoff CM,
Cornetta K,
Yoder MC,
Davidson A,
Srour EF:
Ex vivo expansion of murine hematopoietic progenitor cells generates classes of expanded cells possessing varying levels of bone marrow repopulating potentials.
Exp Hematol
24:299,
1996[Medline]
[Order article via Infotrieve]
26.
Berardi AC,
Wang A,
Levine JD,
Lopez P,
Scadden DT:
Functional isolation and characterization of human hematopoietic stem cells.
Science
267:104,
1995[Abstract/Free Full Text]
27.
Traycoff CM,
Abboud MR,
Laver J,
Brandt JE,
Hoffman R,
Law P,
Ishizawa L,
Srour EF:
Evaluation of the in vitro behavior of phenotypically defined populations of umbilical cord blood hematopoietic progenitor cells.
Exp Hematol
22:215,
1994[Medline]
[Order article via Infotrieve]
28.
Ladd AC,
Pyatt R,
Gothot A,
Rice S,
McMahel J,
Traycoff CM,
Srour EF:
Orderly process of sequential cytokine stimulation is required for activation and maximal proliferation of primitive human bone marrow CD34+ hematopoietic progenitor cells residing in G0.
Blood
90:658,
1997[Abstract/Free Full Text]
29.
Traycoff C,
Orazi A,
Ladd AC,
Rice S,
McMahel J,
Srour EF:
Proliferation-induced decline of primitive hematopoietic progenitor cell activity is coupled with an increase in apoptosis of ex vivo expanded CD34+ cells.
Exp Hematol
26:53,
1998[Medline]
[Order article via Infotrieve]
30.
Moritz T,
Patel V,
Williams DA:
Bone marrow extracellular matrix molecules improve gene transfer into human hematopoietic cells via retroviral vectors.
J Clin Invest
93:1451,
1994
31.
Bender MA,
Palmer TD,
Gelinas RE,
Miller AD:
Evidence that the packaging signal of Moloney murine leukemia virus extends into gag region.
J Virol
61:1639,
1987[Abstract/Free Full Text]
32.
Cornetta K,
Moen RC,
Culver K,
Morgan RA,
McLachlin JR,
Sturm S,
Selegue JE,
London WT,
Blaese RM,
Anderson WF:
Amphotropic murine leukemia retrovirus is not an acute pathogen for primates.
Hum Gene Ther
1:13,
1990
33.
Gothot A,
Pyatt R,
McMahel J,
Rice S,
Srour EF:
Functional hetergeneity of human CD34+ cells isolated in subcompartments of the G0/G1 phase of the cell cycle.
Blood
90:4384,
1997[Abstract/Free Full Text]
34.
Roe T,
Reynolds TC,
Yu G,
Brown PO:
Integration of murine leukemia virus DNA depends on mitosis.
EMBO J
12:2099,
1993[Medline]
[Order article via Infotrieve]
35.
Nolta JA,
Smogorzewska EM,
Kohn DB:
Analysis of optimal conditions for retroviral-mediated transduction of primitive human hematopoietic cells.
Blood
86:101,
1995[Abstract/Free Full Text]
36.
Deisseroth AB,
Zu Z,
Claxton D,
Hanania EG,
Fu S,
Ellerson D,
Goldberg L,
Thomas M,
Janicek K,
Anderson WF,
Hester J,
Korbling M,
Durett A,
Moen R,
Berenson R,
Heimfeld S,
Hamer J,
Calvert L,
Tibbits P,
Talpaz M,
Kantarjian H,
Champlin R,
Reading C:
Genetic marking shows that Ph+ cells present in autologous transplants of chronic myelogenous leukemia (CML) contribute to relapse after autologous bone marrow in CML.
Blood
83:3068,
1994[Abstract/Free Full Text]
37.
Kohn DB,
Weinberg KI,
Nolta JA,
Heiss LN,
Lenarsky C,
Crooks GM,
Hanley ME,
Annett G,
Brooks JS,
El-Khoureiy A,
Lawrence K,
Wells S,
Moen RC,
Bastian J,
Williams-Herman DE,
Elder M,
Wara D,
Bowen T,
Hershfield MS,
Mullen CA,
Blaese RM,
Parkman R:
Engraftment of gene-modified umbilical cord blood cells in neonates with adenosine deaminase deficiency.
Nat Med
1:1017,
1995[Medline]
[Order article via Infotrieve]
38.
Dunbar CE,
Cottler-Fox M,
O'Shaughnessy JA,
Doren S,
Carter CS,
Berenson R,
Brown S,
Moen RC,
Greenblatt J,
Stewart FM,
Leitman SF,
Wilson W,
Cowan KH,
Young NS,
Nienhuis AW:
Retrovirally marked CD34-enriched peripheral blood and bone marrow cells contribute to long-term engraftment after autologous transplantation.
Blood
85:3048,
1995[Abstract/Free Full Text]
39.
Cornetta K,
Srour EF,
Moore A,
Davidson A,
Broun ER,
Hromas R,
Moen RC,
Morgan RA,
Rubin L,
Anderson WF,
Hoffman R,
Tricot G:
Retroviral gene transfer in autologous bone marrow transplantation for adult acute leukemia.
Hum Gene Ther
7:1323,
1996[Medline]
[Order article via Infotrieve]
40.
Verfaillie CM,
Miller JS:
A novel single-cell proliferation assay shows that long-term culture-initiating cell (LTC-IC) maintenance over time results from the extensive proliferation of a small fraction of LTC-IC.
Blood
86:2137,
1995[Abstract/Free Full Text]
41.
Young JC,
Varma A,
DiGiusto D,
Backer MP:
Retention of quiescent hematopoietic cells with high proliferative potential during ex vivo stem cell culture.
Blood
87:545,
1996[Abstract/Free Full Text]
42.
Emmons RVB,
Doren S,
Zujewski J,
Cottler-Fox M,
Carter CS,
Hines K,
O'Shaughnessy JA,
Leitman SF,
Greenblatt JJ,
Cowan K,
Dunbar CE:
Retroviral gene transduction of adult peripheral blood or marrow-derived CD34+ cells for six hours without growth factors or on autologous stroma does not improve marking efficiency assessed in vivo.
Blood
89:4040,
1997[Abstract/Free Full Text]
43.
Randall TD,
Weissman IL:
Phenotypic and functional changes induced at the clonal level in hematopoietic stem cells after 5-fluorouracil treatment.
Blood
89:3596,
1997[Abstract/Free Full Text]
44.
Luskey BD,
Rosenblatt M,
Zsebo K,
Williams DA:
Stem cell factor, interleukin-3, and interleukin-6 promote retroviral-mediated gene transfer into murine hematopoietic stem cells.
Blood
80:396,
1992[Abstract/Free Full Text]
45.
Brenner MK:
Gene transfer into human hematopoietic progenitor cells: A review of current clinical protocols.
J Hematother
2:7,
1993[Medline]
[Order article via Infotrieve]
46.
Boezeman J,
Raymakers R,
Vierwinden G,
Linssen P:
Automatic analysis of growth onset, growth rate and colony size of individual bone marrow progenitors.
Cytometry
28:305,
1997[Medline]
[Order article via Infotrieve]
47.
Bhatia M,
Bonnet D,
Kapp U,
Wang JCY,
Murdoch B,
Dick JE:
Quantitative analysis reveals expansion of human hematopoietic repopulating cells after short-term ex vivo culture.
J Exp Med
186:619,
1997[Abstract/Free Full Text]
48.
Dao MA,
Hannum CH,
Kohn DB,
Nolta JA:
FLT3 ligand preserves the ability of human CD34+ progenitors to sustain long-term hematopoiesis in immune-deficient mice after ex vivo retroviral-mediated transduction.
Blood
89:446,
1997[Abstract/Free Full Text]
49.
Dao MA,
Yu XJ,
Nolta JA:
Clonal diversity of primitive human hematopoietic progenitors following retroviral marking and long-term engraftment in immune-deficient mice.
Exp Hematol
25:1357,
1997[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
B.-C. Lee, T. Cheng, G. B. Adams, E. C. Attar, N. Miura, S. B. Lee, Y. Saito, I. Olszak, D. Dombkowski, D. P. Olson, et al.
P2Y-like receptor, GPR105 (P2Y14), identifies and mediates chemotaxis of bone-marrowhematopoietic stem cells
Genes & Dev.,
July 1, 2003;
17(13):
1592 - 1604.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. A. Williams, A. W. Nienhuis, R. G. Hawley, and F. O. Smith
Gene Therapy 2000
Hematology,
January 1, 2000;
2000(1):
376 - 393.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Guenechea, J.C. Segovia, B. Albella, M. Lamana, M. Ramirez, C. Regidor, M.N. Fernandez, and J.A. Bueren
Delayed Engraftment of Nonobese Diabetic/Severe Combined Immunodeficient Mice Transplanted With Ex Vivo-Expanded Human CD34+ Cord Blood Cells
Blood,
February 1, 1999;
93(3):
1097 - 1105.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract