|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 10 (May 15), 1998:
pp. 3756-3765
Enhanced Megakaryocyte and Erythroid Development From Normal
Human CD34+ Cells: Consequence of Enforced Expression of
SCL
By
Ngaire J. Elwood,
Helen Zogos,
Daniel S. Pereira,
John E. Dick, and
C. Glenn Begley
From the Rotary Bone Marrow Research Laboratories and the Walter and
Eliza Hall Institute of Medical Research, Royal Melbourne Hospital,
Parkville, Victoria, Australia; the Department of Genetics, Research
Institute, Hospital for Sick Children, and the Department of Molecular
and Medical Genetics, University of Toronto, Toronto, Ontario, Canada.
 |
ABSTRACT |
The product of the SCL gene is a basic helix-loop-helix (bHLH)
transcription factor that is essential for the development of
hematopoietic stem cells in both the embryo and the adult. However,
once the stem cell compartment is established, the function of SCL in
subsequent differentiation and commitment events within normal
hematopoietic cells remains undefined. The aim of the current study was
to investigate this role using purified normal human hematopoietic
CD34+ cells. An SCL retrovirus was used to transduce
CD34+ cells isolated from human bone marrow, peripheral
blood, and umbilical cord blood. Enforced expression of SCL increased
by a median of twofold the number of erythroid colonies, with an increase in both colony size and the rate of hemoglobinization. Unexpectedly, enforced expression in CD34+ cells also
significantly increased the number of megakaryocyte colonies, but with
no impact on the size of colonies. There was no consistent effect on
the number nor size of granulocyte-macrophage (GM) colonies. The
proliferative effect of enforced SCL expression on erythroid cells was
attributed to a shortened cell cycle time; the self-renewal capacity of
erythroid or GM progenitors was unchanged, as was survival of cells
within colonies. These results demonstrate a role for SCL in
determining erythroid and megakaryocyte differentiation from normal
human hematopoietic CD34+ cells.
 |
INTRODUCTION |
HEMATOPOIESIS requires the
differentiation of a pluripotent stem cell into at least 8 distinct
cell lineages representing diverse functional phenotypes; however, the
mechanisms involved in regulation of hematopoietic differentiation
are poorly understood. The basic helix-loop-helix (bHLH) family
of transcription factors plays a critical role in regulating
differentiation of many cell types.1,2 MyoD for instance,
is a master regulator gene3 that plays an important role in
the control of mammalian myogenesis,4,5 and NeuroD plays a
similar role in neuronal differentiation.6 However, the
role of bHLH proteins in regulating hematopoietic stem cell
differentiation is unclear.
The SCL (also known as TAL-1) proto-oncogene encodes a member of the
bHLH family that is predominantly expressed in hematopoietic cells.7 Aberrant expression of SCL is implicated in the
development of 20% to 60% of cases of T-cell acute lymphoblastic
leukemia (T-ALL),8-12 and SCL is oncogenic when expressed
in T lymphocytes.13-16 Within the hematopoietic
compartment, SCL is normally present in cells of the erythroid, mast,
and megakaryocyte (MK) cell lineages, in some early myeloid cell lines,
and in committed (CD34+/CD38+) progenitor
cells.7,17-22 A crucial role for SCL has been demonstrated in the development of hematopoietic stem cells: mice homozygous for a
null mutation of the SCL gene die in utero at embryonic day 9 due to
failure of primitive hematopoiesis.23,24 In addition, studies using SCL null embryonic stem (ES) cells also demonstrate an
essential role for SCL in the development of hematopoietic stem cells
in the adult.25,26
The contribution of SCL to normal hematopoietic differentiation once
the hematopoietic stem cell has been established has not been
investigated. However, SCL expression during erythroid and macrophage
differentiation in a number of hematopoietic cell lines suggests that,
in addition to its essential role in hematopoietic stem cell
development, SCL may be an important regulator of normal hematopoietic
differentiation. SCL mRNA and protein levels increase throughout
erythroid differentiation, with a late decrease in SCL protein
levels.17,19,27-29 Conversely, levels progressively decrease during myeloid differentiation.30-33 These results
are supported by studies demonstrating enforced expression of SCL increases the rate of erythroid differentiation,27,33 but
perturbs monocytic and granulocytic differentiation.31-34
The aim of the current study was to investigate the function of SCL in
normal hematopoiesis using primary human CD34+ cells, a
population of cells representing a range of cell types from most
primitive to committed progenitor cells. We show that enforced
expression of SCL results in enhanced differentiation of these
hematopoietic stem cells towards the erythroid and MK lineages.
 |
MATERIALS AND METHODS |
Construction of the LNC(SCL) retrovirus.
The LNC(SCL) retroviral vector was constructed by cloning a 1.88-kb
HindIII-Xba I fragment from human SCL cDNA7
containing the full-length coding region into the Hpa I site of
the LNCX vector.35 This retrovirus expressed SCL from an
internal cytomegalovirus (CMV) promoter and the viral LTR
controlled expression of the neomycin phosphotransferase (NeoR) gene,
conferring resistance of infected cells to G418.35 A
high-titer amphotropic producer cell line was generated by infection of
PA317 cells with viral supernatant from GP+E-86 cells electroporated
with LNC(SCL). A high-titer clonal cell line was identified using RNA
slot blot analysis36 and standard NIH3T3
assay.37 NIH3T3 assay was used to routinely monitor the
titer of the retroviruses. SCL mRNA expression and protein production
from the LNC(SCL) retrovirus within PA317 cells was confirmed by
Northern blot and Western blot analysis, respectively (data not shown).
The control cell line used throughout these studies was PA317/LNL6, a
cell line that produces a retrovirus expressing the NeoR gene
alone.38,39 Stocks of equivalent titer of both the
PA317/LNL6 (4.4 × 106 ± 2 × 106
infectious units [IU]/ ml, n=6 NIH3T3 assays) and PA317 / LNC(SCL) (3.1 × 106 ± 1.5 × 106 IU/mL, n = 6) cell lines were established and frozen. In each series of
experiments, retroviral preparations were confirmed to be of comparable
titer. These preparations were then used for a maximum of 4 to 6 weeks
when comparable titer was again confirmed. To further ensure that
experiments were comparable, if the retroviral transduction efficiency
of CD34+ cells was greater than or equal to twofold
discordant between LNC(SCL) and the controls (LNL6-infected
CD34+ cells), the results were disregarded.
CD34+ cell selection and retroviral
transduction.
Clinical samples were bone marrow (BM) or peripheral blood progenitor
cells (PBPC) mobilized by granulocyte colony-stimulating factor (G-CSF)
alone or G-CSF in combination with stem cell factor (SCF)
using clinical protocols previously described40,41: there
was no difference between BM-derived and PBPC-derived CD34+
cells in response to enforced expression of SCL (data not shown). Mononuclear cells (MNC) were isolated by centrifugation on Ficoll density gradient, and cells were selected based on expression of CD34,
a surface glycoprotein expressed on developmentally early hematopoietic
stem and progenitor cells (for review see Krause et al,42
Huang and Terstappen,43 Schmitt et al,44 Murray et al,45 and Graf and Torok-Storb46). The
CD34+ cells were isolated using the Miltenyi MiniMacs
Immunomagnetic Separation system and the CD34+
progenitor cell isolation kit (Becton Dickinson, Knoxfield, Victoria, Australia). These cell preparations were confirmed 95% pure
CD34+ cells by reanalysis, as previously
described.40
CD34+-purified cells (2.5 × 105 to 5 × 105 cells) were cocultivated for 3 days (37°C
in 5% CO2) in 60-mm dishes (Falcon; Becton Dickinson,
Lincoln Park, NJ) with 106 irradiated (3,000 rad)
PA317/LNL6 or PA317/LNC(SCL) retrovirus producer cells using previously
optimized conditions.40 Retroviral transductions were
performed in 5 mL Iscove's modified Dulbecco's medium
(IMDM)/10% FCS in the presence of human interleukin-3
(huIL-3; 100 ng/mL; unless otherwise stated, all cytokines used
throughout this study were purified recombinant human proteins provided
by Agen, Thousand Oaks, CA), recombinant murine (r mu) Flt3/Flk-2 ligand (FL; 100 ng/mL; produced as previously
described47,48), and 4 µg/mL polybrene (Sigma, Gymea, New
South Wales, Australia). For all experiments, mock cocultivations were
performed using the packaging cell line PA317. After retroviral
transduction, nonadherent cells were collected and efficiency of
infection determined by progenitor cell assay in the presence of 1.5 mg/mL active concentration G418 (Life Technologies, Melbourne,
Australia). This concentration was selected based on titrations of G418
on human CD34+ cells (data not shown). In all experiments,
mock-transduced CD34+ cells were assayed in the presence of
G418 and confirmed effective killing of all cells that did not express
the NeoR gene. Retroviral transductions using LNL6 and LNC(SCL) were
performed in parallel and under identical conditions. Within each
experiment, the titers of the retroviruses were equivalent.
Expression of retroviral SCL mRNA in G418-resistant (G418R) colonies
(both granulocyte-macrophage [GM] and erythroid) was confirmed by
performing reverse transcriptase-polymerase chain reaction (RT-PCR) on
mRNA extracted from separate pools of 100 G418R GM and 100 G418R
erythroid colonies. mRNA was extracted using Trizol (Life
Technologies), samples were DNase-treated (Boehringer Mannheim, Castle
Hill, New South Wales, Australia), and oligo(dT)-and random-primed cDNA
was synthesized from the total RNA in 60 µL. Ten microliters of each
sample was PCR-amplified with primers to amplify endogenous human SCL
(forward CAAGTAAGAGGCTGGAGTTG and reverse GTGATGTCGAGGAGTTGAAG). To
detect retrovirally expressed SCL cDNA sequences, the oligonucleotide
primer pair consisted of the above-noted forward primer for human SCL
and an antisense primer complementary to a sequence within the provirus
(CTAGCTTGCCAAACCTACAG). Thirty-five cycles of PCR amplification were
performed in 50 µL reaction mixtures and 30 µL of the product was
separated by agarose gel electrophoresis, transferred to
HybondN+ (Amersham), and hybridized with an internal SCL
oligonucleotide (GCCTATGTTGATCCATCCAG). Relative mRNA abundance was
estimated by densitometric analysis using a Stratagene Eagle Eye II
video system and the Stratagene (La Jolla, CA) ZERO-Dscan software. In
control experiments, endogenous SCL expression was detected in GM and
erythroid colonies. Within the limits of this PCR technique, retroviral
SCL sequences were detected in GM and erythroid colonies at levels up
to 22-fold (mean, 9-fold; n = 6 patient samples) above that observed
for endogenous SCL in these colonies.
Progenitor cell assays.
Progenitor cells were grown in agar culture prepared by adding 1 vol of
double-strength AIMDM and 1 vol of pretested FCS to 2 vol of 0.6% agar
(Difco Laboratories, Detroit, MI) in a final volume of 1 mL.49 Cultures were stimulated by granulocyte-macrophage colony-stimulating factor (GM-CSF; 100 ng/mL), G-CSF (500 U/mL), and
SCF (100 ng/mL) for growth of GM colony-forming cells
(GM-CFC) and eosinophil progenitor cells (Eo-CFC).
Colonies were stimulated with GM-CSF (100 ng/mL), IL-3 (100 ng/mL),
IL-6 (100 ng/mL), SCF (100 ng/mL), and erythropoietin (EPO; 2 U/mL) for
erythroid progenitors (burst-forming unit-erythroid [BFU-E]), as
previously described.41 Cultures were established using 1 × 103 cells/mL in the absence of G418. Because of the
interpatient variability in both the transduction and cloning
efficiencies (see below), in the presence of G418, a range of
CD34+ cell concentrations (from 1 × 103
to 5 × 104 cells/mL) was always examined. To
accurately quantitate progenitor cells, multiple replicate cultures
were examined; results shown for colonies grown in G418 are the mean of
a minimum of nine replicate cultures. All other results are the mean of
triplicate cultures. Cultures were incubated in a fully humidified
atmosphere of 5% CO2 in air at 37°C for 14 days.
Replicate cultures were scored for colonies (>40 cells) after 14 days
using a dissection microscope at 35× magnification. Throughout
this study, hematopoietic colonies derived from LNL6- or
LNC(SCL)-transduced CD34+ cells will be referred to as LNL6
or SCL colonies, respectively.
Retroviral transduction efficiency, as determined by the percentage of
G418R colonies after culture in agar, was a median of 9% (range, 1%
to 16%; n = 13). Consistent with our previous findings,40
a wide interpatient variation in transduction efficiency was observed.
A broad interpatient variation was also apparent in the frequency of
clonogenic cells within the CD34+ cell population
(see Results). Only patient samples were included in which a minimum of
20 G418R colonies/104 CD34+ cells cultured were
observed after transduction with LNC(SCL).
Megakaryocyte cultures.
MK colonies were stimulated and identified in agar culture as
previously described.50 Briefly, cultures were established using 0.3% agar, IMDM, 25% FCS, and 1 × 103
CD34+ cells/mL in the absence of G418 and 1 × 103 and 3 × 103 CD34+
cells/mL in the presence of G418 (1.5 mg/mL). Cultures were stimulated with G-CSF (500 U/mL), GM-CSF (100 ng/mL), SCF (100 ng/mL), IL-3 (100 ng/mL), IL-6 (100 ng/mL), EPO (2 U/mL), and pegylated recombinant human
megakaryocyte growth and development factor (PEG-rHuMGDF; 200 ng/mL).
After incubation for 10 days at 37°C in 5% CO2 in air,
cultures were dehydrated and MK identified using an alkaline phosphatase anti-alkaline phosphatase method of staining whole agar
cultures in situ. MK colonies were scored using an inverted microscope
(×100) and were defined as containing 3 or more cells.
Morphology of myeloid colonies.
Agar cultures stimulated with GM-CSF (100 ng/mL), G-CSF (500 U/mL), and
SCF (100 ng/mL) were fixed at day 14 in 2.5% (vol/vol) glutaraldehyde
(TAAB Laboratories, Reading, UK) in phosphate-buffered saline (PBS) and
stained with Luxol-Fast blue to identify eosinophils.51 Colonies were scored under light microscope (×100).
Colony size and hemoglobinization.
To determine the mean colony size for erythroid and GM colonies, 30 to
50 colonies were plucked from agar culture into 150 µL PBS, the
number of cells was counted, and the result was divided by the number
of colonies pooled. Cell counts were performed after culture in agar
for 7, 10, and 14 days.
Hemoglobinization of erythroid colonies in situ was determined by
staining with 2,7-diaminofluorene (DAF) as previously
described.52 Results presented are the number of
DAF-positive colonies expressed as a percentage of the total number of
colonies present in EPO-containing cultures in the presence of G418
(1.5 mg/mL) for 7, 10, and 14 days. To allow for the variable cloning
and transduction efficiencies, cultures were established using a range
of CD34+ cell numbers (1 × 103 to 5 × 104 CD34+ cells/mL).
Isolation and retroviral transduction of human cord blood (CB)
CD34+ cells.
Ficoll-separated/red blood cell-lysed human umbilical CB cells were
enriched for CD34+ cells by immunomagnetic negative
selection using a cocktail of iron-conjugated lineage antibodies and
the StemSep device as described by the manufacturer (Stem Cell
Technologies Inc, Vancouver, British Columbia, Canada). In preparation
for retroviral infection, CD34-enriched/lineage-depleted cells were
resuspended in IMDM supplemented with 2.5% FCS, IL-3 (50 ng/mL), IL-6
(20 ng/mL), SCF (50 ng/mL), FL (50 ng/mL; Immunex Corp, Seattle, WA),
and G-CSF (20 ng/mL) and prestimulated for 16 hours on 35-mm petri
dishes precoated with the C-terminal fibronectin fragment, CH-296
(supplied by Takara Shuzo Co Ltd, Otsu, Japan). After prestimulation,
virus-containing medium from a confluent T75 cm2 flask of
either PA317/LNL6 or PA317/LNC(SCL) retroviral producer cells
supplemented with the aforementioned cytokines was used to infect the
CD34-enriched/lineage-depleted cells at 12-hour intervals for 48 hours.
Cells were then collected and used to establish methylcellulose
cultures as previously described53 using 1,000 and 333 CD34+ cells/mL in the presence or absence of 1.5 mg/mL
G418. Colonies were scored on day 14 using a dissection microscope
(magnification ×35), and morphology of colonies was determined by
May-Grünwald Giemsa staining of cytospin preparations.
Recloning experiments.
In recloning experiments, approximately 100 randomly selected G418R
erythroid and GM colonies derived from LNL6- or LNC(SCL)-transduced cells were isolated, resuspended, and recloned into agar culture in the
same stimuli (without G418) as the original cultures. The number of
secondary clones (>15 cells) and colonies (>50 cells) was
enumerated after a further 14 days.
Analysis of cell death.
To determine the number of dying cells in colonies derived from
retrovirally transduced cells after 7, 10, and 14 days in agar culture,
40 G418R erythroid colonies were plucked from agar into 150 µL PBS
and a single cell suspension was prepared. Cells were then examined
either by eosin uptake or propidium iodide (PI) staining. The ability
of cells to exclude eosin was compared with the total number of cells
as quantitated by staining with crystal violet as previously
described.49 For experiments performed using PI, 1 µL of
PI (stock 100 µg/mL in PBS; Sigma) was added to 100 µL containing
cells from the pooled colonies. Twenty microliters was then dropped
onto a slide, coverslipped, and examined with an oil immersion lens and
a light microscope containing a UV lamp. Fluorescently stained,
nonviable cells were quantitated under UV light and compared with the
total number of cells observed under phase contrast. Using both
protocols, the proportion of dying cells per G418R colony was
determined.
Statistical analyses.
Unless stated otherwise, all statistical analyses were performed using
the Student's t-test.
 |
RESULTS |
Enforced expression of SCL increased both the number and size of
erythroid colonies.
Purified CD34+ cells from adult BM and blood were incubated
with irradiated cells producing a retrovirus containing the full-length human SCL cDNA [LNC(SCL) retrovirus]. In control experiments, CD34+ cells were transduced with the LNL6 retrovirus, and
CD34+ cells were mock-transduced by incubation with PA317
cells for 3 days. There was no difference between groups in the number
of cells recovered at the end of this 3-day period (130% to 150% cell
recovery in 9 experiments), at which time agar cultures were established.
There was a median 1.5-fold increase in the absolute number of
clonogenic cells after transduction with the LNC(SCL) retrovirus when
compared with the mock-transduced and LNL6-control infected cells after
agar culture for 14 days (P < .005, paired t-test, n = 13 samples). This increased frequency of clonogenic cells was due to
increased numbers of erythroid colonies and was often evident
macroscopically (Fig 1A and B). The
increase in erythroid colony number was also evident with and without
applying G418 selection (Fig 1C and D). This indicated that the
differences observed were not solely due to more efficient expression
of the NeoR gene in erythroid progenitor cells transduced with the
LNC(SCL)-retrovirus compared with those transduced with LNL6. In
addition to the striking effects on erythroid colony number, there was
also an increase in the size of erythroid colonies (Fig 1E and F and
see below). The enhanced erythroid colony formation, in the absence of
G418, is consistent with studies demonstrating that the transduction efficiency of CD34+ cells is substantially greater than
that assessed by colony formation in the presence of
G418.40,54,55 We have previously reported PCR on DNA
extracted from individual GM and erythroid colonies as an independent
indicator of transduction efficiency40: NeoR gene was
detected in 39%, 68%, and 79% of colonies grown in cultures without
G418 (total of 90 colonies examined). In comparison, gene transfer, as
assessed by colony formation in the presence of G418, was much lower,
at 0.1%, 7%, and 3%, respectively. An explanation to account for
such a difference has not yet been elucidated.55

View larger version (0K):
[in this window]
[in a new window]
| Fig 1.
Growth of erythroid colonies in agar culture after
transduction of human CD34+ cells with LNL6 or LNC(SCL).
(A) through (D) show agar culture plates of LNL6-transduced (A and C)
or LNC(SCL)-transduced (B and D) CD34+ cells stimulated
for erythroid colonies in the presence (A and B) or absence (C and D)
of G418. CD34+ cells were cultured at 1,000 cells/mL in
the absence of G418 (C and D) and at 104 cells/mL in the
presence of G418 (A and B). Photographs were taken at day 13 of culture
in agar. (E) and (F) show morphology of individual erythroid colonies
(original magnification ×40) grown in the presence of G418 after
transduction of CD34+ cells with LNL6 (E) or LNC(SCL)
(F). The control erythroid colony shown in (E) was the largest colony
in the culture, whereas that in (F) represents a typical erythroid
colony. Colonies were photographed at day 13.
|
|
Figure 2A shows a typical experiment with
the number of erythroid and GM colonies derived from LNC(SCL)-infected
versus control CD34+ cells. In this experiment there was a
fourfold increase in the total number of erythroid colonies in the
presence or absence of G418. The increase in erythroid colonies was
consistently observed and was a median of twofold in 13 experiments.
The increase in erythroid colony formation therefore accounted for the
increase in absolute number of colonies generated (Fig 2B). As
discussed below, there was no consistent change in numbers of GM
colonies. Despite the heterogeneity between different patients,
analysis of the results from 13 patient samples showed a significant
enhancement of erythroid colony formation as a result of enforced
expression of SCL (Fig 2C, P < .001, paired t-test).

View larger version (31K):
[in this window]
[in a new window]

View larger version (35K):
[in this window]
[in a new window]

View larger version (18K):
[in this window]
[in a new window]
| Fig 2.
(A) Typical experiment showing the number of progenitor
cells after retroviral transduction of CD34+ cells with
PA317 alone ( ), LNL6 ( ), or LNC(SCL) ( ). GM and erythroid
colonies in the presence and absence of G418 (1.5 mg/mL active
concentration) are shown. Agar cultures were established using 1,000 CD34+ cells and GM and erythroid colonies were
quantitated in independent cultures using the appropriate growth factor
combinations. Data points are the mean ± SD of triplicate cultures
(in absence of G418) or 9-replicate cultures (in presence of G418). (B)
Total number of G418R colonies per 1 × 104
CD34+ cells for 5 representative patient samples.
Cultures were established in the presence of G418 (1.5 mg/mL) using a
range of cell concentrations (1 × 103 to 5 × 104 CD34+ cells) after transduction with LNL6
(N) or LNC(SCL) (S). ( ) The number of GM colonies; ( ) the number
of erythroid colonies. GM and erythroid colonies were quantitated in
independent cultures. Each bar represents the mean from 9-replicate
cultures. (C) The proportion of erythroid colonies grown in agar
culture as a function of the total number of colonies obtained after
the transduction of CD34+ cells with LNL6 or LNC(SCL).
Each point represents an individual patient sample.
|
|
As well as an increase in erythroid colony number, enforced SCL
expression resulted in increased size of erythroid colonies. This was
quantitated by documenting the number of cells per G418R colony
(Fig 3). After 7 days in agar culture,
erythroid colonies were selected based on their typical colony
morphology rather than on their red appearance. However, at days 10 and
14, erythroid colonies were clearly hemoglobinized. Erythroid colonies
derived from LNC(SCL)-infected cells (SCL-erythroid colonies) were up to 3.8 times (median, 1.6-fold) larger than colonies from
LNL6-transduced control cells at all three timepoints. The increase in
colony size was most apparent at days 7 and 10, at which the median
fold increase was 1.8 (P < .01) and 1.6 (P < .001).
The increase at day 14 was 1.3-fold (P < .01).

View larger version (22K):
[in this window]
[in a new window]
| Fig 3.
Number of cells per G418R erythroid colony after
transduction of CD34+ cells with LNL6 or LNC(SCL). Each
point represents an individual patient sample. The mean colony size for
each patient sample was determined by pooling 30 to 50 colonies in 150 µL PBS, the number of cells was counted, and the result was divided
by the number of colonies pooled. Cell counts were performed after
culture in agar for 7 (n = 11 experiments), 10 (n = 15 experiments), and 14 days (n = 13 experiments). Statistics were
performed using the paired t-test.
|
|
Enforced expression of SCL enhanced hemoglobinization of erythroid
colonies.
While examining these cultures, it appeared that SCL-erythroid colonies
were hemoglobinized earlier than control colonies. To quantitate this
more objectively, colonies were stained with DAF. After 7 days in agar
culture, approximately half the control, LNL6 colonies assessed as
erythroid based on typical colony morphology were stained positively
with DAF. Consistent with the earlier hemoglobinization of
SCL-erythroid colonies, DAF staining corresponded well with the colony
morphology of SCL-erythroid colonies (data not shown). However, to
overcome any investigator bias, results are presented as a percentage
of the total number of colonies observed. Approximately 70 colonies
were evaluated at each time point for each sample. After 7 days in
culture, 45% of all SCL colonies stained positive for DAF. This
finding compared with 20% of LNL6 colonies (n = 9 experiments,
P < .001). Similarly, at day 10 of agar culture, 78% of all
SCL colonies stained positive for DAF, compared with 52% of LNL6
colonies (n = 11 experiments, P < .001). At this timepoint,
all colonies of typical erythroid morphology in SCL cultures were DAF
positive. This was not the case in control cultures. As expected, at
day 14 of culture, all colonies of typical erythroid morphology were
visibly hemoglobinized and DAF positive. This represented 88% of all
the SCL colonies grown under conditions favoring erythroid growth and
72% of LNL6 colonies (n = 7 experiments, P < .001).
There was no evidence for SCL-induced growth factor independence of
hematopoietic cells; agar cultures established in the absence of
cytokines did not result in hematopoietic colonies and the erythroid
colonies formed in response to enforced expression of SCL remained
absolutely EPO-dependent (data not shown). Together, these results
demonstrated that enforced expression of the SCL gene in freshly
isolated human CD34+ cells increased the number of
erythroid colonies and the number of cells present within these
colonies and hastened the hemoglobinization of colonies. Thus, this
documented an action for SCL to enhance clonogenicity, proliferation,
and differentiation within the adult erythroid compartment.
Enhanced erythroid colony formation in CD34+
cells derived from CB.
To evaluate the role of SCL in fetal hematopoietic cells,
CD34+ cells were isolated from human CB and transduced with
LNL6 or LNC(SCL) retroviruses (Table 1).
For all 3 CB samples, the size of the erythroid colonies was greater
after LNC(SCL) transduction compared with LNL6. In two of three CB
experiments, an increase in the number of SCL erythroid colonies was
observed. Consistent with the results described above,
hemoglobinization was almost twofold greater after enforced expression
of SCL compared with NeoR alone. In this case, the difference in
hemoglobinization at day 7 existed despite no increase in
the number of erythroid colonies at day 14. As with PBPC- and
BM-derived CD34+ cells, and somewhat surprisingly, the
total number and morphology of myeloid colonies was unchanged.
Therefore, CB-derived CD34+ cells behaved in a similar
manner to CD34+ cells from adult blood and BM. In addition
to the different cellular source, the similar effect of enforced SCL
expression was despite the different methodology used to isolate and
transduce the CD34+ cells. Thus, enforced SCL expression
enhanced erythroid colony formation in cells from both adult and fetal
tissues.
View this table:
[in this window]
[in a new window]
|
Table 1.
Growth of Progenitor Cells in Methylcellulose After
Retroviral Transduction of CD34+ Cells Isolated From
Human Cord Blood
|
|
Enforced expression of SCL did not influence cell death.
Although controversial,33 it has been suggested that SCL
may play a role in protecting cells against
apoptosis.16,34,56 It was therefore possible that SCL
increased the size of erythroid colonies by decreasing the degree of
cell death within these colonies. However, the proportion of dying
cells within the erythroid colonies was unaltered after transduction
with LNL6 and LNC(SCL) at days 7, 10, and 14 (Fig 4A). A similar result was obtained
when the proportion of dying cells was examined by staining DNA with PI (Fig 4B). Erythroid colonies were selected using the same criteria as
that used for documenting the size of erythroid colonies. Although this
did not allow direct identification of apoptotic cells, it did indicate
cells that were dying, irrespective of the mechanism. This suggested
that an SCL-induced decrease in cell death was not the explanation for
the increase in colony size and that enforced expression of SCL did not
alter the proportion or the rate of hematopoietic cell death.

View larger version (24K):
[in this window]
[in a new window]
| Fig 4.
Proportion of nonviable cells per G418R erythroid colony.
CD34+ cells were retrovirally infected with LNL6 ( ) or
LNC(SCL) ( ) and placed into agar cultures stimulated for erythroid
colonies for 7, 10, and 14 days. For each experiment, 40 G418R colonies were pooled in 150 µL PBS and analyzed as outlined below. The results
were divided by the number of colonies pooled. (A) The percentage of
dying cells was determined by comparing the number of cells that
stained with eosin to the total number of cells present. Data points
represent the mean ± SD percentage of nonviable cells per erythroid
colony at days 7 (n = 3 experiments), 10 (n = 6 experiments), and
14 (n = 6 experiments). (B) The number of dying cells was determined
by staining with PI. Fluorescently stained nonviable cells were
quantitated using UV microscopy and compared with the total number of
cells observed under phase contrast to determine the percentage of
nonviable cells per G418R erythroid colony at day 10 (n = 5 experiments).
|
|
Enforced expression of SCL did not decrease the number of GM
colonies.
Although LNC(SCL)-transduced cells generated an increase in the total
number of colonies, this was primarily accounted for by an increase in
erythroid colonies. However, as shown in Fig 2B, there was the
suggestion that, in some experiments, enforced SCL expression also
increased the number of GM colonies. To directly examine whether SCL
could influence the development of GM colonies, cultures were
established under conditions in which no erythroid colony formation
could result. Given the evidence implicating SCL in macrophage
differentiation, an action on GM colony formation in such circumstances
might be expected. However, enforced expression of SCL in human
CD34+ cells did not consistently alter the number of GM or
of eosinophil colonies. Figure
5 shows the number of G418R GM
colonies for each patient sample; the median number of G418R GM
colonies/10,000 CD34+ cells after cocultivation with LNL6
and LNC(SCL) was 63 (range, 7 to 260) and 80 (range, 10 to 350),
respectively (n = 13 experiments). Although this difference was not
statistically significant (P = .43, paired t-test), in
6 experiments there was a modest increase in the number of GM colonies.
Furthermore, enforced expression of SCL did not influence the type of
myeloid colonies observed (Table 2); 29%
were pure eosinophil colonies and there was no difference in the number
of granulocyte and/or macrophage colonies containing
eosinophils. Thus, in this system, enforced expression of SCL did not
appear to alter myeloid differentiation.

View larger version (17K):
[in this window]
[in a new window]
| Fig 5.
Number of G418R GM colonies after
transduction of CD34+ cells with LNL6 or LNC(SCL).
Cultures were established in the presence of G418 (1.5 mg/mL) using 1 × 103 to 5 × 104 CD34+ cells.
Each point shows the mean from 9-replicate cultures for an individual
patient sample.
|
|
Enforced expression of SCL did not alter the frequency of clonogenic
cells in erythroid and GM colonies.
To examine the self-generative capacity of progenitor cells infected
with the LNC(SCL) retrovirus, individual erythroid and GM colonies were
isolated at day 14 and placed into secondary agar cultures. Thirty-two
percent of both LNL6- and SCL-erythroid colonies contained clonogenic
cells, as did 28% and 29% of GM colonies derived from cells
transduced with LNL6 and LNC(SCL), respectively. These results
demonstrated that enforced expression of SCL did not alter the
self-renewal capacity of freshly isolated human progenitor cells.
Consistent with these results, attempts to generate cell lines from
retrovirally transduced CD34+ cells were unsuccessful,
despite the use of multiple growth factor combinations (data not
shown).
Enforced expression of SCL increased the number of megakaryocyte
colonies.
The normal expression pattern of SCL suggests a possible role for SCL
in MK differentiation. MK colony formation was therefore investigated.
As with erythroid colony formation, there was wide interpatient
variation. However, in every case, enforced expression of SCL in
CD34+ cells resulted in an increase in the number of MK
colonies. There was a median increase of fourfold (range, 2- to
42-fold) compared with control cultures (P < .005;
Fig 6A). Based on the erythroid colony data
presented, we anticipated that SCL would also act to increase the size
of MK colonies. However, this was not the case. Figure 6B shows data
from 4 patient samples in which the number of cells per retrovirally
transduced MK clone was quantitated. In all 4 samples, despite an
increase in the number of MK clones after transduction with LNC(SCL),
there was no difference in the clone size. The size of the MK colonies
( 3 cells) after transduction of cells with LNL6 was 5.5 ± 1.4 cells (mean ± SD, n = 80 colonies examined) versus 5.2 ± 0.8 cells (n = 187 colonies examined) for LNC(SCL). Similarly, there was no
difference in the size of MK cells (data not shown). Thus, enforced
expression of SCL increased the number of clonogenic MK progenitor
cells but did not alter their proliferative potential.

View larger version (17K):
[in this window]
[in a new window]

View larger version (35K):
[in this window]
[in a new window]
| Fig 6.
(A) Number of G418R MK colonies after transduction of
CD34+ cells with LNL6 or LNC(SCL). Cultures were
established using 3,000 CD34+ cells in the presence of
1.5 mg/mL G418. Each data point represents an individual patient
sample. Equivalent titers between LNL6 and LNC(SCL) (2% to 13% G418R
GM-CFC) were confirmed within each experiment. (B) The number of cells
per G418R MK clone after transduction of CD34+ cells with
LNL6 ( ) or LNC(SCL) ( ). The total number of retrovirally transduced MK clones is shown. Clones from a total of 9 agar culture plates, representing 4 individual patient samples, are shown. Equivalent titers were observed for the LNL6 and LNC(SCL) retroviruses, as assessed by determining the percentage of G418R GM-CFC for each of
the 4 patient samples. MK colonies contained 3 or more cells. The
number of cells per MK clone was counted using an inverted microscope
at ×100 magnification.
|
|
 |
DISCUSSION |
In this report, we demonstrate that enforced expression of SCL in human
CD34+ cells enhanced both erythroid and MK development,
thereby providing further evidence of a role for SCL as a master
regulator of hematopoiesis. The enhanced colony growth and colony size
observed with enforced expression of SCL, a transcription factor, is
typically associated with cytokine stimulation of hematopoietic
progenitor cells.57-60 It is conceivable that SCL may be
responsible for mediating some of the effects, eg, of SCF on erythroid
progenitor cells, because an increase in SCL protein levels has been
documented after the culture of human erythroid precursors in
SCF.28 However, the results presented in the current report
directly demonstrate the importance of the bHLH protein, SCL, in
hematopoietic development and in the human system.
This is the first description of a direct functional role for SCL in MK
development. Enforced expression of SCL enhanced the clonogenic
potential of MK cells but did not influence the proliferative ability
of these cells. This action is in contrast to, eg, thrombopoietin, in
which the extracellular growth factor can increase both clonogenicity, colony size, and MK ploidy.59 In a previous study, SCL was
overexpressed in the early myeloid murine cell line,
416B,61 and, consistent with the present study, there was
no effect of SCL to stimulate proliferation of committed MK
progenitors. However, an action of SCL to enhance clonogenicity of
uncommitted progenitors was not evaluated. Moreover, both studies
failed to demonstrate an effect of SCL on the differentiation and
subsequent morphologic changes of mature MK, although this was seen
with GATA-1 in the 416B cells. SCL can now be added to the short list
of transcription factors known to be capable of influencing MK
differentiation and development, with the other proteins being
NF-E2,62 HOXA10,63 and members of the GATA
family.61,64
The SCL-induced erythroid development is consistent with some of the
known actions of SCL previously documented using erythroid cell lines.
The experiments presented here demonstrated that, in an optimal
environment (eg, the presence of EPO), SCL per se regulated
erythropoiesis. This was evidenced in terms of enhanced clonogenicity,
increased proliferation, and hastening of hemoglobinization. There are
several potential mechanisms by which SCL might exert these effects on
erythroid (and MK) progenitor cells. It is possible that SCL enhanced
the survival of committed progenitor cells during the 3-day coculture
period; however, this effect alone would be insufficient to explain the
increased size and differentiation of the erythroid colonies (which
implied an action during the agar culture phase). Furthermore, similar
results were obtained using CD34+ cells derived from both
adult and fetal sources despite differences in the transduction
protocols, suggesting that the SCL-mediated effects were independent of
conditions during the transduction period. Whereas there was no
evidence for increased self-renewal or alteration in hematopoietic cell
death within colonies, there was an increase in the size of erythroid
colonies. The increased proliferative capacity of erythroid cells (as
evidenced by increased colony size) may therefore be due to a shortened
cell cycle time within SCL-erythroid colonies. This would be consistent
with previous studies that demonstrated a role for SCL in proliferation
of K562 cells.65 The enhancement of clonogenic capacity of
both erythroid and MK progenitors raises the possibility that SCL may
play a role in a bipotent erythroid (Ery)/MK progenitor cell or direct cellular differentiation towards such a bipotent progenitor. Studies of
SCL expression have also suggested that endogenous SCL is likely to be
important within these cells.33,66 In addition to these effects, SCL hastened erythroid differentiation suggesting further action on postmitotic erythroid cells.
Enforced expression of SCL did not perturb myeloid development. These
findings were unexpected given previous studies, using cell lines, that
have implied a role for SCL during myeloid differentiation. Based on
the reported action of SCL in cells from myeloid progenitor cell
lines,31-34 one might predict a decrease in GM colonies
proportional to the increase in erythroid and MK precursors. Such a
finding was reported after enforced expression of HOXA10 in murine
hematopoietic progenitor cells,63 in which an increase in
MK progenitor cells was reported with concomitant decreases in the
granulocyte and macrophage compartments. In the present study, RT-PCR
analysis confirmed the presence of both endogenous SCL and increased
levels of retroviral SCL mRNA in GM colonies. However, given that the levels of transcription factor can influence hematopoietic
differentiation,67 the absolute abundance of SCL protein
may be important in myeloid differentiation. However, the absence of a
consistent alteration in GM precursors does further support the idea
that the effects of enforced expression of SCL may be manifested in a
progenitor cell such as the Ery/MK progenitor. It is also consistent
with the action of growth factors in which, eg, there is no evidence that MK differentiation induced by thrombopoietin occurs at the expense
of other cell lineages.59,68,69
This lack of expected action of SCL on the cells of the GM lineage may
also be a consequence of the use of multiple cytokines in this study
(viz, GM-CSF, G-CSF, and SCF). It is possible that this combination of
cytokines was able to elicit GM differentiation via intracellular
signaling mechanisms that were not perturbed by the enforced expression
of SCL. In contrast, the inhibitory action of SCL on myeloid
differentiation using cell lines was seen only when single growth
factors were used and then, eg, with leukemia-inhibitory factor
(LIF) but not with IL-6.31,32
The findings of this study highlight the advantage of using primary
human cells to examine the events involved in hematopoiesis. By
definition, immmortalized cell lines inherently harbor unknown genetic
mutations and, although these cell lines represent important hematologic tools, they cannot truly reflect normal cells. This may be
demonstrated in the present study, eg, by the differences observed in
the effect of SCL on GM differentiation and also by the unaltered
self-renewal capacity of LNC(SCL)-transduced progenitor cells; this was
in contrast to the increased self-renewal capacity observed with
enforced expression of SCL in M1 myeloid progenitor cells,31 and the decrease in self-renewal capacity observed with antisense SCL in K562 cells.65
In summary, we have shown that SCL can increase megakaryocytopoiesis
and direct the development of erythroid precursors derived from human
CD34+ cells. Such an action of SCL is in keeping with the
role of other bHLH proteins to regulate the differentiation of various
cell types and arguably justifies the description of SCL as a master regulator of hematopoiesis.70
 |
FOOTNOTES |
Submitted October 16, 1997;
accepted January 12, 1998.
Supported in part by the National Health and Medical Research Council
(Canberra, Australia), the Medical Research Council of Canada, and the
National Cancer Institute of Canada with funds from the Canadian Cancer
Society. D.S.P is a Terry Fox Research Fellow of the National Cancer
Institute of Canada, supported with funds provided by the Terry Fox
Run.
Address reprint requests to Ngaire J. Elwood, PhD, Rotary Bone Marrow
Research Laboratories, Post Office, Royal Melbourne Hospital,
Parkville, Victoria, 3050, Australia; e-mail: elwood{at}wehi.edu.au.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
 |
ACKNOWLEDGMENT |
The authors gratefully acknowledge the assistance of Rachel Mansfield
and the staff of the Centre for the Development of Cancer Therapeutics,
Melbourne for the supply of patient samples and Amgen for the supply of
cytokines. We also thank Dr Andrew Elefanty for helpful discussions and
advice.
 |
REFERENCES |
1.
Garrell J,
Campuzano S:
The helix-loop-helix domain: A common motif for bristles, muscles and sex.
Bioessays
13:493,
1991[Medline]
[Order article via Infotrieve]
2.
Kadesch T:
Consequences of heteromeric interactions among helix-loop-helix proteins.
Cell Growth Differ
4:49,
1993[Medline]
[Order article via Infotrieve]
3.
Davis RL,
Weintraub H,
Lassar AB:
Expression of a single transfected cDNA converts fibroblasts to myoblasts.
Cell
51:987,
1987[Medline]
[Order article via Infotrieve]
4.
Edmondson DG,
Olson EN:
Helix-loop-helix proteins as regulators of muscle-specific transcription.
J Biol Chem
268:755,
1993[Free Full Text]
5. Ludolph DC, Konieczny SF: Transcription factor families: Muscling
in on the myogenic program. FASEB J 9:1595, 1995
6.
Lee JE,
Hollenberg SM,
Snider L,
Turner DL,
Lipnick N,
Weintraub H:
Conversion of Xenopus ectoderm into neurons by NeuroD, a basic helix-loop-helix protein.
Science
268:836,
1995[Abstract/Free Full Text]
7.
Begley CG,
Aplan PD,
Denning SM,
Haynes BF,
Waldmann TA,
Kirsch IR:
The gene SCL is expressed during early hematopoiesis and encodes a differentiation-related DNA-binding motif.
Proc Natl Acad Sci USA
86:10128,
1989[Abstract/Free Full Text]
8. Brown L, Cheng JT, Chen Q, Siciliano MJ, Crist W, Buchanan G,
Baer R: Site-specific recombination of the tal-1 gene is a common
occurrence in human T cell leukemia. EMB0 J 9:3343, 1990
9.
Bernard O,
Lecointe N,
Jonveaux P,
Souyri M,
Mauchauffe M,
Berger R,
Larsen CJ,
Mathieu-Mahul D:
Two site-specific deletions and t(1;14) translocation restricted to human T-cell acute leukemias disrupt the 5 part of the tal-1 gene.
Oncogene
6:1477,
1991[Medline]
[Order article via Infotrieve]
10.
Aplan PD,
Lombardi DP,
Reaman GH,
Sather HN,
Hammond GD,
Kirsch IR:
Involvement of the putative hematopoietic transcription factor SCL in T-cell acute lymphoblastic leukemia.
Blood
79:1327,
1992[Abstract/Free Full Text]
11.
Bash RO,
Hall S,
Timmons CF,
Crist WM,
Amylon M,
Smith RG,
Baer R:
Does activation of the TAL1 gene occur in a majority of patients with T-cell acute lymphoblastic leukemia? A pediatric oncology group study.
Blood
86:666,
1995[Abstract/Free Full Text]
12.
Ono Y,
Fukuhara N,
Yoshie O:
Transcriptional activity of TAL1 in T cell acute lymphoblastic leukemia (T-ALL) requires RBTN1 or -2 and induces TALLA1, a highly specific tumor marker of T-ALL.
J Biol Chem
272:4576,
1997[Abstract/Free Full Text]
13.
Elwood NJ,
Cook WD,
Metcalf D,
Begley CG:
SCL, the gene implicated in human T-cell leukemia is oncogenic in a murine T-lymphocyte cell line.
Oncogene
8:3093,
1993[Medline]
[Order article via Infotrieve]
14.
Kelliher MA,
Seldin DC,
Leder P:
Tal-1 induces T cell acute lymphoblastic leukemia accelerated by casein kinase II .
EMBO J
15:5160,
1996[Medline]
[Order article via Infotrieve]
15.
Larson RC,
Lavenir I,
Larson TA,
Baer R,
Warren AJ,
Wadman I,
Nottage K,
Rabbitts TH:
Protein dimerization between Lmo2 (Rbtn2) and Tal1 alters thymocyte development and potentiates T cell tumorigenesis in transgenic mice.
EMBO J
15:1021,
1996[Medline]
[Order article via Infotrieve]
16.
Condorelli GL,
Facchiano F,
Valtieri M,
Proietti E,
Vitelli L,
Lulli V,
Huebner K,
Peschle C,
Croce CM:
T-cell-directed TAL-1 expression induces T-cell malignancies in transgenic mice.
Cancer Res
56:5113,
1996[Abstract/Free Full Text]
17.
Visvader J,
Begley CG,
Adams JM:
Differential expression of the LYL, SCL and E2A helix-loop-helix genes within the hemopoietic system.
Oncogene
6:187,
1991[Medline]
[Order article via Infotrieve]
18.
Green AR,
Salvaris E,
Begley CG:
Erythroid expression of the `helix-loop-helix' gene, SCL.
Oncogene
6:475,
1991[Medline]
[Order article via Infotrieve]
19.
Green AR,
Lints T,
Visvader J,
Harvey R,
Begley CG:
SCL is coexpressed with GATA-1 in hemopoietic cells but is also expressed in developing brain.
Oncogene
7:653,
1992[Medline]
[Order article via Infotrieve]
20.
Mouthon MA,
Bernard O,
Mitjavila MT,
Romeo PH,
Vainchenker W,
Mathieu-Mahul D:
Expression of tal-1 and GATA-binding proteins during human hematopoiesis.
Blood
81:647,
1993[Abstract/Free Full Text]
21.
Kallianpur AR,
Jordan JE,
Brandt SJ:
The SCL/TAL-1 gene is expressed in progenitors of both the hematopoietic and vascular systems during embryogenesis.
Blood
83:1200,
1994[Abstract/Free Full Text]
22.
Pulford K,
Lecointe N,
Leroy-Viard K,
Jones M,
Mathieu-Mahul D,
Mason DY:
Expression of TAL-1 proteins in human tissues.
Blood
85:675,
1995[Abstract/Free Full Text]
23.
Robb L,
Lyons I,
Li RL,
Hartley L,
Kontgen F,
Harvey RP,
Metcalf D,
Begley CG:
Absence of yolk sac hematopoiesis from mice with a targeted disruption of the SCL gene.
Proc Natl Acad Sci USA
92:7075,
1995[Abstract/Free Full Text]
24.
Shivdasani RA,
Mayer EL,
Orkin SH:
Absence of blood formation in mice lacking the T-cell leukaemia oncoprotein tal-1/SCL.
Nature
373:432,
1995[Medline]
[Order article via Infotrieve]
25.
Robb L,
Elwood NJ,
Elefanty AG,
Kontgen F,
Li R,
Barnett LD,
Begley CG:
The scl gene product is required for the generation of all hematopoietic lineages in the adult mouse.
EMBO J
15:4123,
1996[Medline]
[Order article via Infotrieve]
26.
Porcher C,
Swat W,
Rockwell K,
Fujiwara Y,
Alt FW,
Orkin SH:
The T cell leukemia oncoprotein SCL/tal-1 is essential for development of all hematopoietic lineages.
Cell
86:47,
1996[Medline]
[Order article via Infotrieve]
27.
Aplan PD,
Nakahara K,
Orkin SH,
Kirsch IR:
The SCL gene product: A positive regulator of erythroid differentiation.
EMBO J
11:4073,
1992[Medline]
[Order article via Infotrieve]
28.
Miller BA,
Floros J,
Cheung JY,
Wojchowski DM,
Bell L,
Begley CG,
Elwood NJ,
Kreider J,
Christian C:
Steel factor affects SCL expression during normal erythroid differentiation.
Blood
84:2971,
1994[Abstract/Free Full Text]
29.
Murrell AM,
Bockamp E-O,
Gottgens B,
Chan YS,
Cross MA,
Heyworth CM,
Green AR:
Discordant regulation of SCL/TAL-1 mRNA and protein during erythroid differentiation.
Oncogene
11:131,
1995[Medline]
[Order article via Infotrieve]
30.
Green AR,
Rockman S,
DeLuca E,
Begley CG:
Induced myeloid differentiation of K562 cells with downregulation of erythroid and megakaryocytic transcription factors: A novel experimental model for hemopoietic lineage restriction.
Exp Hematol
21:525,
1993[Medline]
[Order article via Infotrieve]
31.
Tanigawa T,
Elwood N,
Metcalf D,
Cary D,
DeLuca E,
Nicola NA,
Begley CG:
The SCL gene product is regulated by and differentially regulates cytokine responses during myeloid leukemic cell differentiation.
Proc Natl Acad Sci USA
90:7864,
1993[Abstract/Free Full Text]
32.
Tanigawa T,
Nicola N,
McArthur GA,
Strasser A,
Begley CG:
Differential regulation of macrophage differentiation in response to leukemia inhibitory factor/oncostatin-M/interleukin-6: The effect of enforced expression of the SCL transcription factor.
Blood
85:379,
1995[Abstract/Free Full Text]
33.
Hoang T,
Paradis E,
Brady G,
Billia F,
Nakahara K,
Iscove NN,
Kirsch IR:
Opposing effects of the basic helix-loop-helix transcription factor SCL on erythroid and monocytic differentiation.
Blood
87:102,
1996[Abstract/Free Full Text]
34.
Condorelli GL,
Tocci A,
Botta R,
Facchiano F,
Testa U,
Vitelli L,
Valtieri M,
Croce CM,
Peschle C:
Ectopic TAL-1/SCL expression in phenotypically normal or leukemic myeloid precursors: proliferative and antiapoptotic effects coupled with a differentiation blockade.
Mol Cell Biol
17:2954,
1997[Abstract]
35.
Miller AD,
Rosman GJ:
Improved retroviral vectors for gene transfer and expression.
Biotechniques
7:980,
1989[Medline]
[Order article via Infotrieve]
36.
Yang Y,
Vanin EF,
Whitt MA,
Fornerod M,
Zwart R,
Schneiderman RD,
Grosveld G,
Nienhuis AW:
Inducible, high-level production of infectious murine leukemia retroviral vector particles pseudotyped with vesicular stomatitis virus G envelope protein.
Hum Gene Ther
6:1203,
1995[Medline]
[Order article via Infotrieve]
37.
Bowtell DD,
Johnson GR,
Kelso A,
Cory S:
Expression of genes transferred to haemopoietic stem cells by recombinant retroviruses.
Mol Biol Med
4:229,
1987[Medline]
[Order article via Infotrieve]
38.
Miller AD,
Buttimore C:
Redesign of retrovirus packaging cell lines to avoid recombination leading to helper virus production.
Mol Cell Biol
6:2895,
1986[Abstract/Free Full Text]
39.
Bender MA,
Palmer TD,
Gelinas RE,
Miller AD:
Evidence that the packaging signal of Moloney murine leukemia virus extends into the gag region.
J Virol
61:1639,
1987[Abstract/Free Full Text]
40.
Elwood NJ,
Zogos H,
Willson T,
Begley CG:
Retroviral transduction of human progenitor cells: Use of granulocyte colony-stimulating factor plus stem cell factor to mobilize progenitor cells in vivo and stimulation by Flt3/Flk-2 ligand in vitro.
Blood
88:4452,
1996[Abstract/Free Full Text]
41.
Begley CG,
Basser R,
Mansfield R,
Thomson B,
Parker WRL,
Layton J,
To B,
Cebon J,
Sheridan WP,
Fox RM,
Green MD:
Enhanced levels and enhanced clonogenic capacity of blood progenitor cells following administration of SCF plus G-CSF to humans.
Blood
90:3378,
1997[Abstract/Free Full Text]
42.
Krause DS,
Fackler MJ,
Civin CI,
May WS:
CD34: Structure, biology, and clinical utility.
Blood
87:1,
1996[Free Full Text]
43.
Huang S,
Terstappen LWMM:
Lymphoid and myeloid differentiation of single human CD34+, HLA-DR+, CD38- hematopoietic stem cells.
Blood
83:1515,
1994[Abstract/Free Full Text]
44.
Schmitt C,
Ktorza S,
Sarun S,
Verpilleux M-P,
Blanc C,
Deugnier M-A,
Dalloul A,
Debre P:
CD34-positive early stages of human T-cell differentiation.
Leuk Lymphoma
17:43,
1995[Medline]
[Order article via Infotrieve]
45.
Murray L,
Chen B,
Galy A,
Chen S,
Tushinski R,
Uchida N,
Negrin R,
Tricot G,
Jagannath S,
Vesole D,
Barlogie B,
Hoffman R,
Tsukamoto A:
Enrichment of human hematopoietic stem cell activity in the CD34+thy-1+Lin subpopulation from mobilized peripheral blood.
Blood
85:368,
1995[Abstract/Free Full Text]
46.
Graf L,
Torok-Storb B:
Identification of a novel DNA sequence differentially expressed between normal human CD34+CD38hi and CD34+CD38lo marrow cells.
Blood
86:548,
1995[Abstract/Free Full Text]
47.
Rasko JEJ,
Metcalf D,
Rossner MT,
Begley CG,
Nicola NA:
The flt3/flk-2 ligand: Receptor distribution and action on murine hematopoietic cell survival and proliferation.
Leukemia
9:2058,
1995[Medline]
[Order article via Infotrieve]
48.
Begley CG,
Rasko JEJ,
Curtis D,
Takagi K,
Metcalf D,
Hilton D,
Roberts B,
Nicola NA,
Rossner MT:
Murine flt3 ligand protects M1 leukemic cells from LIF-induced differentiation and suppression of self-renewal.
Exp Hematol
24:1247,
1996[Medline]
[Order article via Infotrieve]
49. Begley CG: Human progenitor cell assays, in Morstyn G, Sheridan
W (eds): Cell Therapy. Cambridge, UK, Cambridge, 1996
50.
Rasko JEJ,
O'Flaherty E,
Begley CG:
Mpl ligand (MGDF) alone and in combination with stem cell factor (SCF) promotes proliferation and survival of human megakaryocyte, erythroid and granulocyte/macrophage progenitors.
Stem Cells
15:33,
1997[Medline]
[Order article via Infotrieve]
51. Metcalf D: Clonal Culture of Hemopoietic Cells: Techniques and
Applications. Amsterdam, The Netherlands, Elsevier, 1984
52.
Worthington RE,
Bossie-Codreanu J,
Van Zant G:
Quantitation of erythroid differentiation in vitro using a sensitive colorimetric assay for hemoglobin.
Exp Hematol
15:85,
1987[Medline]
[Order article via Infotrieve]
53.
Lapidot T,
Pflumio F,
Doedens M,
Murdoch B,
Williams DE,
Dick JE:
Cytokine stimulation of multilineage hematopoiesis from immature human cells engrafted in SCID mice.
Science
255:1137,
1992[Abstract/Free Full Text]
54.
Bregni M,
Magni M,
Siena S,
Di Nicola M,
Bonadonna G,
Gianni AM:
Human peripheral blood hematopoietic progenitors are optimal targets of retroviral-mediated gene transfer.
Blood
80:1418,
1992[Abstract/Free Full Text]
55.
Lu M,
Maruyama M,
Zhang N,
Levine F,
Friedmann T,
Ho AD:
High efficiency retroviral-mediated gene transduction into CD34+ cells purified from peripheral blood of breast cancer patients primed with chemotherapy and granulocyte-macrophage colony-stimulating factor.
Hum Gene Ther
5:203,
1994[Medline]
[Order article via Infotrieve]
56.
Leroy-Viard K,
Vinit M-A,
Lecointe N,
Jouault H,
Hibner U,
Romeo P-H,
Mathieu-Mahul D:
Loss of TAL-1 protein activity induces premature apoptosis of Jurkat leukemic T cells upon medium depletion.
EMBO J
14:2341,
1995[Medline]
[Order article via Infotrieve]
57.
Metcalf D:
The molecular control of cell division, differentiation commitment and maturation in haemopoietic cells.
Nature
339:27,
1989[Medline]
[Order article via Infotrieve]
58.
Testa NG,
Dexter TM:
Cell lineages in haemopoiesis: Comments on their regulation.
Semin Immunol
2:167,
1990[Medline]
[Order article via Infotrieve]
59.
Kaushansky K:
Thrombopoietin Understanding and manipulating platelet production.
Annu Rev Med
48:1,
1997[Medline]
[Order article via Infotrieve]
60.
Migliaccio AR,
Vannucchi AM,
Migliaccio G:
Molecular control of erythroid differentiation.
Int J Hematol
64:1,
1996[Medline]
[Order article via Infotrieve]
61.
Visvader JE,
Elefanty AG,
Strasser A,
Adams JM:
GATA-1 but not SCL induces megakaryocytic differentiation in an early myeloid line.
EMBO J
11:4557,
1992[Medline]
[Order article via Infotrieve]
62.
Shivdasani RA,
Rosenblatt MF,
Zucker-Franklin D,
Jackson CW,
Hunt P,
Saris CJ,
Orkin SH:
Transcription factor NF-E2 is required for platelet formation independent of the actions of thrombopoietin/MGDF in megakaryocyte development.
Cell
81:695,
1995[Medline]
[Order article via Infotrieve]
63.
Thorsteinsdottir U,
Sauvageau G,
Hough MR,
Dragowska W,
Lansdorp PM,
Lawrence HJ,
Largman C,
Humphries RK:
Overexpression of HOXA10 in murine hematopoietic cells perturbs both myeloid and lymphoid differentiation and leads to acute myeloid leukemia.
Mol Cell Biol
17:495,
1997[Abstract]
64.
Visvader JE,
Crossley M,
Hill J,
Orkin SH,
Adams JM:
The C-terminal zinc finger of GATA-1 or GATA-2 is sufficient to induce megakaryocytic differentiation of an early myeloid cell line.
Mol Cell Biol
15:634,
1995[Abstract]
65.
Green AR,
DeLuca E,
Begley CG:
Antisense SCL suppresses self-renewal and enhances spontaneous erythroid differentiation of the human leukaemic cell line K562.
EMBO J
10:4153,
1991[Medline]
[Order article via Infotrieve]
66.
Brady G,
Billia F,
Knox J,
Hoang T,
Kirsch IR,
Voura EB,
Hawley RG,
Cumming R,
Buchwald M,
Siminovitch K,
Miyamoto N,
Boehmelt G,
Iscove NN:
Analysis of gene expression in a complex differentiation hierarchy by global amplification of cDNA from single cells.
Curr Biol
5:909,
1995[Medline]
[Order article via Infotrieve]
67.
Kulessa H,
Frampton J,
Graf T:
GATA-1 reprograms avian myelomonocytic cell lines into eosinophils, thromboblasts, and erythroblasts.
Genes Dev
9:1250,
1995[Abstract/Free Full Text]
68.
Kobayashi M,
Laver JH,
Kato T,
Miyazaki H,
Ogawa M:
Recombinant human thrombopoietin (Mpl ligand) enhances proliferation of erythroid progenitors.
Blood
86:2494,
1995[Abstract/Free Full Text]
69.
Ku H,
Yonemura Y,
Kaushansky K,
Ogawa M:
Thrombopoietin, the ligand for the Mpl receptor, synergizes with Steel factor and other early acting cytokines in supporting proliferation of primitive hematopoietic progenitors of mice.
Blood
87:4544,
1996[Abstract/Free Full Text]
70.
Green T:
Haematopoiesis. Master regulator unmasked.
Nature
383:575,
1996[Medline]
[Order article via Infotrieve]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. Salek-Ardakani, G. Smooha, J. de Boer, N. J. Sebire, M. Morrow, L. Rainis, S. Lee, O. Williams, S. Izraeli, and H. J.M. Brady
ERG Is a Megakaryocytic Oncogene
Cancer Res.,
June 1, 2009;
69(11):
4665 - 4673.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. B. de la Grange, F. Armstrong, V. Duval, M.-C. Rouyez, N. Goardon, P.-H. Romeo, and F. Pflumio
Low SCL/TAL1 expression reveals its major role in adult hematopoietic myeloid progenitors and stem cells
Blood,
November 1, 2006;
108(9):
2998 - 3004.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Capron, Y. Lecluse, A. L. Kaushik, A. Foudi, C. Lacout, D. Sekkai, I. Godin, O. Albagli, I. Poullion, F. Svinartchouk, et al.
The SCL relative LYL-1 is required for fetal and adult hematopoietic stem cell function and B-cell differentiation
Blood,
June 15, 2006;
107(12):
4678 - 4686.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Rainis, T. Toki, J. E. Pimanda, E. Rosenthal, K. Machol, S. Strehl, B. Gottgens, E. Ito, and S. Izraeli
The Proto-Oncogene ERG in Megakaryoblastic Leukemias
Cancer Res.,
September 1, 2005;
65(17):
7596 - 7602.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Hall, N. J. Slater, C. G. Begley, J. M. Salmon, L. J. Van Stekelenburg, M. P. McCormack, S. M. Jane, and D. J. Curtis
Functional but Abnormal Adult Erythropoiesis in the Absence of the Stem Cell Leukemia Gene
Mol. Cell. Biol.,
August 1, 2005;
25(15):
6355 - 6362.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Gillitzer, M. Peluso, K.-L. Laugwitz, G. Munch, S. Massberg, I. Konrad, M. Gawaz, and M. Ungerer
Retroviral Infection and Selection of Culture-Derived Platelets Allows Study of the Effect of Transgenes on Platelet Physiology Ex Vivo and on Thrombus Formation In Vivo
Arterioscler Thromb Vasc Biol,
August 1, 2005;
25(8):
1750 - 1755.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Buitenhuis, H. W. M. van Deutekom, L. P. Verhagen, A. Castor, S. E. W. Jacobsen, J.-W. J. Lammers, L. Koenderman, and P. J. Coffer
Differential regulation of granulopoiesis by the basic helix-loop-helix transcriptional inhibitors Id1 and Id2
Blood,
June 1, 2005;
105(11):
4272 - 4281.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Ravet, D. Reynaud, M. Titeux, B. Izac, S. Fichelson, P.-H. Romeo, A. Dubart-Kupperschmitt, and F. Pflumio
Characterization of DNA-binding-dependent and -independent functions of SCL/TAL1 during human erythropoiesis
Blood,
May 1, 2004;
103(9):
3326 - 3335.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Kunisato, S. Chiba, T. Saito, K. Kumano, E. Nakagami-Yamaguchi, T. Yamaguchi, and H. Hirai
Stem cell leukemia protein directs hematopoietic stem cell fate
Blood,
May 1, 2004;
103(9):
3336 - 3341.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Lahlil, E. Lecuyer, S. Herblot, and T. Hoang
SCL Assembles a Multifactorial Complex That Determines Glycophorin A Expression
Mol. Cell. Biol.,
February 15, 2004;
24(4):
1439 - 1452.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Xu, S. Huang, L.-S. Chang, A. D. Agulnick, and S. J. Brandt
Identification of a TAL1 Target Gene Reveals a Positive Role for the LIM Domain-Binding Protein Ldb1 in Erythroid Gene Expression and Differentiation
Mol. Cell. Biol.,
November 1, 2003;
23(21):
7585 - 7599.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. E. Elagib, F. K. Racke, M. Mogass, R. Khetawat, L. L. Delehanty, and A. N. Goldfarb
RUNX1 and GATA-1 coexpression and cooperation in megakaryocytic differentiation
Blood,
June 1, 2003;
101(11):
4333 - 4341.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Hall, D. J. Curtis, D. Metcalf, A. G. Elefanty, K. Sourris, L. Robb, J. R. Gothert, S. M. Jane, and C. G. Begley
The critical regulator of embryonic hematopoiesis, SCL, is vital in the adult for megakaryopoiesis, erythropoiesis, and lineage choice in CFU-S12
PNAS,
February 4, 2003;
100(3):
992 - 997.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Tang, J. L. Arbiser, and S. J. Brandt
Phosphorylation by Mitogen-activated Protein Kinase Mediates the Hypoxia-induced Turnover of the TAL1/SCL Transcription Factor in Endothelial Cells
J. Biol. Chem.,
May 17, 2002;
277(21):
18365 - 18372.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Sinclair, A. J. Bench, A. J. C. Bloor, J. Li, B. Gottgens, M. L. Stanley, J. Miller, S. Piltz, S. Hunter, E. P. Nacheva, et al.
Rescue of the lethal scl-/- phenotype by the human SCL locus
Blood,
May 13, 2002;
99(11):
3931 - 3938.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.-J. Sanchez, E.-O. Bockamp, J. Miller, L. Gambardella, and A. R. Green
Selective rescue of early haematopoietic progenitors in Scl-/- mice by expressing Scl under the control of a stem cell enhancer
Development,
December 1, 2001;
128(23):
4815 - 4827.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. M. Barton, B. Gottgens, M. Gering, J. G. R. Gilbert, D. Grafham, J. Rogers, D. Bentley, R. Patient, and A. R. Green
Regulation of the stem cell leukemia (SCL) gene: A tale of two fishes
PNAS,
May 24, 2001;
(2001)
101532998.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Huang and S. J. Brandt
mSin3A Regulates Murine Erythroleukemia Cell Differentiation through Association with the TAL1 (or SCL) Transcription Factor
Mol. Cell. Biol.,
March 15, 2000;
20(6):
2248 - 2259.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
A. G. Elefanty, C. G. Begley, L. Hartley, B. Papaevangeliou, and L. Robb
SCL Expression in the Mouse Embryo Detected With a Targeted lacZ Reporter Gene Demonstrates Its Localization to Hematopoietic, Vascular, and Neural Tissues
Blood,
December 1, 1999;
94(11):
3754 - 3763.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. G. Begley and A. R. Green
The SCL Gene: From Case Report to Critical Hematopoietic Regulator
Blood,
May 1, 1999;
93(9):
2760 - 2770.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Vyas, K. Ault, C. W. Jackson, S. H. Orkin, and R. A. Shivdasani
Consequences of GATA-1 Deficiency in Megakaryocytes and Platelets
Blood,
May 1, 1999;
93(9):
2867 - 2875.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. M. Barton, B. Gottgens, M. Gering, J. G. R. Gilbert, D. Grafham, J. Rogers, D. Bentley, R. Patient, and A. R. Green
From the Cover: Regulation of the stem cell leukemia (SCL) gene: A tale of two fishes
PNAS,
June 5, 2001;
98(12):
6747 - 6752.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|