|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 10 (May 15), 1998:
pp. 3724-3733
Human CD34+ Bone Marrow Cells Regulate Stromal
Production of Interleukin-6 and Granulocyte Colony-Stimulating Factor
and Increase the Colony-Stimulating Activity of Stroma
By
Pankaj Gupta,
Bruce R. Blazar,
Kalpna Gupta, and
Catherine M. Verfaillie
From the Departments of Medicine and Pediatrics, University of
Minnesota Medical School and Veterans Affairs Medical Center,
Minneapolis, MN.
 |
ABSTRACT |
Cytokines produced by stromal cells induce the proliferation and
differentiation of hematopoietic cells in the marrow microenvironment. We hypothesized that cross-talk between hematopoietic cells at different stages of differentiation and stromal cells influences stromal cytokine production and is responsible for maintaining steady-state hematopoiesis and responding to stress situations. We show
that coculture of primitive CD34+ cells in contact with
or separated by a transwell membrane from irradiated human bone marrow
stromal layers induces a fourfold to fivefold increase in interleukin-6
(IL-6) and granulocyte colony-stimulating factor (G-CSF) levels in the
stromal supernatant (SN) during the first week. Levels of both
cytokines decreased to baseline after coculture of CD34+
cells for 3 to 5 weeks. Coculture of more mature
CD15+/CD14 myeloid precursors induced only
a transient 1.5- to 2-fold increase in IL-6 and G-CSF at 48 hours.
Neither CD34+ nor CD15+/CD14
cells produced IL-6, G-CSF, IL-1 , or tumor necrosis factor . When
CD34+ cells were cultured in methylcellulose medium
supplemented with cytokines at concentrations found in stromal SN or
supplemented with stromal SN, a fourfold to fivefold increase in colony
formation was seen over cultures supplemented with erythropoietin (EPO) only. When cultures were supplemented with the increased concentrations of IL-6 and G-CSF detected in cocultures of stroma and
CD34+ cells or when CD34+ cells were
cocultured in methylcellulose medium in a transwell above a stromal
layer, a further increase in the number and size of colonies was seen.
The colony-forming unit-granulocyte-macrophage-stimulating activity
of stromal SN was neutralized by antibodies against G-CSF or IL-6.
These studies indicate that primitive CD34+ progenitors
provide a soluble positive feedback signal to induce cytokine
production by stromal cells and that the observed increase in cytokine
levels is biologically relevant.
 |
INTRODUCTION |
IN STEADY-STATE hematopoiesis,
proliferation and differentiation of immature progenitors occurs in the
bone marrow (BM) microenvironment. It is well known that cytokines
produced locally by stromal cells are responsible for induction of cell
proliferation and differentiation. However, it is less clear how
steady-state levels of mature blood elements are maintained. Cytokines
detectable in the blood of normal donors include interleukin-1
(IL-1 ), IL-3, IL-6, and tumor necrosis factor (TNF- ).1,2 In neutropenic patients, serum levels of
IL-6, granulocyte-colony stimulating factor (G-CSF), and flt3-ligand,
but not granulocyte macrophage-colony stimulating factor (GM-CSF) or
IL-3, increase to the range of 500 to 1,000 pg/mL.2-11 It
is unclear which signals are responsible for the increase in cytokine
levels or if these increased levels of cytokines have functional
importance. We hypothesized that cross-talk between cytokine-producing
stromal cells and immature and mature hematopoietic cells is needed
both to maintain steady-state hematopoiesis and to respond to stress
situations.
Reverse transcription-polymerase chain reaction (RT-PCR) studies on BM
biopsy specimens from healthy volunteers, reflective of in vivo
steady-state hematopoiesis, have shown the presence of IL-6, stem cell
factor (SCF), macrophage inflammatory protein-1 (MIP-1 ),
transforming growth factor (TGF- ), TNF- , and IL-1 but not
G-CSF, GM-CSF, leukemia inhibitory factor (LIF), IL-3, or IL-1
mRNA.12 Stromal cells have also been shown to produce flt3-ligand.13 The in vivo microenvironment is mimicked at
least in part by the in vitro stroma-dependent long-term bone marrow cultures (LTBMCs). As for steady state in vivo hematopoiesis, stromal
supernatants contain picogram concentrations of a few cytokines
including G-CSF, IL-6, and GM-CSF.14-16 Therefore, in the
present studies we used the stromal LTBMC system to determine the
effect of hematopoietic progenitors at different stages of differentiation on stromal secretion of cytokines and the potential of
such cytokines to induce growth of committed clonogenic cells in vitro.
We show that immature CD34+ cells but not maturing
CD15+/CD14 myeloid cells induce an
upregulation of cytokine production by stromal cells and that this is
caused by a soluble factor derived from CD34+ cells. Thus,
these studies show that hematopoietic cells can influence stromal
production of cytokines.
 |
MATERIALS AND METHODS |
Cell separation.
Normal human BM was obtained from healthy volunteer donors after
informed consent. Bone marrow mononuclear cells (BMMNCs) were separated
by using Ficoll-Hypaque (Sigma, St Louis, MO)
centrifugation. CD34+ cells were enriched either by
sequential counterflow elutriation centrifugation and depletion of
lineage committed progenitors using immunomagnetic
beads17-19 or by selection with a Ceprate-LC CD34-avidin
immunoadsorption column (CellPro Inc, Bothell, WA).20 CD34+/HLA-DR (DR ) and
Lin /CD34+/HLA-DR+
(DR+) cells were purified by fluorescence-activated cell
sorting (FACS), as previously described.18 Large cells in
the "rotor off" fraction from counterflow elutriation
centrifugation were separately subjected to FACS to obtain
CD15+/CD14
(15+/14 ) maturing myeloid precursors.
Stromal layers.
Human marrow stromal layers were established from BMMNCs as
described.18 When confluent, the flasks were irradiated
with 1,250 rads. Irradiated stromal feeders were subcultured in 24-well culture plates and maintained at 37°C by weekly replacement of half
the medium with fresh LTBMC medium consisting of Iscove's modified
Dulbecco's medium with 12.5% fetal calf serum (FCS; Hyclone Laboratories, Logan, UT), 12.5% horse serum (StemCell Technologies Inc, Vancouver, Canada), 2 mmol/L L-glutamine (GIBCO BRL, Gaithersburg, MD), 1,000 U/mL penicillin, 100 U/mL streptomycin, and
10 6 mol/L hydrocortisone.18
M2-10B4 cells (a kind gift from Dr C.J. Eaves, Terry Fox Laboratories,
Vancouver, Canada) were cultured in RPMI-1640 plus 10% FCS. When
confluent, cells were irradiated with 2,000 rads and subsequently
maintained in LTBMC medium.
Liquid suspension cultures.
Ten thousand DR+ or DR cells or 10,000 to 50,000 15+/14 cells were cocultured
in contact with irradiated stromal layers or separated from stroma by a
collagen-coated transwell insert (0.4-µm microporous filter; Costar
Corp, Cambridge, MA) in 24-well culture plates in LTBMC medium.
Cultures were incubated in a humidified 5% CO2 atmosphere
at 37°C for up to 5 weeks and maintained by weekly replacement of
half the medium with fresh LTBMC medium.
Supernatants (SNs).
SNs from irradiated cultures of human BM stroma or from cocultures of
hematopoietic progenitors in contact with (stroma contact) or separated
from (stroma noncontact) irradiated stromal layers were harvested 2, 4, or 7 days after a half-medium change during the first week, after
initiation of the cultures, and on day 2 during the third, fourth, and
fifth weeks. SNs were centrifuged at 400g for 10 minutes to
remove cell debris and then frozen at 70°C until use.
Enzyme-linked immunosorbent assays (ELISA) for cytokines.
Cytokine concentrations were measured with commercially available ELISA
kits for human IL-1 (sensitivity 0.3 pg/mL), IL-3 (sensitivity 7.4 pg/mL), IL-6 (sensitivity 0.35 pg/mL), IL-7 (sensitivity 6 pg/mL),
G-CSF (sensitivity 10.9 pg/mL), SCF (sensitivity 3 pg/mL), LIF
(sensitivity 4 pg/mL), basic fibroblast growth factor (bFGF; sensitivity 1 pg/mL), MIP-1 (sensitivity 2 pg/mL), human
platelet-derived growth factor AB (PDGF-AB; sensitivity 8.4 pg/mL; all
kits from R & D Systems, Minneapolis, MN), human GM-CSF (sensitivity 5 pg/mL; Endogen, Boston, MA), human TNF- (sensitivity <10 pg/mL;
Boehringer Mannheim, Indianapolis, IN), and human TGF- (sensitivity
50 pg/mL; total [acid labile + acid stable] TGF- measured;
Genzyme, Cambridge, MA) according to the manufacturers'
recommendations.
Expression of von Willebrand factor (vWf) by marrow cells.
To examine if marrow cells obtained after Ceprate-LC CD34-avidin
immunoadsorption column contained endothelial cells, the cells eluting
after adhesion to the column were stained with CD34-biotin followed by
SA-670, HLA-DR phycoerythrin (PE) and anti-vWf antibody followed by
fluorescein isothiocyanate (FITC)-conjugated secondary antibody.
Control population of the same cells were stained with SA-670, IgG-PE,
and the FITC-conjugated secondary antibody. Briefly, cells were first
stained with the CD34 and HLA-DR antibodies followed by SA-670. Cells
were washed, fixed with 4% paraformaldehyde at room temperature for 20 minutes, permeabilized by 0.1% Triton X-100 for 5 minutes on ice, and
blocked with 3% bovine serum albumin. Cells were then sequentially
stained with the vWf antibody and the secondary antibody. As a positive
control, human microvascular endothelial cells (MECs) grown as
described21 were stained for CD34 and vWf by the same
technique. The expression of vWf by gated marrow cells in the
DR , DR+, and CD34
populations was analyzed by multiparameter flow cytometry.
Preparation of stromal cell RNA and Northern blot analysis.
Allogeneic irradiated human BM stroma was subcultured in 6-well tissue
culture plates in LTBMC medium. Two days after the weekly replacement
of half the medium with fresh LTBMC medium, 50,000 to 500,000 FACS-sorted CD34+ cells or
15+/14 cells were placed either alone or
together into 0.4-µm transwell inserts above stromal feeders for 8 to
24 hours at 37°C. Control wells did not receive hematopoietic cells
(stroma alone). After removal of the transwells containing
hematopoietic cells, stromal layers were washed twice with
phosphate-buffered saline (PBS) and stromal cells were detached by
using trypsin plus EDTA for 5 minutes. After trypsin was neutralized
with cold FCS, cells were pelleted by centrifugation at 4°C and
immediately lysed with 0.35 mL lysis buffer and frozen. Total RNA was
isolated by using the RNeasy method (Qiagen, Chatsworth, CA), estimated
spectrophotometrically, electrophoresed on 1.2% agarose-formaldehyde
gels (10 µg RNA per lane), and transferred to Nytran
nylon membranes (Schleicher & Schuell, Keene, NH), as previously
described.22,23 Blots were hybridized in the presence of
50% formamide, 2× Denhardt's solution, 5× sodium
chloride/sodium phosphate/EDTA buffer (SSPE; Sigma), 0.1% sodium
dodecyl sulfate (SDS), 0.1 mg/mL yeast RNA, and 0.1 mg/mL denatured
salmon sperm DNA to 106 cpm/mL of a human G-CSF cDNA probe
(R & D Systems) labeled with [ -32P]dCTP by random
priming reaction.24,25 Membranes hybridized to cDNA probes
were washed with high stringency buffer consisting of 0.1× sodium
chloride/sodium citrate buffer (SSC; Boehringer Mannheim), 0.1% SDS at
65°C, and autoradiographed at 80°C. After removal of the
first probe, membranes were rehybridized to a probe for -actin as an
internal standard of total RNA loaded per lane.
RT-PCR for G-CSF mRNA.
Total RNA was obtained as described previously from irradiated stromal
feeders alone in 6-well tissue culture plates and from stromal feeders
cocultured with FACS-purified CD34+ cells in transwell
inserts (5 × 104 or 5 × 105 cells
per transwell in 6-well plates; equivalent to 10,000 or 100,000 CD34+ cells, respectively, in 24-well plates).
A semiquantitative RT-PCR technique was used to determine the
expression of G-CSF mRNA transcripts in stroma by using the one-step
Titan RT-PCR system as per the manufacturer's instructions (Boehringer
Mannheim). The following primer sets for human G-CSF were obtained from
Clontech (Palo Alto, CA): upstream primer 5 TTGGACACACTGCAGCTGGACGTCGCCGACTTT 3 and downstream primer
5 ATTGCAGAGCCAGGGCTGGGGAGCAGTCATAGT 3 . In initial
experiments, we standardized RT-PCR quantitation of G-CSF mRNA
transcripts in 0.1 to 4 µg total RNA from stromal layers cultured in
the presence of 100 ng/mL TNF- for 24 hours. We determined by serial
cycle analysis between 25 and 40 cycles of PCR, that 35 cycles were optimal for semiquantitative detection of G-CSF mRNA transcripts. Conditions used were as follows: thermal cycling at 55°C for 30 seconds and 68°C for 1 minute for 35 cycles, followed by 7 minutes extension at 68°C. The amplified products from 1.5 µg total RNA per sample were resolved on 1.5% agarose gel in 1×
Tris-borate-EDTA buffer, pH 8.0 and visualized with 0.5 µg/mL
ethidium bromide. The negative controls were RT-PCR reactions performed
in the absence of any template or in the absence of the enzyme. The
RT-PCR-amplified products resolved on an agarose gel showed a single
band of the expected size for the G-CSF product amplified by the
Clontech primers, in comparison to a positive control, which was the
470-bp amplified product of the specific G-CSF cDNA fragment supplied by Clontech with the G-CSF Amplimer set. The mRNA for human -actin was amplified for 35 cycles in the same PCR tube by using primers from
GIBCO BRL as an internal control for RNA integrity and quantitation. The amplified product was detected as a single band of the expected size (353 bp). The intensity of the ethidium bromide-stained bands was
quantitated by acquiring the image from a Gel Doc apparatus (Biorad,
Hercules, CA) and Molecular Analyst (Molecular Bioscience Group,
Hercules, CA) software.
Cytokines.
Recombinant human cytokines used included G-CSF (Neupogen; Amgen,
Thousand Oaks, CA), GM-CSF (Immunex Corp, Seattle, WA), SCF (a kind
gift from Amgen), LIF (R & D Systems), MIP-1 (R & D Systems), IL-3
and IL-6 (kind gifts from Dr G. Wong, Genetics Institute, Boston, MA),
and EPO (Amgen).
Short-term methylcellulose cultures.
Cells were plated in methylcellulose (final concentration 1.12%)
supplemented with 30% FCS, 3 IU recombinant EPO, and either 5% to
10% SN from the bladder carcinoma cell line 5637, 5 ng/mL IL-3, or
combinations of recombinant human cytokines, as specified. For some
experiments, cells were plated in methylcellulose medium in transwell
inserts placed in 6-well plates containing similar methylcellulose
medium supplemented with 5 ng/mL IL-3 alone or with 25% SN from
irradiated stroma (M2-10B4 stromal cell line). Cells were also plated
in transwell inserts placed in wells containing an intact irradiated
stromal feeder layer (M2-10B4 stromal cell line) in the bottom chamber
in methylcellulose medium that was not supplemented with exogenous
cytokines except for EPO. Cultures were incubated in humidified 5%
CO2 atmosphere at 37°C; burst-forming unit-erythroid
(BFU-E), colony forming unit-mixed (CFU-MIX), and colony-forming unit-granulocyte-macrophage (CFU-GM) were enumerated at
day 14 of culture, as previously described.26 High
proliferative potential colony-forming cells (HPP-CFCs) were enumerated
on day 28.
Inhibition of colony formation by anti-G-CSF and anti-IL-6
antibodies.
The effect of neutralizing antibodies against G-CSF and IL-6 on
stroma-conditioned medium-induced colony formation was examined by
adding the antibodies to methylcellulose cultures at final concentrations of 3 µg/mL anti-G-CSF, 5 µg/mL anti-IL-6, or 5 µg/mL normal goat IgG (all from R & D Systems) on day 0. Cultures were supplemented with additional antibodies at the same concentration on days 4, 7, and 11. Colonies were scored on day 14.
Statistics.
Results of data are reported as the mean ± standard error of the
mean. Levels of significance were determined by two-sided Student's
t-test.
 |
RESULTS |
Production of cytokines by irradiated human marrow stroma.
We determined by ELISA the concentrations of several cytokines known to
influence the proliferation and differentiation of hematopoietic
progenitors in SNs recovered from irradiated stromal feeders 2, 4, and
7 days after a weekly half medium replacement. Picogram amounts of
IL-6, G-CSF, SCF, LIF, MIP-1 , TNF- , and TGF- were detected
(Table 1). IL-1 , IL-3, IL-7, GM-CSF,
bFGF, and PDGF-AB were not measurable. IL-6, SCF, and TGF- increased between day 2 and 7 after medium replacement; the concentration of
G-CSF remained constant, whereas TNF- and MIP-1 levels decreased.
Effect of hematopoietic progenitors and precursors on cytokine
production by stroma.
We next examined if immature hematopoietic progenitors affected stromal
production of cytokines (Fig 1A and B).
Previous studies from our group and others have shown that primitive
progenitors are enriched in the DR population and
committed progenitors in the DR+ population. The average
percentage of CFCs in DR and DR+ cells
is 2% and 8%, respectively; P < .001.18 The
average percentage of long-term culture-initiating cells
(LTC-ICs) in DR cells is
1%.27 Coculture of DR cells, enriched
for LTC-ICs, with irradiated stromal layers induced a fourfold to
fivefold increase in IL-6 and G-CSF concentrations in the medium on
days 2, 4, and 7 during the first week of coculture. The more mature
DR+ cell population, enriched for CFCs but not LTC-ICs,
induced a similar increase in IL-6 and G-CSF levels. In the presence of either DR or DR+ cells, IL-6
concentration was up to 2,643 pg/mL and G-CSF concentration was up to
637 pg/mL during the first week of culture. However, when the cultures
were maintained for 3 to 5 weeks, the concentrations of both cytokines
declined to levels comparable with control irradiated stroma (IL-6
range, 179 to 399 pg/mL; and G-CSF range, 0 to 51 pg/mL).
Concentrations of LIF, MIP-1 , TNF- , TGF- , and IL-1 were not
significantly altered by the presence of CD34+ progenitors
(data not shown). SNs of DR or DR+ cells
incubated in LTBMC medium in the absence of stroma did not contain
detectable levels of IL-6, G-CSF, IL-1 or TNF- during the first
week of culture.

View larger version (17K):
[in this window]
[in a new window]

View larger version (42K):
[in this window]
[in a new window]
| Fig 1.
Stromal production of IL-6 and G-CSF is stimulated by
CD34+ hematopoietic progenitors. Irradiated marrow
stromal layers were subcultured with LTBMC medium in 24-well plates as
described. A total of 10,000 CD34+/HLA-DR+
or CD34+/HLA-DR cells/well were seeded
directly onto the stromal layers (stroma contact, SC) or in a transwell
insert (stroma noncontact, SNC) on day 0. Cytokine levels were
determined by ELISA in SNs obtained on days 2, 4, and 7 during the
first week and on day 2 after a half medium replacement during weeks 3, 4, and 5. (A) Concentration of IL-6 in SN. Numbers within the figure
indicate number of experiments. Comparison between stroma only and
stroma plus progenitors (DR+ or DR cells
in either contact or noncontact): *P < .05. (B) Concentration of G-CSF in SN. Numbers within the figure indicate number of
experiments. Comparison between stroma only and stroma plus progenitors
(DR+ or DR cells in either contact or
noncontact): *P < .05. (C) Comparison between contact and
noncontact cultures on G-CSF and IL-6 concentrations. N = 5.
|
|
To evaluate if the changes in cytokine secretion were mediated by a
cell-cell interaction (stroma-contact cultures) or by soluble
progenitor-derived factors, we also measured cytokine levels in
cultures in which DR+ or DR cells were
cultured separate from the stromal feeder by a transwell (stroma-noncontact cultures; Fig 1C). We have shown that human CD34+ cells cannot migrate through such 0.4-µm transwell
membranes (unpublished observations). As was seen in stroma-contact
cultures, increased levels of IL-6 and G-CSF were found in
stroma-noncontact cultures.
Because endothelial cells may express CD34, we examined if the
CD34+ BM populations contained endothelial cells
(Fig 2). Microvascular endothelial cells
expressed extremely high levels of vWf and variable levels of CD34
(33% MECs were CD34+). In contrast, marrow cells that
adhered to the CD34-immunoadsorption column did not express vWf. This
was similar for the DR , DR+, and for
those cells that adhered to the column but after elution did not stain
for CD34 (CD34 ). These results indicate that the
marrow cells obtained were not contaminated to any significant degree
by endothelial cells.

View larger version (18K):
[in this window]
[in a new window]
| Fig 2.
Expression of vWf by CD34-immunoadsorption column
purified marrow cells. Bone marrow cells adhering to the
CD34-immunoadsorption column and control microvascular endothelial
cells were stained for CD34, HLA-DR, and vWf and analyzed by flow
cytometry, as described in the Materials and Methods. (A) Microvascular
endothelial cells stained with either vWf antibody plus FITC-conjugated
secondary antibody or with the FITC-conjugated secondary antibody; (B)
bone marrow cells stained with the FITC-conjugated secondary antibody; (C) bone marrow cells stained with vWf antibody plus FITC-conjugated secondary antibody.
|
|
Because cytokine levels were no longer elevated in SNs of stroma
cocultured for 3 to 5 weeks with CD34+ cells (Fig 1A and
B), we hypothesized that, on differentiation, myeloid precursors may no
longer affect stromal cytokine production. Therefore, we determined
cytokine levels in cocultures of stroma by using FACS-purified
15+/14 maturing myeloid precursors.
Although levels of G-CSF and IL-6 increased 1.5- to 2-fold at 48 hours
after initiation of the cultures, concentrations of both cytokines
became comparable with baseline stromal levels after 4 to 7 days of
coculture (Fig 3). Again, no differences
were seen on days 2, 4, or 7 between cultures in which
15+/14 cells were cultured in contact
with or separated from the stromal layer (data not shown). As for
CD34+ cells, 15+/14
precursors themselves did not produce detectable concentrations of
IL-6, G-CSF, IL-1 , or TNF- .

View larger version (44K):
[in this window]
[in a new window]
| Fig 3.
Effect of maturing myeloid precursors on stromal
production of IL-6 and G-CSF. From 10,000 to 50,000 CD15+/CD14 myeloid precursors/well were
seeded in contact (stroma contact, SC) or separated by a transwell
insert (stroma noncontact, SNC) from irradiated stromal layers in
24-well plates. SNs were obtained 2 and 7 days after seeding, and
cytokine levels were determined by ELISA. Numbers within the figure
indicate number of experiments. Comparison between stroma only and
stroma plus precursors (cells either in contact with or separated from
stroma): ¥P < .005, ¥¥P < .001.
|
|
To examine the effect of cell concentration on stromal cytokine
production, increasing numbers of CD34+ or
15+/14 cells were plated on stroma and
G-CSF levels in SNs determined on day 4 (Fig 4A). However, the G-CSF level that was
increased fivefold when 10,000 CD34+ cells were cocultured
with stroma was decreased significantly (66% of SN of stromal feeders
without progenitors) when the number of CD34+ cells was
increased to 100,000. In contrast, different concentrations of
15+/14 cells altered stromal cytokine
production only to a small extent, because coculture of 50,000 15+/14 cells increased G-CSF levels in
SNs to 1.6-fold, whereas G-CSF levels were not significantly changed in
the presence of 10,000 or 100,000 15+/14
cells.

View larger version (19K):
[in this window]
[in a new window]
| Fig 4.
Dose response effect of CD34+ and
CD15+/CD14 cells on stromal G-CSF
production. From 10,000 to 100,000 CD34+ or
CD15+/CD14 cells were plated on stromal
layers. SNs were obtained on day 4 and G-CSF levels were determined by
ELISA. G-CSF levels shown as percent of stromal SN is 100%. Numbers
within the figure indicate number of experiments. (A) The indicated
numbers of CD34+ or
CD15+/CD14 cells were plated on stromal
layers. Comparison between stroma and other conditions: *P < .05, ¶P < .02, ¥P < .001. (B) Combinations of CD34+ and CD15+/CD14
cells were plated together on stromal layers. Comparison between stroma
and other conditions: *P < .05.
|
|
To simulate the effect of prolonged coculture of CD34+
cells with stroma, which results in a progressive decrease in
CD34+ cells and increase in
15+/14 cells, we evaluated the effect of
coculture of stroma with combinations of CD34+ cells and
15+/14 on G-CSF levels in the SNs (Fig
4B). Coculture of increasing numbers of
15+/14 cells and decreasing numbers of
CD34+ cells with stroma resulted in a progressive decrease
in G-CSF levels. This effect was similar to the effect on G-CSF levels of prolonged coculture of CD34+ cells with stroma.
G-CSF mRNA transcripts were not detectable by Northern blotting in
irradiated stromal layers in the absence of hematopoietic cells
(Fig 5A). However, an increase in G-CSF
mRNA was detected in stromal layers cocultured with CD34+
cells in transwells. G-CSF mRNA remained undetectable by Northern analysis in stromal layers cocultured with low or high concentrations of 15+/14 cells alone or with
15+/14 cells and CD34+ cells
together. The stimulation of G-CSF mRNA levels by CD34+
cells was further confirmed by RT-PCR. G-CSF mRNA transcripts were
detected in stroma cultured in the absence of CD34+ cells
(Fig 5B). A dose-dependent increase in G-CSF mRNA was seen on coculture
of stroma with 5 × 104 CD34+ cells/well
in 6-well plates (twofold increase by densitometric analysis compared
with stroma cultured in the absence of CD34+ cells) and
further on coculture with 5 × 105 CD34+
cells/well (fourfold increase by densitometric analysis compared with
stroma cultured in the absence of CD34+ cells). Thus,
although G-CSF protein levels are reduced in the SN in the presence of
100,000 CD34+ cells/well of 24-well plates, stromal G-CSF
mRNA levels are increased. Because CD34+ cells were
cultured in transwell inserts, which were removed before obtaining RNA
from the stromal feeders in the lower chamber, these results further
show that the G-CSF detected in the SN is produced by the stromal cells
in response to stimulation by a soluble factor from CD34+
cells.

View larger version (17K):
[in this window]
[in a new window]

View larger version (32K):
[in this window]
[in a new window]
| Fig 5.
CD34+ cells stimulate stromal G-CSF mRNA.
The indicated numbers of FACS-sorted CD34+ cells,
CD15+/CD14 cells, or both together were
plated in transwell inserts above stromal feeders for 24 hours before
obtaining stromal cell RNA. (A) Northern analysis, showing increased
stromal G-CSF mRNA in the presence of CD34+ cells. (B)
RT-PCR-amplified products resolved on 1.5% agarose gel, showing a
dose-dependent increase in G-CSF mRNA transcripts with increasing
numbers of CD34+ cells. The positive control was the
specified 470 bp cDNA product of human G-CSF obtained from Clontech.
The 353-bp amplified product of -actin is shown as an internal
control for RNA.
|
|
The picogram concentrations of cytokines in stromal SNs stimulate
progenitor growth.
We then examined the biological relevance of these cytokine
concentrations. Culture of CD34+ cells in methylcellulose
medium in the presence of EPO and cytokines at the concentrations found
in stromal SNs devoid of hematopoietic cells resulted in a fivefold
increase in CFU-GM compared with cultures supplemented with EPO alone
(Fig 6). This was 70% of CFU-GM growth
seen in cultures supplemented with EPO and 5 ng/mL IL-3. Likewise,
CFU-MIX growth in the presence of the cytokine combination was 50% to
60% of that seen with IL-3, whereas no CFU-MIX were seen in cultures
supplemented with EPO alone. However, the growth of day-28 HPP-CFCs was
not supported by these concentrations of cytokines. Addition of stromal
SN itself to CD34+ clonogenic cultures increased growth of
CFU-GM by 10-fold compared with cultures supplemented with EPO alone
and resulted in a growth of 99% of CFU-GM and 70% CFU-MIX compared
with IL-3 (Fig 7). The size of colonies in
the presence of the nanogram concentration (5 ng/mL) of IL-3 was
significantly larger than in cultures supplemented with the picogram
concentrations of cytokines or with stromal SN.

View larger version (25K):
[in this window]
[in a new window]
| Fig 6.
Progenitor growth is stimulated by the concentrations of
cytokines present in stromal SN. From 2,000 to 4,000 CD34+ cells/well were plated in methylcellulose cultures
supplemented with 5 ng/mL IL-3 alone, 5% conditioned medium from 5,637 cells, or with a combination of recombinant human cytokines in
concentrations comparable with stromal SN (50 pg/mL G-CSF, 5 pg/mL
GM-CSF, 35 pg/mL SCF, 15 pg/mL LIF, 250 pg/mL IL-6, and 75 pg/mL
MIP-1 ). All cultures were supplemented with 3 IU/mL recombinant EPO.
The no-cytokine cultures were not supplemented with any cytokines other
than EPO. BFU-E, CFU-MIX, and CFU-GM colonies were enumerated on day 14 and HPP-CFC on day 28. Numbers within the figure indicate number of
experiments. Comparison between no cytokines and SN concentrations are
as follows: **P < .01, ¥P < .005, ¥¥P < .001.
|
|

View larger version (32K):
[in this window]
[in a new window]
| Fig 7.
Stimulation of progenitor growth is increased in
cocultures of CD34+ cells with stroma. A total of 2,000 or 5,600 DR+ cells/well were plated in methylcellulose
medium in transwell inserts placed in 6-well plates containing similar
methylcellulose medium. Cultures were supplemented with 5 ng/mL IL-3
alone or with 25% SN from irradiated stroma grown in a separate plate
(stroma conditioned medium; M2-10B4 stromal cell line).
Equal numbers of cells were also plated in transwell inserts directly
above an intact irradiated stromal feeder layer (M2-10B4 stromal cell line) in the bottom chamber in methylcellulose medium not supplemented with exogenous cytokines (stroma coculture). Cells were also plated directly in 24-well plates in methylcellulose medium supplemented with
cytokines comparable with stromal SN (SN concentration cytokines), as
described for Fig 6. Numbers within the figure indicate number of
experiments. Comparison between stroma coculture and other conditions
are as follows: ¥P < .005, ¥¥P < .001.
|
|
We further examined if the increase in cytokine concentrations was a
result of coculture of progenitors with stroma increased colony growth.
Coculture of progenitors in a transwell above stromal feeders
increased CFU-GM growth 1.6-fold and CFU-MIX growth 3-fold when
compared with cultures supplemented with SN from hematopoietic cell-free stromal feeders (Fig 7). Colony growth in coculture was also
increased compared with cultures supplemented with cytokines in
concentrations found in stromal cultures without CD34+
cells. Colonies in the coculture conditions were larger than those in
cultures supplemented with cytokines or stromal SN. The addition of
neutralizing antibodies against G-CSF, IL-6, or both completely
abrogated the stimulation of CFU-GM growth by stroma conditioned medium
(Fig 8). The growth of BFU-E was not
affected by the neutralizing antibodies (data not shown). Thus,
stimulation of CFU-GM growth by stroma is largely attributable to the
G-CSF and IL-6 present in the stromal SN.

View larger version (15K):
[in this window]
[in a new window]
| Fig 8.
Stimulation of CFU-GM growth is inhibited by antibodies
against G-CSF and IL-6. A total of 2,000 DR+ cells/well
were plated in methylcellulose cultures supplemented with either 5 ng/mL IL-3 alone or conditioned medium from irradiated human stroma
(final concentration 50%). All cultures were supplemented with 3 IU/mL
recombinant EPO. Neutralizing antibodies against human G-CSF, human
IL-6, or normal goat IgG were added on days 0, 4, 7, and 11 to the
indicated wells, which were supplemented with stroma conditioned
medium. N = 4. Comparison between stroma CM or goat IgG and other
conditions: *P < .05.
|
|
Supplementation of cultures with IL-6 and G-CSF at concentrations found
in cocultures of stromal cells and CD34+ cells (1,000 pg/mL
IL-6 and 250 pg/mL G-CSF) and low levels (equivalent to SN
concentration) of other stromal cytokines also resulted in an increase
in CFU-GM growth compared with cultures supplemented with cytokines in
concentrations found in stromal cultures without CD34+
cells (Fig 9).

View larger version (15K):
[in this window]
[in a new window]
| Fig 9.
Stimulation of progenitor growth is increased by the
higher levels of IL-6 and G-CSF present in stromal cocultures. A total of 4,000 CD34+ cells/well were plated in methylcellulose
medium supplemented with no cytokines or with a combination of
recombinant human cytokines in concentrations comparable with stromal
SN (5 pg/mL GM-CSF, 35 pg/mL SCF, 15 pg/mL LIF, and 75 pg/mL MIP-1 )
and IL-6 and G-CSF either at the concentrations present in stromal SN
(250 pg/mL IL-6 and 50 pg/mL G-CSF) or at the concentrations present in
cocultures of stroma with CD34+ cells (1,000 pg/mL IL-6
and 250 pg/mL G-CSF). All cultures were supplemented with 3 IU/mL
recombinant EPO. Colonies were enumerated on day 14. N = 4. Comparison between SN concentration cytokines and SN concentration
cytokines with higher concentrations of IL-6 and G-CSF: **P < .01.
|
|
 |
DISCUSSION |
This study confirms and extends previous reports showing that
irradiated stromal feeders from long-term marrow cultures produce a
number of growth-promoting and inhibitory cytokines in picogram concentrations.14-16,28 In addition, we show here that the
concentration of at least two of these cytokines, G-CSF and IL-6,
increases when DR and DR+ populations,
enriched in immature progenitors including CFCs and LTC-ICs, are
cocultured in contact with or separated from stromal feeders. This
suggests that these primitive progenitors produce a soluble factor that
increases stromal cytokine production. Once these cells mature into
terminally differentiated myeloid cells after 3 to 5 weeks of culture,
cytokine concentrations return to basal levels. Finally, these changes
in cytokine levels have potential biological relevance, because
significantly more CFCs are induced to grow when cultured with
cytokines at concentrations similar to those in stromal cultures seeded
with CD34+ cells than in cytokines at concentrations
similar to progenitor-free stromal cultures.
Cytokines produced locally in the marrow microenvironment are necessary
for the induction of proliferation, differentiation, and maturation of
hematopoietic stem cells into mature precursors and blood elements.
Under steady-state conditions, production of normal precursors and
blood cells remains fairly constant, whereas this process is
accelerated under conditions of stress or after myelosuppression.
However, the mechanisms that regulate steady-state and accelerated
hematopoiesis are not well known. Our studies indicate that immature
CD34+ progenitors may provide a positive feedback signal to
stromal cells present in the marrow microenvironment to increase the
availability of cytokines necessary for their proliferation and
differentiation into more mature cells. The heterogeneity in the levels
of IL-6 and G-CSF measured in the cocultures of CD34+ cells
and stromal layers from various donors is in agreement with the range
of concentrations of these cytokines reported from in
vitro14,16 and in vivo2-7 studies and likely
reflects inherent biological variability. Although the level of G-CSF
in the SN was reduced when a large number of CD34+ cells
were plated with stroma, the level of stromal G-CSF mRNA was increased,
as detected by both Northern analysis and RT-PCR. This suggests that
although both low and high numbers of CD34+ cells stimulate
stromal G-CSF production, the reduced level of protein in the SN in the
presence of higher numbers of progenitors may be a result of
consumption of cytokines by the progenitors, which is in agreement with
earlier reports.29-31 After prolonged coculture of
CD34+ cells with stromal feeders, which results in the
production of neutrophils and macrophages and the disappearance of the
majority of the immature CD34+ cells, levels of IL-6 or
G-CSF are not increased above those found in progenitor-free cultures.
Of interest is the observation that coculture of CD34+
cells enriched for CFCs and LTC-ICs increased IL-6 and G-CSF concentrations, whereas this was not seen for more mature precursors and neutrophils present in the CD15+ population. The
addition of 10,000 to 100,000 15+/14
cells/well did not significantly reduce the level of cytokines in
stromal SNs, nor was the level of stromal G-CSF mRNA detectably altered
in the presence of these cells. Therefore, the return to baseline after
prolonged coculture of CD34+ progenitors with stromal
feeders is unlikely to be the result of consumption of the cytokines by
maturing precursors. These data suggest that once sufficient mature
precursors and blood cells are present or the number of
CD34+ cells falls underneath a certain threshold, signals
to increase cytokine levels may cease to be produced.
Recent studies indicate that leukemic blasts or myeloma cells stimulate
stromal cytokine production.32,33 However, although coculture of malignant cells with marrow stromal feeders induces cytokine production, direct contact between these cells and stromal elements is required. In contrast, we show that coculture of normal human CD34+ cells either in direct contact with stromal
cells or separated from the stromal cells by a 0.4-µm filter membrane
results in equivalent increases in G-CSF and IL-6 levels. This
indicates that the cytokine induction occurs through a soluble factor
released by CD34+ cells and does not require cell-cell
interaction. These results are in agreement with recent studies showing
that CD34+ cells stimulate IL-6 production by osteoblasts
via an unidentified soluble factor.31 However,
CD34+ cells do not stimulate G-CSF production by
osteoblasts, unlike the effect of CD34+ cells on irradiated
stromal layers, which are composed of a variety of cell types. It is
possible that differences in the culture media used for osteoblast
culture31 and the LTBMC medium used in the present study,
such as the concentration and source of serum and presence of
hydrocortisone, may have contributed to the differences observed. IL-6
and G-CSF production in fibroblasts, monocytes, and endothelial cells
can be upregulated by lipopolysaccharide, IL-1 , IL-1 , or
TNF- .34-41 However, SNs of CD34+ cells kept
in culture do not contain IL-1 or TNF- . Further, Taichman et
al31 showed that neutralizing antibodies against IL-1 or
TNF- did not abrogate the stimulatory effect of CD34+
cells on osteoblast cytokine production. Therefore, the nature of the
soluble factor(s) responsible for this effect remains unidentified.
These in vitro results are reminiscent of what is observed clinically.
Serum levels of IL-6 and G-CSF found in patients with neutropenia after
chemotherapy or after transplant are elevated to a similar degree as
what we observed in stromal cultures seeded with CD34+
cells.2-10 Once the peripheral blood neutrophil count
recovers to over 0.5 × 109/L, serum G-CSF levels
decrease to baseline.3 Thus, the decrease in IL-6 and G-CSF
levels seen in vitro in stroma-dependent cultures containing
progressively increasing numbers of mature precursors and neutrophils
mimics the cytokine/blood cell homeostasis observed clinically. Several
clinical studies have indicated that these variations in cytokine
levels have biological repercussions. The degree of G-CSF or IL-6
elevation after marrow aplasia correlates with the speed of
hematopoietic recovery.3,10 Furthermore, Migliaccio et
al15 have shown that conditioned medium from stromal cells
obtained from patients with delayed engraftment after transplant contains significantly less G-CSF and supports growth of CFU-GM in
vitro significantly less well than SNs from stromal cells obtained from
normal individuals or patients who engrafted in a timely manner after
transplant. Here we show that the concentrations of cytokines found in
SNs of progenitor-free irradiated stromal cultures can support growth
of CFU-GM and, to a lesser extent, more primitive CFU-MIX and HPP-CFCs.
Routinely, in vitro clonogenic methylcellulose assays are supplemented
with nanogram rather than picogram concentrations of one or more
cytokines. Our studies show that a mixture of picogram concentrations
of a number of cytokines produced in the marrow microenvironment is
sufficient to induce growth of progenitors, although the colony size is
smaller than when cultures are supplemented with 5 ng/mL IL-3. In
addition, we have previously shown that the same cytokines in picogram
concentrations (500 pg/mL G-CSF, 50 pg/mL GM-CSF, 200 pg/mL SCF, 50 pg/mL LIF, 200 pg/mL MIP-1 , and 2 ng/mL IL-6) are capable of
sustaining generation of CFU-GM for up to 5 weeks in long-term
stroma-free cultures initiated with DR
cells.42 As is suggested by the in vivo effects of
increased levels of G-CSF and IL-6, our in vitro studies show that a
fivefold higher concentration of IL-6 and G-CSF significantly increases the growth of CFU-GM. Even greater increases in CFU-GM and CFU-MIX colony number and colony size were seen when CD34+ cells
were cultured above the stromal feeders for 14 days. This suggests that
additional stromal cytokines that are active on immature progenitors,
such as IL-11 or flt-3 ligand, which were not measured and not added to
the cultures, may also be important regulators of steady-state and
stress hematopoiesis. Alternatively, the superior growth of CFCs in
cocultures may be the result of the continuous supply of cytokines
provided by the stromal layer in contrast to cytokine-or
SN-supplemented cultures, in which picogram concentrations of cytokines
are provided only at the initiation of the 2-week culture.
In conclusion, our studies show that cytokine production by the stromal
cells of the marrow microenvironment is regulated by the presence or
absence of hematopoietic progenitors at specific stages of
differentiation. The nature of the positive feedback signal emanated by
primitive CD34+ cells that induces cytokine production is
currently under study.
 |
FOOTNOTES |
Submitted April 22, 1997;
accepted January 9, 1998.
Supported by National Institutes of Health Grant No. R01-HL-49930, the
United States Department of Veterans Affairs, the Minnesota Medical
Foundation, the University of Minnesota Bone Marrow Transplant Research
Fund, and the University of Minnesota Hospital and Clinic. C.M.V. is a
Scholar of the Leukemia Society of America.
Address reprint requests to Catherine M. Verfaillie, MD, Department of
Medicine, Box 806 UMHC, 420 Delaware St SE, Minneapolis, MN 55455.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
 |
ACKNOWLEDGMENT |
The authors acknowledge the excellent technical assistance of Joseph
Brazil, Dr Angela Panoskaltsis-Mortari and the University of Minnesota
Cytokine Reference Laboratory, Todd Lenvik, Brad Anderson, and Nathalie
Dellare.
 |
REFERENCES |
1. Anon: Levels of IL-1 , IL-3, IL-6, IL-7, TNF- and basic FGF
in normal blood and urine. Cytokine Bulletin. Minneapolis, MN, R & D
Systems, Spring 1994, p 3
2.
Watari K,
Asano S,
Shirafuji N,
Kodo H,
Ozawa K,
Takaku F,
Kamachi S-I:
Serum granulocyte colony-stimulating factor levels in healthy volunteers and patients with various disorders as estimated by enzyme immunoassay.
Blood
73:117,
1989[Abstract/Free Full Text]
3.
Cairo MS,
Suen Y,
Sender L,
Gillan ER,
Ho W,
Plunkett JM,
van de Ven C:
Circulating granulocyte colony-stimulating factor (G-CSF) levels after allogeneic and autologous bone marrow transplantation: Endogenous G-CSF production correlates with myeloid engraftment.
Blood
79:1869,
1992[Abstract/Free Full Text]
4.
Sallerfors B,
Olofsson T,
Lenhoff S:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) and granulocyte colony-stimulating factor (G-CSF) in serum in bone marrow transplanted patients.
Bone Marrow Transplant
8:191,
1991[Medline]
[Order article via Infotrieve]
5.
Rabinowitz J,
Petros WP,
Stuart AR,
Peters WP:
Characterization of endogenous cytokine concentrations after high-dose chemotherapy with autologous bone marrow support.
Blood
81:2452,
1993[Abstract/Free Full Text]
6.
Kawano Y,
Takaue Y,
Saito S-I,
Sato J,
Shimizu T,
Suzue T,
Hirao A,
Okamoto Y,
Abe T,
Watanabe T,
Kuroda Y,
Kimura F,
Motoyoshi K,
Asano S:
Granulocyte colony-stimulating factor (G-CSF), macrophage-CSF, granulocyte-macrophage-CSF, interleukin-3 and interleukin-6 levels in sera from children undergoing blood stem cell autografts.
Blood
81:856,
1993[Abstract/Free Full Text]
7.
Chasty RC,
Lamb WR,
Gallati H,
Roberts TE,
Brenchley PEC,
Yin JAL:
Serum cytokine levels in patients undergoing bone marrow transplantation.
Bone Marrow Transplant
12:331,
1993[Medline]
[Order article via Infotrieve]
8.
Schwaighofer H,
Herold M,
Schwarz T,
Nordberg J,
Ceska M,
Prior C,
Nachbaur D,
Weyrer W,
Brankova J,
Eibl B,
Tilg H,
Bowden R,
Niederwieser D:
Serum levels of interleukin 6, interleukin 8 and C-reactive protein after human allogeneic bone marrow transplantation.
Transplantation
58:430,
1994[Medline]
[Order article via Infotrieve]
9.
Shimazaki C,
Uchiyama H,
Fujita N,
Araki S-I,
Sudo Y,
Yamagata N,
Ashihara E,
Goto H,
Inaba T,
Haruyama H,
Nakagawa M:
Serum levels of endogenous and exogenous granulocyte colony-stimulating factor after autologous blood stem cell transplantation.
Exp Hematol
23:1497,
1995[Medline]
[Order article via Infotrieve]
10. (abstr)
Beck JT,
Hayden K,
Barlogie B,
Jagannath S:
Early elevation of serum interleukin-6 (IL-6) predicts rapid platelet recovery following high-dose melphalan and autologous marrow transplantation (ABMT) in multiple myeloma.
Proc Am Assoc Cancer Res
33:266,
1992
11.
Lyman SD,
Seaberg M,
Hanna R,
Zappone J,
Brasel K,
Abkowitz JL,
Prchal JT,
Schultz JC,
Shahidi NT:
Plasma/serum levels of flt3 ligand are low in normal individuals and highly elevated in patients with Fanconi anemia and acquired aplastic anemia.
Blood
86:4091,
1995[Abstract/Free Full Text]
12.
Cluitmans FHM,
Esendam BHJ,
Landegent JE,
Willemze R,
Falkenburg JHF:
Constitutive in vivo cytokine and hematopoietic growth factor gene expression in the bone marrow and peripheral blood of healthy individuals.
Blood
85:2038,
1995[Abstract/Free Full Text]
13.
Lisovsky M,
Braun SE,
Ge Y,
Takahira H,
Lu L,
Savchenko VG,
Lyman SD,
Broxmeyer HE:
Flt3-ligand production by human bone marrow stromal cells.
Leukemia
10:1012,
1996[Medline]
[Order article via Infotrieve]
14.
Mielcarek M,
Roecklein BA,
Torok-Storb B:
CD14+ cells in granulocyte colony-stimulating factor (G-CSF)-mobilized peripheral blood mononuclear cells induce secretion of interleukin-6 and G-CSF by marrow stroma.
Blood
87:574,
1996[Abstract/Free Full Text]
15.
Migliaccio AR,
Migliaccio G,
Johnson G,
Adamson JW,
Torok-Storb B:
Comparative analysis of hematopoietic growth factors released by stromal cells from normal donors or transplanted patients.
Blood
75:305,
1990[Abstract/Free Full Text]
16.
Guba SC,
Sartor CI,
Gottschalk LR,
Ye-Hu J,
Mulligan T,
Emerson SG:
Bone marrow stromal fibroblasts secrete interleukin-6 and granulocyte-macrophage colony-stimulating factor in the absence of inflammatory stimulation: Demonstration by serum-free bioassay, enzyme-linked immunosorbent assay and reverse transcriptase polymerase chain reaction.
Blood
80:1190,
1992[Abstract/Free Full Text]
17.
Brandt J,
Srour E,
van Besien K,
Bridell RA,
Hoffman R:
Cytokine-dependent long term culture of highly enriched hematopoietic progenitor cells from human bone marrow.
J Clin Invest
86:932,
1990
18.
Verfaillie C,
Blakolmer K,
McGlave P:
Purified primitive human hematopoietic progenitor cells with long-term in vitro repopulating capacity adhere selectively to irradiated bone marrow stroma.
J Exp Med
172:509,
1990[Abstract/Free Full Text]
19.
Verfaillie CM,
Miller WJ,
Boylan K,
McGlave PB:
Selection of benign primitive hematopoietic progenitors in chronic myelogenous leukemia on the basis of HLA-DR antigen expression.
Blood
79:1003,
1992[Abstract/Free Full Text]
20.
Berenson RJ,
Andrews RG,
Bensinger WI,
Kalamasz D,
Knitter G,
Buckner CD,
Bernstein ID:
Antigen CD34+ marrow cells engraft lethally irradiated baboons.
J Clin Invest
81:951,
1988
21.
Gupta K,
Ramakrishnan S,
Browne PV,
Solovey A,
Hebbel RP:
A novel technique for culture of human dermal microvascular endothelial cells under either serum-free or serum-supplemented conditions: Isolation by panning and stimulation with vascular endothelial growth factor.
Exp Cell Res
230:244,
1997[Medline]
[Order article via Infotrieve]
22. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1989
23.
Thomas PS:
Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose.
Proc Natl Acad Sci USA
77:5201,
1980[Abstract/Free Full Text]
24.
Feinberg AP,
Vogelstein B:
A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity.
Anal Biochem
132:6,
1983[Medline]
[Order article via Infotrieve]
25.
Zupo S,
Perussia B,
Baldi L,
Corcione A,
Dono M,
Ferrarini M,
Pistoia V:
Production of granulocyte-macrophage colony-stimulating factor but not IL-3 by normal and neoplastic human B lymphocytes.
J Immunol
148:1423,
1992[Abstract]
26.
McGlave PB,
Mamus S,
Vilen B,
Dewald G:
Effect of recombinant gamma interferon on chronic myeloid leukemia bone marrow progenitors.
Exp Hematol
15:331,
1987[Medline]
[Order article via Infotrieve]
27.
Verfaillie CM:
Direct contact between human primitive hematopoietic progenitors and bone marrow stroma is not required for long-term in vitro hematopoiesis.
Blood
79:2821,
1992[Abstract/Free Full Text]
28.
Burroughs J,
Gupta P,
Blazar B,
Verfaillie CM:
Diffusible factors from the murine cell line M2-10B4 support human in vitro hematopoiesis.
Exp Hematol
22:1095,
1994[Medline]
[Order article via Infotrieve]
29. (abstr, suppl)
Zandstra PW,
Petzer AL,
Eaves CJ,
Piret JM:
Very high concentrations of cytokines are required for the maximal stimulation in vitro of primitive human hematopoietic progenitors (LTC-IC) and are depleted most rapidly by subpopulations of cells that are highly enriched in their LTC-IC content.
Blood
86:422a,
1995
30.
Koller MR,
Bradley MS,
Palsson BØ:
Growth factor consumption and production in perfusion cultures of human bone marrow correlate with specific cell production.
Exp Hematol
23:1275,
1995[Medline]
[Order article via Infotrieve]
31.
Taichman RS,
Reilly MJ,
Verma RS,
Emerson SG:
Augmented production of interleukin-6 by normal human osteoblasts in response to CD34+ hematopoietic bone marrow cells in vitro.
Blood
89:1165,
1997[Abstract/Free Full Text]
32.
Yoshikubo T,
Ozawa K,
Takahashi K,
Nishikawa M,
Horiuchi N,
Tojo A,
Tani K,
Kodama H,
Asano S:
Adhesion of NFS-60 myeloid leukemia cells to MC3T3-G2/PA6 stromal cells induces granulocyte colony-stimulating factor production.
Blood
84:415,
1994[Abstract/Free Full Text]
33.
Chauhan D,
Uchiyama H,
Akbarali Y,
Urashima M,
Yamamoto K-I,
Liberman TA,
Anderson KC:
Multiple myeloma cell adhesion-induced interleukin-6 expression in bone marrow stromal cells involves activation of NF- B.
Blood
87:1104,
1996[Abstract/Free Full Text]
34.
Bagby GC:
Interleukin-1 and hematopoiesis.
Blood Rev
3:152,
1989[Medline]
[Order article via Infotrieve]
35.
Broudy VC,
Kaushansky K,
Harlan JM,
Adamson JW:
Interleukin-1 stimulates human endothelial cells to produce granulocyte macrophage colony-stimulating factor and granulocyte colony-stimulating factor.
J Immunol
139:464,
1987[Abstract]
36.
Demetri G,
Ernst T,
Pratt E II,
Zenzie B,
Rheinwald J,
Griffin J:
Expression of ras oncogenes in cultured human cells alters the transcriptional and posttranscriptional regulation of cytokine genes.
J Clin Invest
86:1261,
1990
37.
Ernst TJ,
Ritchie AR,
Demetri GD,
Griffin JD:
Regulation of granulocyte-and monocyte-colony stimulating factor mRNA levels in human blood monocytes is mediated primarily at a post-transcriptional level.
J Biol Chem
264:5700,
1989[Abstract/Free Full Text]
38.
Koeffler HP,
Gasson J,
Tobler A:
Transcriptional and posttranscriptional modulation of myeloid colony-stimulating factor expression by tumor necrosis factor and other agents.
Mol Cell Biol
8:3432,
1988[Abstract/Free Full Text]
39.
Nordan R,
Potter M:
A macrophage-derived factor required by plasmacytomas for survival and proliferation in vitro.
Science
233:566,
1986[Abstract/Free Full Text]
40.
Sironi M,
Breviario F,
Proserpio P,
Biondi A,
Vecchi A,
Van Damme J,
Dejana E,
Mantovani A:
IL-1 stimulates IL-6 production in endothelial cells.
J Immunol
142:549,
1989[Abstract]
41.
Van Damme J,
Cayphas S,
Opdenakker G,
Billiau A,
Van Snick J:
Interleukin-1 and poly(r1).poly(rC)induce production of a hybridoma growth factor by human fibroblasts.
Eur J Immunol
17:1,
1987[Medline]
[Order article via Infotrieve]
42.
Gupta P,
McCarthy JB,
Verfaillie CM:
Stromal fibroblast heparan sulfate is required for cytokine-mediated ex vivo maintenance of human long-term culture-initiating cells.
Blood
87:3229,
1996[Abstract/Free Full Text]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Trikha, R. Corringham, B. Klein, and J.-F. Rossi
Targeted Anti-Interleukin-6 Monoclonal Antibody Therapy for Cancer: A Review of the Rationale and Clinical Evidence
Clin. Cancer Res.,
October 15, 2003;
9(13):
4653 - 4665.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-J. Lataillade, D. Clay, P. Bourin, F. Herodin, C. Dupuy, C. Jasmin, and M.-C. Le Bousse-Kerdiles
Stromal cell-derived factor 1 regulates primitive hematopoiesis by suppressing apoptosis and by promoting G0/G1 transition in CD34+ cells: evidence for an autocrine/paracrine mechanism
Blood,
February 15, 2002;
99(4):
1117 - 1129.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. SUWA, J. C. HOGG, M. E. KLUT, J. HARDS, and S. F. van EEDEN
Interleukin-6 Changes Deformability of Neutrophils and Induces Their Sequestration in the Lung
Am. J. Respir. Crit. Care Med.,
March 15, 2001;
163(4):
970 - 976.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
T. Suwa, J. C. Hogg, D. English, and S. F. Van Eeden
Interleukin-6 induces demargination of intravascular neutrophils and shortens their transit in marrow
Am J Physiol Heart Circ Physiol,
December 1, 2000;
279(6):
H2954 - H2960.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Aoki, S. Sha, H. Mukai, and Y. Nishi
Selective stimulation of G-CSF gene expression in macrophages by a stimulatory monoclonal antibody as detected by a luciferase reporter gene assay
J. Leukoc. Biol.,
November 1, 2000;
68(5):
757 - 764.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
G. Mbalaviele, N. Jaiswal, A. Meng, L. Cheng, C. Van Den Bos, and M. Thiede
Human Mesenchymal Stem Cells Promote Human Osteoclast Differentiation from CD34+ Bone Marrow Hematopoietic Progenitors
Endocrinology,
August 1, 1999;
140(8):
3736 - 3743.
[Abstract]
[Full Text]
|
 |
|
|
|