|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Blood, Vol. 91 No. 10 (May 15), 1998:
pp. 3693-3701
By
From the Division of Hematology/Oncology and Indiana Elks Cancer
Research Center, Department of Medicine, Department of Pediatrics,
Herman B Wells Center for Pediatric Research, Howard Hughes Medical
Institute, and Department of Microbiology and Immunology, Indiana
University School of Medicine, Indianapolis, IN.
Primitive hematopoietic progenitor cells (HPCs) are potential
targets for treatment of numerous hematopoietic diseases using retroviral-mediated gene transfer (RMGT). To achieve high efficiency of
gene transfer into primitive HPCs, a delicate balance between cellular
activation and proliferation and maintenance of hematopoietic potential
must be established. We have demonstrated that a subpopulation of human
bone marrow (BM) CD34+ cells, highly enriched for primitive
HPCs, persists in culture in a mitotically quiescent state due to their
cytokine-nonresponsive (CNR) nature, a characteristic that may prevent
efficient RMGT of these cells. To evaluate and possibly circumvent
this, we designed a two-step transduction protocol using
neoR-containing vectors coupled with flow
cytometric cell sorting to isolate and examine transduction efficiency
in different fractions of cultured CD34+ cells. BM
CD34+ cells stained on day 0 (d0) with the membrane dye
PKH2 were prestimulated for 24 hours with stem cell factor (SCF),
interleukin-3 (IL-3), and IL-6, and then transduced on fibronectin with
the retroviral vector LNL6 on d1. On d5, half of the cultured cells
were transduced with the retroviral vector G1Na and sorted on d6 into
cytokine-responsive (d6 CR) cells (detected via their loss of PKH2
fluorescence relative to d0 sample) and d6 CNR cells that had not
divided since d0. The other half of the cultured cells were first
sorted on d5 into d5 CR and d5 CNR cells and then infected separately
with G1Na. Both sets of d5 and d6 CR and CNR cells were cultured in
secondary long-term cultures (LTCs) and assayed weekly for transduced
progenitor cells. Significantly higher numbers of G418-resistant
colonies were produced in cultures initiated with d5 and d6 CNR cells
compared with respective CR fractions (P < .05). At week 2, transduction efficiency was comparable between d5 and d6 transduced CR
and CNR cells (P > .05). However, at weeks 3 and 4, d5 and
d6 CNR fractions generated significantly higher numbers of
neoR progenitor cells relative to the respective CR
fractions (P < .05), while no difference in transduction
efficiency between d5 and d6 CNR cells could be demonstrated.
Polymerase chain reaction (PCR) analysis of the origin of transduced
neoR gene in clonogenic cells demonstrated that
mature progenitors (CR fractions) contained predominantly LNL6
sequences, while more primitive progenitor cells (CNR fractions) were
transduced with G1Na. These results demonstrate that prolonged
stimulation of primitive HPCs is essential for achieving efficient RMGT
into cells capable of sustaining long-term in vitro hematopoiesis. These findings may have significant implications for the development of
clinical gene therapy protocols.
HEMATOPOIETIC STEM CELLS, due to their
long-term engraftment potential, are the target cells of choice in
somatic gene therapy for malignant and nonmalignant bone marrow (BM)
disorders.1-3 Retroviral-mediated gene transfer (RMGT)
remains the most attractive means of reliably delivering genetic
material to cells possessing high proliferative
potential.4-6 The major limitation of RMGT is the
requirement for cell division before stable integration of the
retroviral vector into the target cell genome.7 Since "true" stem cells represent a relatively quiescent population of
hematopoietic cells,8-11 transduction efficiency into these cells without cytokine stimulation is low. However, cytokine
stimulation of primitive hematopoietic progenitor cells (HPCs) may
compromise the hematopoietic potential of these cells, since in vitro
activation of HPCs is normally associated with progressive loss of
self-renewal capacity and increased lineage
commitment.12-16 Nevertheless, cytokine stimulation has
been shown to increase gene transduction efficiency into human
committed BM progenitors.17,18 In addition, stable engraftment of retrovirally marked human BM cells in immunodeficient mice19,20 or in clinical gene-marking
studies21,22 suggests transfer of foreign genetic material
into human stem cells.
Recently, our laboratory documented the persistence of a cytokine
nonresponsive (CNR) population of HPCs in short-term cultures and
demonstrated the ability of these cells to sequentially enter the cell
cycle and proliferate.23,24 Furthermore, human CNR cells
were shown to be enriched for long-term hematopoietic
culture-initiating cells,23 and in the murine system were
capable of repopulating the hematopoietic system of lethally irradiated
recipients.25 The identification of CNR
cells,23 which resemble those described by Berardi et
al26 as a group of cells highly enriched for primitive HPCs, raises the question of whether prestimulation of human
CD34+ cells for a relatively short period pre-RMGT
facilitates gene transduction into mature elements of the progenitor
pool but not into the more primitive, mitotically dormant cells. In
support of this contention are the recent studies by Larochelle et
al,20 which demonstrated that although high-efficiency gene
transfer into mature and primitive clonogenic cells was achieved by a
short prestimulation of CD34+ cells followed by RMGT over
recombinant fragments of the extracellular matrix component,
fibronectin, gene transfer into more primitive NOD/SCID repopulating
cells was inefficient.20
Given these observations regarding the nature of CNR cells and the
relative inefficiency of transducing primitive HPCs, we reasoned that
RMGT into cells capable of sustaining prolonged in vitro hematopoiesis
may be enhanced if CNR cells were specifically targeted via prolonged
cytokine stimulation and delayed transduction. In this study, we
transduced BM CD34+ cells at 1, 5, and 6 days after
cytokine stimulation in short-term culture and examined the
contribution of each transduction cycle to gene transfer efficiency in
CNR cells and to the persistence of long-term expression of transduced
genes. We report here that transduction on day 5 (d5) or d6, but not on
d1, resulted in efficient gene transfer into CNR cells, and that only
this fraction of cultured cells was capable of supporting the
production of transduced progenitors for up to 5 weeks. These results
suggest that efficient RMGT into hematopoietic cells may be best
realized by delayed targeting of quiescent primitive HPCs. Furthermore,
our findings define fractions of ex vivo manipulated CD34+
cells that may be responsible for long-term expression of transduced genetic material and offer potential alternatives for improving somatic
gene transfer into hematopoietic stem cells.
BM collection and fractionation.
Human BM aspirates were collected from normal adult subjects after
obtaining informed consent according to guidelines established by the
Investigational Review Board of Indiana University School of Medicine.
Low-density BM cells were recovered by Ficoll-Hypaque (Pharmacia,
Piscataway, NJ) density centrifugation. Cells were fractionated by
immunomagnetic selection to obtain CD34+ cells as
previously described.23,27 All reagents for the
immunomagnetic separation procedure were kindly provided by Baxter
Healthcare (Irvine, CA).
Immunofluorescence staining and flow cytometric cell sorting.
Immunomagnetically enriched BM CD34+ cells were stained on
ice for 20 minutes with fluorescein isothiocyanate (FITC)-conjugated anti-CD34 (Becton Dickinson Immunocytometry Systems [BDIS], San Jose,
CA). Control monoclonal antibodies consisted of
fluorochrome-conjugated, isotype-matched, nonspecific myeloma proteins.
Cells were washed and resuspended for flow cytometric cell sorting in
phosphate-buffered saline (PBS) supplemented with 1% human serum
albumin and were immediately sorted as previously
described23,28 on a FACStarplus flow cytometer
(BDIS). Viability and purity of sorted cells always exceeded 98% and
90%, respectively.
PKH2 staining.
Sorted CD34+ cells were stained with PKH2 (Sigma
ImmunoChemicals, St Louis, MO) before use in short-term culture, per
the manufacturer's instructions and as previously
described.23 Briefly, cells were suspended in 1 mL diluent
(Sigma Immuno Chemical) and immediately transferred into a
polypropylene tube containing 1 mL 4 × 10 Preparation of fibronectin-coated dishes.
Non-tissue culture-grade culture dishes were coated with fibronectin
according to Moritz et al.30 Briefly, the wells were coated
for 2 hours at room temperature with a 30/35-kD protein fragment at a
concentration of 10 µg/cm2 in PBS. Excess protein
solution was aspirated, and the remaining free sites were blocked with
0.5 mL 2% fibronectin-free bovine serum albumin (BSA) in PBS for 20 minutes at room temperature. Excess BSA solution was aspirated, and the
wells were washed with Hanks' balanced salt solution supplemented with
HEPES buffer.
Retroviral vectors.
The two recombinant retroviral vectors used in these studies were LNL6
and G1Na, both of which contained the gene for neomycin resistance
(neoR). The LNL6 vector, which is amphotropically
packaged in the PA317 cell line and has a titer of 1 to 2 × 106 colony-forming units (CFU)/mL, was developed by Bender
et al.31 The G1Na vector was developed by Genetic Therapy
(Gaithersburg, MD) and is packaged in the PA317 cell line.
Similar to LNL6, G1Na also has a titer of 1 to 2 × 106 CFU/mL. Both vectors were negative for
replication-competent retrovirus when tested in the
S+/L Retroviral transduction.
PKH2-stained BM CD34+ cells were incubated overnight at
37°C in 5% CO2 with 100 ng/mL each of stem cell factor
(SCF), interleukin-3 (IL-3), and IL-6. Cells were transduced the next
day (d1) by incubating overnight with LNL6 or G1Na viral supernatant at
a multiplicity of infection (moi) greater than 10:1 on plates coated
with fibronectin, in the presence of 8 µg/mL Polybrene and cytokines.
Following infection, nonadherent cells were collected in IMDM
supplemented with 20% fetal bovine serum while the adherent cells were
treated with 0.5% trypsin-EDTA. Cells were washed twice with medium
and replated with cytokines in tissue culture-grade flat-bottomed 48-well plates in the absence of fibronectin. On d5, cells were harvested and split into two parts. Half of the cells were washed and
stained with phycoerythrin-conjugated CD34 and sorted to yield CD34+ PKH2bright (CNR) and CD34+
PKH2dim (cytokine-responsive [CR]) cells as previously
demonstrated.23 A sample fixed in 1% formaldehyde on d0
immediately after staining of fresh sorted CD34+ cells with
PKH2 was used to establish PKH2 fluorescence corresponding to
nondividing cells. Stringent selection of CNR cells based on PKH2
fluorescence was performed according to previously established procedures.23,28,29 Fractions isolated on d5 are referred to as d5 CNR and d5 CR fractions (Fig 1). These fractions were cultured
overnight in the presence of SCF, IL3, and IL6 and were then transduced
on d6 with G1Na or LNL6 supernatant (using whichever vector was not
used on d1) on fibronectin-coated dishes (plus Polybrene) overnight as
on d1. These cells were subsequently washed and plated in individual
wells of a 48-well plate with SCF, IL-3, and IL-6. The remaining half
of the cells were transduced on day 5 with G1Na or LNL6 supernatant
(using whichever vector was not used on day 1) on fibronectin-coated
dishes plus Polybrene overnight, and then trypsinized, harvested,
washed, and stained with phycoerythrin-conjugated anti-CD34 on d6. The
same strategy used on d5 was applied again to isolate CD34+
PKH2bright (CNR) and CD34+ PKH2dim
(CR) cells. Since these fractions were isolated on d6, they are referred to as d6 CNR and d6 CR fractions (Fig
1). After isolation, d6 CNR and d6 CR cells
were plated in individual wells of a 48-well plate with SCF, IL-3, and
IL-6.
LTC.
Secondary LTCs of the fractions (control and transduced) were
established in 1 mL complete medium in flat-bottomed 48-well plates as
described previously.13,23 Secondary cultures were supplemented at initiation and every 48 hours thereafter with 100 ng/mL
each of SCF, IL-3, and IL-6. At weekly intervals, cultures were
demidepopulated and the remaining cells were replenished with fresh
medium and cytokines. Collected cells were used in HPC assays. For ease
of data presentation, results obtained from cultures established with
control, 1° TC, and 2° TC cells will not be presented in every
figure.
HPC assay.
A total of 103 fresh CD34+ cells or between 2 and 8 × 103 cultured cells were suspended in 35-mm tissue
culture dishes in 1 mL containing 30% FCS, 5 × 10 PCR analysis.
Individual colonies were identified and isolated into microcentrifuge
tubes containing 500 mL PBS. DNA from each colony was extracted as
follows. Cells were pelleted at 2,000g for 7 to 8 minutes at
4°C. All of the supernatant was removed, and the cells were suspended
in 40 µL water. Samples were incubated initially for 10 minutes at
94°C, then at 55°C for 1 hour after addition of 20 µg proteinase
K (Sigma), and finally at 94°C for 15 minutes. DNA extracted from
each colony was split into two parts and tested for the presence of the
neoR gene with two sets of primers specific for
PA317/LNL6 and PA317/G1Na to distinguish the source of the
neoR sequence. The neomycin phosphotransferase gene
from vector G1Na was amplified using the primers 5 Statistical analysis.
Where applicable, data are presented as the mean ± SE. In some
figures and for clarity of presentation, only the positive SE is
depicted. Statistical comparison between paired data from different
groups was performed using a two-tailed t-test.
Evaluation of gene transfer efficiency of LNL6 and G1Na.
To follow retroviral-marked cells in culture, we selected the LNL6 and
G1Na vectors that contain the neoR gene. The
structure of the vectors is similar except for the noncoding region 3 Susceptibility of different fractions of cultured CD34+
cells to G1Na and LNL6.
Since the experimental design involved transduction of different
fractions of ex vivo-expanded CD34+ cells with G1Na or
LNL6 at different time points, we investigated the susceptibility of
these cell fractions to both retroviruses. Total BM CD34+
cells were stained with PKH2 and cultured with SCF, IL3, and IL6, and
on d1, d5, d6, d8, or d9 were transduced with G1Na or LNL6 supernatant.
To distinguish between the susceptibility of fractions of cultured
cells to transduction before and after fractionation, two different
approaches were taken. In the first, cultured CD34+ cells
were separated on d5 and d8 into CNR and CR cells (based on residual
PKH2 fluorescence) and both CNR and CR cells were split into two
fractions, each of which was then transduced with one of the two
retroviral vectors. In the second, cultured CD34+ cells
were first transduced on d6 and d9 and then fractionated into CNR and
CR cells. The data presented in Table 1demonstrate that at any given time point, all groups of cells were
equally transduced with either G1Na or LNL6. It is evident that
regardless of whether cells were exposed to vector before or after
fractionation into CR and CNR cells, these fractions were equally
susceptible to transduction with G1Na and LNL6, and that the highest
degree of gene transfer occurred on d5 and d6 (Table 1). It is
important to point out that on d8 and d9, CNR fractions produced a
higher number of total and G418-resistant colonies compared with their respective CR counterparts, suggesting that targeting CNR fractions may
be essential to achieve efficient RMGT in cells enriched for enhanced
progenitor cell production capacity and possibly primitive hematopoietic potential.
Targeting of CNR cells with RMGT.
Based on the preliminary data shown in Table 1, it was reasoned that
effective gene transfer into CNR cells could be achieved after 5 to 6 days of in vitro prestimulation. Experiments designed to examine this
possibility and to investigate whether transduced CNR cells could
support the long-term production of marked progenitor cells in vitro
were performed according to the schema outlined in Fig 1. A total of
six experiments were performed. In four, LNL6 was used on d1 and G1Na
on d5 and d6, while the sequence was reversed in the other two
experiments. All resulting groups of cells were maintained in
suspension LTC, and the production of total and G418-resistant
clonogenic progenitor cells was assessed.
Transduction efficiency.
Due to the large number of transduced cells required for assay in the
presence of G418 and to the limited number of cells available at the
end of week 1, we opted not to examine any of the infected groups of
cells at this time point. However, transduction efficiency in all of
the groups analyzed was highest at week 2, yet at this time point, no
significant differences (P > .05) in transduction
efficiency between d5 and d6 CNR fractions and their CR counterparts
could be established (Fig 3). As predicted from the production of
transduced clonogenic cells (Fig 2B), transduction efficiency in
cultures established with d5 CR, d6 CR, or 2° TC cells declined
drastically by weeks 3 and 4. In contrast, only a slight decline in
transduction efficiency was observed between weeks 2 and 3 in cultures
established with d5 and d6 CNR cells. This initial maintenance of
transduction efficiency in these cultures was followed by a rapid
decrease between weeks 3 and 5 (Fig 3). During weeks 3 and 4, transduction efficiency was significantly higher in d5 and d6
CNR cultures (P < .05) compared with their respective CR
counterparts and 2° TC cultures. Again, of interest are the analogous
transduction efficiencies observed in cultures initiated with either d5
CNR or d6 CNR cells, suggesting that differences in the methodology
used in isolating these cells did not negatively affect the
hematopoietic function of either fraction.
PCR analysis of G418-resistant colonies.
The design of these experiments necessitated that the primers used to
amplify LNL6 and G1Na sequences be specific for their respective
retroviral vectors and capable of determining the origin of the
neoR gene in transduced cells. DNA extracted from
individual hematopoietic colonies was amplified with G1Na-specific and
LNL6-specific primer pairs separately or together. Only DNAs amplified
by the appropriate primer sets were detected, thus confirming the
specificity of the primers used (Fig
4). We next examined the
fidelity of our PCR assay by investigating whether PCR analysis of
cells exposed to both LNL6 and G1Na at different time points was
capable of identifying the origin of the transduced
neoR gene. Figure 5demonstrates that HPCs successfully transduced with both vectors
displayed the two vector-specific sequences, while those successfully
transduced with only one of the two vectors contained sequences
corresponding to the appropriate vector.
In this study, we investigated the results of early versus delayed RMGT
into human BM CD34+ cells and evaluated the fate of
transduced cells in two cell fractions discernible in culture based on
their proliferative history. Whereas more mitotically active CR cells
displayed a limited ability to produce assayable progenitors, cells
resistant to immediate cytokine stimulation, here termed CNR cells,
were responsible for the maintenance of long-term in vitro
hematopoiesis and continued expression of transduced
neoR genes, demonstrating successful gene transfer
into primitive HPCs. Recent studies by Larochelle et al20
demonstrated that exposure of human CD34+ cells to
retroviral vectors efficiently transduced clonogenic progenitors and
LTC-initiating cells, but not the more primitive SCID repopulating
cells. These investigators20 transduced CD34+
cells after 24 hours of prestimulation with SCF, IL-3, and IL-6 using a
protocol that required up to 48 hours of additional in vitro incubation
during which the cells were exposed to the retroviral vector. Among the
possible explanations as to why SCID repopulating cells were not
genetically marked is the possibility that these cells were not induced
to proliferate during the 72 hours of in vitro manipulation, an event
previously demonstrated to be essential for successful
RMGT.7,34 This study20 and others35
suggest that RMGT into quiescent primitive HPCs is not efficient if
cells are exposed to the retroviral vector within 72 hours of in vitro stimulation. The failure to effectively transduce long-term marrow repopulating cells using a 3-day or shorter transduction protocol has
been previously documented by several investigators.36-39
Submitted October 27, 1997;
accepted December 31, 1997.
1.
Williams DA:
Expression of introduced genetic sequences in hematopoietic cells following retroviral-mediated gene transfer.
Hum Gene Ther
1:229,
1990[Medline]
[Order article via Infotrieve]
2.
Apperley JF:
Gene therapy: Current status and future directions.
B J Haemat
75:148,
1990
3.
Krauss JC:
Hematopoietic stem cell gene replacement therapy.
Biochim Biophys Acta
1114:193,
1992[Medline]
[Order article via Infotrieve]
4.
Anderson WF:
Human gene therapy.
Science
256:808,
1992
5.
Miller AD:
Human gene therapy comes of age.
Nature
357:455,
1992[Medline]
[Order article via Infotrieve]
6.
Mulligan RC:
The basic science of gene therapy.
Science
260:926,
1993
7.
Miller DG,
Mohammed AA,
Miller AD:
Gene transfer by retrovirus vectors occurs only in cells that are actively replicating at the time of infection.
Mol Cell Biol
10:4239,
1990
8.
Hodgson GS,
Bradley TR:
Properties of haemopoietic stem cells surviving 5-fluorouracil treatment: Evidence for a pre-CFU-S cell?
Nature
281:381,
1979[Medline]
[Order article via Infotrieve]
9.
Lerner C,
Harrison DE:
5-Fluorouracil spares hemopoietic stem cells responsible for long-term repopulation.
Exp Hematol
18:114,
1990[Medline]
[Order article via Infotrieve]
10.
Li C,
Johnson G:
Rhodamine 123 reveals heterogeneity within murine lin
11.
Van Zant G,
Scott-Micus K,
Thompson BP,
Fleischman RA,
Perkins S:
Stem cell quiescence/activation is reversible by serial transplantation and is independent of stromal cell genotype in mouse aggregation chimeras.
Exp Hematol
20:470,
1992[Medline]
[Order article via Infotrieve]
12. (editorial)
Williams DA:
Ex vivo expansion of hematopoietic stem and progenitor cells
13.
Srour EF,
Brandt JE,
Briddell RA,
Grigsby S,
Leemhuis T,
Hoffman R:
Long-term generation and expansion of human primitive hematopoietic progenitor cells in vitro.
Blood
81:661,
1993
14.
Haylock DN,
To LB,
Dowse TL,
Juttner CA,
Simmons PJ:
Ex vivo expansion and maturation of peripheral blood CD34+ cells into the myeloid lineage.
Blood
80:1405,
1992
15. (suppl)
Sutherland HJ,
Hogge DE,
Eaves CJ:
Growth factor regulation of the maintenance and differentiation of human long-term culture-initiating cells (LTC-IC).
Leukemia
7:S122,
1993
16.
Koller MR,
Palsson MA,
Manchel I,
Palsson BO:
Long-term culture-initiating cell expansion is dependent on frequent medium exchange combined with stromal and other accessory cell effects.
Blood
86:1784,
1995
17.
Nolta JA,
Kohn DB:
Comparison of the effects of growth factors on retroviral vector-mediated gene transfer and the proliferative status of human hematopoietic progenitor cells.
Hum Gene Ther
1:257,
1990[Medline]
[Order article via Infotrieve]
18.
Hughes PF,
Thacker JD,
Hogge D,
Sutherland HJ,
Thomas TE,
Lansdorp PM,
Eaves CJ,
Humphries RK:
Retroviral gene transfer to primitive normal and leukemic hematopoietic cells using clinically applicable procedures. |
Abstract
Introduction
Abstract
6-mol/L PKH2
in diluent at room temperature. After 5 minutes of incubation with
frequent agitation, 2 mL fetal calf serum ([FCS] Hyclone, Logan, UT)
was added to the suspension for 1 minute. The total volume was brought
to 8 mL with Iscove's modified Dulbecco's medium (IMDM) supplemented
with 10% FCS, L-Glutamine, and antibiotics (complete
medium), and the cells were washed three times in complete medium. All
of the complete medium ingredients (except FCS) were obtained from
BioWhitaker (Walkersville, MD). Antibiotics consisted of penicillin and
streptomycin at 100 U/mL and 100 mg/mL, respectively. After the last
wash, cells were suspended in complete medium and cultured with
cytokines as described later. The validity of the PKH2 staining method
on human BM cells has been previously established.
GAATTCGCGGCCGCTACAAT 3
), d5 CNR (
), d6 CR (
), or d6 CNR
(
) or maintained as 2° TC (
) were used to establish LTCs
supplemented with cytokines. Cultures were demidepopulated every week,
followed by replenishment of half of the medium and cytokines.
Harvested cells were used for clonogenic assays in the presence or
absence of G418. For clarity and ease of presentation, data from each
of the 5 groups of cells are presented as the mean ± SE of assayable
and G418-resistant clonogenic cells detected at the indicated time
points in 6 separate LTCs initiated with BM cells from 6 different
normal donors. Values were normalized to represent data obtained from
cultures initiated with 104 cells. In 4 experiments, LNL6
was used on d1 and G1Na on d5 and d6, while the reverse order was used
in the remaining 2 experiments. *P < .05, the indicated CNR
group v the respective CR group. At weeks 3 and 4, d5 CNR and
d6 CNR values (in A and B) were also statistically different
(P < .05) from those observed in 2° TC. No significant
differences were detected between d5 and d6 CNR cells.
Robbing Peter to pay Paul?
Blood
81:3169,
1993