|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 10 (May 15), 1998:
pp. 3766-3772
Human Hematopoietic Progenitors Express Erythropoietin
By
T. Stopka,
J.H. Zivny,
P. Stopkova,
J.F. Prchal, and
J.T. Prchal
From the Department of Medicine, University of Alabama at Birmingham,
Birmingham, AL and the Division of Hematology/Oncology, McGill
University, Montreal, Canada.
 |
ABSTRACT |
Erythropoietin (EPO) is a factor essential for erythroid cell
proliferation, differentiation, and survival. The production of EPO by
the kidneys in response to hypoxia and anemia is well documented. To
determine whether EPO is also produced by hematopoietic cells, we
analyzed the expression of EPO in normal human hematopoietic progenitors and in their progeny. Undifferentiated
CD34+lin hematopoietic progenitors do not
have detectable EPO mRNA. Differentiating CD34+ cells
that are stimulated with recombinant human EPO in serum-free liquid
cultures express both EPO and EPO receptor (EPOR). Because CD34+ cells represent a heterogeneous cell population, we
analyzed individual burst-forming units-erythroid (BFU-E) and
nonerythroid colony-forming unit-granulocyte-macrophage colonies for
EPO mRNA. Only BFU-E colonies were positive for EPO mRNA. Lysates from
pooled BFU-E colonies stained positively for EPO by immunoblotting. To further confirm the intrinsic nature of erythroid EPO, we replaced extrinsic EPO in erythroid colony cultures with EPO-mimicking peptide
(EMP). We show EPO expression in the EMP-stimulated BFU-Es at both mRNA
and protein levels. Stimulation of bone marrow mononuclear cells
(BMMCs) with EMP upregulated EPO expression. Furthermore, we found EPO
and EPOR mRNAs as well as EPO protein in K562 cells, a human
erythroleukemia cell line. Stimulation of K562 cells with EMP
upregulated EPO expression. We suggest that EPO of erythroid origin may
have a role in the regulation of erythropoiesis.
 |
INTRODUCTION |
ERYTHROPOIETIN (EPO) is a specific
stimulator of erythropoiesis, produced in the kidneys during adult
life1-4 or in the liver during fetal and neonatal
life.5 Its receptor, EPOR, is expressed on colony forming
unit-erythroid and burst forming unit-erythroid (BFU-E)
progenitors.6 EPO stimulates erythroid cell
proliferation,7,8 differentiation,9,10 and
inhibits apoptosis.11 Homozygous deletion of EPO or EPOR
alleles in mice leads to severe anemia and death at 11 to 15 days of
gestation.12-14 In these animals, erythroid commitment
takes place, but terminal erythroid differentiation does not proceed.
Hermine et al15 described the expression of EPO mRNA in
normal mouse bone marrow cells. Experiments with EPO and EPOR antisense
oligonucleotides showed that the inhibition of bone marrow EPO
expression affects the commitment of hematopoietic cells.15
EPO expression was also detected in several human erythroleukemia cell
lines.16,17
It has been recently shown that EPOR can be activated by small
EPO-mimicking peptides (derived from random phage display peptide libraries) that have no amino acid homology with EPO. These peptides stimulate erythroid differentiation of normal human bone marrow progenitors as well as myeloid cell lines stably transfected with EPOR.18-20
We studied EPO and EPOR expression in normal human undifferentiated and
differentiated early hematopoietic progenitors and in erythroid and
nonerythroid precursors derived from these cells.
 |
MATERIALS AND METHODS |
Tissue Culture of CD34+ cells, BFU-Es, and cell lines.
Peripheral blood mononuclear cells (PBMCs) or bone marrow mononuclear
cells (BMMCs) from normal volunteers were isolated on Ficoll-Histopaque
(Sigma Chemical Co, St Louis, MO) gradient. Informed consent from
studied human subjects was obtained. Early hematopoietic progenitors
(CD34+ cells)21 were separated by using a
CD34+ cell magnetic sorting kit (Miltenyi Biotec, Auburn,
CA).22 The CD34+ cell fraction was cultured for
12 days in StemPro-34SFM serum-free media (Life Technologies Inc,
Gaithersburg, MD) with 3 IU/mL EPO and 20 ng/mL stem cell factor.
Aliquots of 105 cells were harvested every other day for
isolation of total RNA.
BFU-E and colony-forming unit-granulocyte-macrophage (CFU-GM) colonies
were cultured in clonogenic cultures in 35-mm Petri dishes by using
semisolid medium (Methocult H4531; StemCell Technologies, Vancouver,
BC, Canada) with EPO (0.125-3 IU/mL; Life Technologies) or
EPO-mimicking peptide 1 (EMP1; 0.1-10 µmol/L; a kind gift of Amgen
and Dr D. Johnson, R.W. Johnson Pharmaceutical Research Institute).
Cultures were maintained in humidified atmosphere at 5%
CO2 and 21% O2 at 37°C. BFU-E colonies
were scored at day 7 and 14 with standard criteria.23,24
K562, Hep3B, and HepG2 cell lines (ATCC, Rockville, MD) were cultured
under the standard protocols.
Single colony reverse transcription-polymerase chain reaction
(RT-PCR).
Individual BFU-E and CFU-GM colonies containing approximately 500 to
2,000 cells were harvested under the control of a microscope and lysed
in guanidium isothiocyanate-based lysis buffer. Total RNA was isolated
by using phenol/chloroform extraction. After DNase treatment, synthesis
of the corresponding cDNA was accomplished by using Superscript II
reverse transcriptase (Life Technologies). EPO, EPOR, and G6PD cDNAs
were amplified with Taq polymerase (Life Technologies) in a Model 480 thermocycler (Perkin-Elmer Inc, Norwalk, CT) for 20 to 30 cycles.25 Sequences of specific primers for RT-PCR were as follows: upstream /downstream primers, EPO
(5 ATCACGACGGGCTGTGCTGAACAC/GGGAGATGGCTTCCTTCTGGGCTC3 ) cDNA fragment containing 2-5 exon, 289 bp; EPOR
(5 GGGAGCGTACAGAGGGTGGAGAT/AGAGCCCGGCGGTGGGAGAGCAG3 ) cDNA fragment containing 4-7 exon, 263 bp; G6PD
(5 AGGCTGCAGTTCCATGATGT/GCAGCATGGGGTGAAAATA3 ) cDNA
fragment containing 10-12 exon, 280 bp, genomic fragment 490 bp.26 Each cycle consisted of 30 seconds denaturation at 94°C, 30 seconds annealing at 58°C and 30 seconds extension at 72°C. Specificity of PCR amplification was confirmed by restriction digestion of PCR product with Pst I (23, 175, and 90 bp fragments) or
Pvu II (201 and 87 bp).
Immunoblotting of the BFU-E colony lysates.
Individual BFU-E colonies were harvested from semisolid cultures at
days 7 to 14, pooled, washed in phosphate-buffered saline (PBS), and
lysed in lysis buffer containing 300 nmol/L NaCl, 50 mmol/L Tris HCl,
pH 7.6, and 0.5% Triton X-100 (Sigma Chemical Co) for 30 to 45 minutes
on ice. After 15 minutes centrifugation at 10,000g, the lysate
was denatured for 5 minutes at 95°C in 1 × Laemli buffer and
separated by 10% sodium dodecyl sulfate-olyacrylamide gel
electrophoresis (SDS-PAGE).27 The gel was
electrophoretically transferred onto a 0.45-µm nitrocellulose
membrane (Schleicher and Schuell, Keene, NH) by using a semidry blotter
(Bio-Rad Laboratory, Hercules, CA).28 The membrane was
blocked with 5% nonfat milk in 1 × PBS/0.05% Tween-20 overnight
at 4°C. Subsequent washing and dilutions were with 1 × PBS/0.05% Tween-20 at room temperature. The primary rabbit anti-EPO
polyclonal antibody, a kind gift from Dr Goldwasser (University of
Chicago, Chicago, IL) and Dr Fingerova (Palacky University at Olomouc,
Olomouc, Czech Republic) or purchased from Genzyme (Cambridge, MA), was
detected by peroxidase-linked antirabbit antibody (Santa Cruz
Biotechnology Inc, Santa Cruz, CA). All three anti-EPO antibodies used
in our experiments gave comparable results. Activated chemiluminescence
was detected on radiograph film (Eastman Kodak Co, Rochester, NY) and
developed in an RP X-omat processor (Eastman Kodak Co). The specificity of immunostaining was verified by preincubation of primary antibody with 50 IU of recombinant human (rh) EPO. The sensitivity of
immunostaining was determined to be 5 mU of rhEPO.
Enzyme-linked immunosorbent assay (ELISA).
EPO was detected by using monoclonal anti-EPO antibody as the capture
antibody and revealed with rabbit anti-EPO polyclonal IgG (Genzyme
Cambridge, MA) followed by antirabbit IgG horseradish peroxidase
antibodies respectively. The color reaction was activated with
3,3 ,5,5 -tetramethylbenzidin (TMB) substrate and stopped with 1 mol/L
H2SO4. Optical density of samples was detected
at 450 nm on ELISA reader (Bio-Tek Instruments Inc, Winooski,
VT).29
 |
RESULTS |
Differentiating
CD34+lin+ cells
express EPO.
CD34+ cells were cultured in serum-free medium under
conditions favoring proliferation and differentiation of erythroid
cells.30,31 EPO and EPOR mRNAs were detected in
CD34+ cultured cells on days 0 to 12 of in vitro culture by
RT-PCR25,26 (Fig 1). Because
the CD34+ cells represent a heterogeneous cell population,
we have further separated them into undifferentiated
(CD34+lin ) and differentiated
hematopoietic progenitors (CD34+lin+) from
three normal subjects by fluorescence-activated cell
sorting30 (Fig 2A). EPO mRNA
was detected by RT-PCR in CD34+lin+ cells but
not in CD34+lin cells (Fig 2B).

View larger version (47K):
[in this window]
[in a new window]
| Fig 1.
Cultured CD34+ cells express EPO and EPOR
mRNAs. CD34+ cells prepared by magnetic
sorting22 were cultured with EPO to preferentially favor
differentiation of erythroid progenitors and precursors.30 Aliquots of cells were taken at days 0, 2, 4, 6, 8, and 12; total RNA
was isolated; and EPO and EPOR cDNAs were generated by RT-PCR by using
specific primers. Size marker 123 bp ladder (M), negative control
( ), genomic DNA (g), EPO cDNA (+) upper panel, EPO cDNA (+)
lower panel.
|
|

View larger version (36K):
[in this window]
[in a new window]
| Fig 2.
EPO expression in CD34+ cells. (A) Bone
marrow cells were first enriched for CD34+ cells by
magnetic sorting.22 Cells were further separated by fluorescence-activated cell sorting by using phycoerythrin-labeled anti-34 antibody recognizing a different CD34 epitope and cocktail of
anti-lin (CD2, CD14, CD15, CD16, CD19, and glycophorin) antibodies labeled with fluorescein isothiocyanate.
CD34+lin (R1) and
CD34+lin+ (R2). (B) Total RNA from
separated cells (4 × 104 of
CD34+lin and 1 × 104 of
CD34+lin+) was prepared for RT-PCR (35 cycles) with EPO and G6PD primers (CD34+lin cDNA template was prepared from
4 times more cells than CD34+lin+ cDNA,
which resulted in higher genomic DNA contamination detected by PCR).
CD34+lin+ cells (lane R2) contain EPO mRNA,
whereas CD34+lin do not (lane R1). Size
marker 123 bp ladder (M), negative control ( ), genomic DNA (g), EPO
and G6PD cDNA (+).
|
|
BFU-E colony cells express EPO mRNA.
In vitro clonogenic cultures23,24 were used to grow
individual erythroid (BFU-E) and nonerythroid (CFU-GM) colonies in the
presence of rhEPO. Individual colonies (500-2,000 cells/colony) were
analyzed by RT-PCR for EPO and EPOR expression. We analyzed individual
BFU-E (n 15) and CFU-GM (n 15) colonies from each of three normal
subjects and pooled BFU-E and CFU-GM colonies from each of eight
additional normal subjects. EPO and EPOR mRNAs were detected in BFU-E
colonies at different stages of erythroid differentiation but not in
nonerythroid colonies (Fig 3A). EPO RT-PCR
products were verified by restriction digestion. The same restriction
pattern was detected from each of the analyzed samples as well as from
the RT-PCR product amplified from control EPO cDNA clone (Fig 3B).

View larger version (62K):
[in this window]
[in a new window]
| Fig 3.
Individual BFU-E but not CFU-GM colonies express EPO. (A)
Individual erythroid BFU-E and nonerythroid CFU-GM colonies stimulated with EMP were harvested and analyzed by RT-PCR for EPO, EPOR, and G6PD.
BFU-E colonies (lanes 1-4) contain EPO and EPOR mRNAs, and CFU-GM
colonies (lanes 5-8) were negative. The housekeeping gene G6PD is
expressed in both types of colonies. Size marker 123 bp ladder (M),
negative control ( ), genomic DNA (g), EPO, EPOR, or G6PD cDNA (+).
(B) Restriction digestion analysis. EPO RT-PCR products prepared from
individual BFU-E colonies (lanes 2-4) were digested (lanes 6-8) with
either PstI (upper panel) or PvuII (lower panel). cDNA EPO template PCR
product (lane 1) and its digest (lane 5). A similar restriction pattern
in respect to the size of digested DNA (PstI digest, 175, 90, and 23 bp; PvuII digest, 201 and 87 bp) was obtained from all analyzed
samples.
|
|
BFU-E colony cells express EPO on protein level.
To study EPO expression in erythroid cells at the protein level, we
analyzed pooled BFU-Es with specific anti-EPO antibodies on Western
blots. Normal BMMCs were stimulated with rhEPO in semisolid cultures.
BFU-E colonies were harvested at day 10, repeatedly washed, and
analyzed by immunoblotting. A specific single band was detected in
BFU-E colony lysates with comparable electrophoretic mobility to rhEPO
(Fig 4). To rule out the possibility that
the EPO detected in erythroid cells represented internalized extrinsic rhEPO, we stimulated BMMCs with an EMP. BFU-E colonies were harvested, pooled, and analyzed on Western blots for EPO.32 Endogenous EPO protein was detected in cells stimulated with EMP (Fig 4). Specific
immunostaining was completely blocked by the preincubation of anti-EPO
antibodies with rhEPO (data not shown).

View larger version (98K):
[in this window]
[in a new window]
| Fig 4.
BFU-E colonies express EPO protein. Bone marrow
mononuclear cells were plated in semisolid media with either EPO or
EMP. (A) BFU-E and CFU-GM colonies were pooled, washed,
and lysed with Triton X-100-based lysis buffer. Lysates (20 µg per
lane) were separated on 10% SDS-PAGE, transferred onto nitrocellulose
membrane, and incubated with rabbit polyclonal anti-EPO antibody. A
single band with comparable electrophoretic mobility to rhEPO (lane 1) was detected in BFU-E cells generated with EMP1 (lane 2) or with rhEPO
(lane 3). The EPO-specific band was absent in Epstein-Barr virus-transformed lymphocytes (lane 4), granulocytes (lane 5), monocytes (lane 6), and CFU-GM colonies (lane 7). The same membrane was
reprobed with antibodies against abundantly expressed angiotensin receptor type 1 (also expressed in BFU-E colony cells)26
and a specific band of comparable intensity was detected in all
samples. (B) Coomassie staining of protein lysates used on Western
blots. To see electrophoretic migration rhEPO was loaded in excess of 50 U/lane.
|
|
EMP upregulates EPO expression in bone marrow cells.
To study the regulation of EPO production in human bone marrow, BMMCs
were stimulated with EMP in serum-free medium for 6 hours and EPO in
cell lysates was detected on Western blots. EMP upregulated EPO
expression (Fig 5A).

View larger version (41K):
[in this window]
[in a new window]
| Fig 5.
EMP1 upregulates EPO expression in BMMCs. Normal BMMCs
were cultured for 2 hours in serum-free medium and then stimulated for
6 hours with EMP1 (0, 0.05, 0.1, and 0.5 µmol/L). Cell lysates (10 µg/lane) were analyzed for EPO on Western blots (A). EMP1 upregulates
EPO expression in BMMCs with increasing EMP1 concentration up to 0.1 µmol/L. No carrier protein was added to rhEPO in lane 1 and, thus,
the intensity of rhEPO band is not comparable with the intensities of
EPO bands detected in cell lysates. (B) Coomassie staining of 10%
SDS-PAGE separated cell lysates (10 µg per lane). In the EPO lane, 50 U of rhEPO was used.
|
|
EMP upregulates secretion of EPO by erythroleukemia and
hepatocarcinoma cell lines.
HepG233,34 and K562 human erythroleukemia
cells31 were used to determine EPO production in response
to EPOR stimulation. Expression of EPO in K562 and HepG2 cells was
detected by RT-PCR (data not shown) or immunoblotting
(Fig 6A). K562 and HepG2 cells were
cultured in serum-free medium and stimulated with EMP for 16 hours; the EPO in supernatants was quantitated by ELISA.29,34 We show that EPO production was upregulated by EMP (Fig 6B).

View larger version (61K):
[in this window]
[in a new window]

View larger version (12K):
[in this window]
[in a new window]
| Fig 6.
(A) K562 erythroleukemia cells express EPO. Total protein
cell lysates (10 µg/lane) from K562 cells, from rhEPO stimulated BFU-E colonies, and from HepG2 cells were analyzed by immunoblotting with anti-EPO antibodies. rhEPO (1 U/lane) is shown on lane 1. (B) K562
cells secrete EPO in response to stimulation with EMP. EMP1 was used
(0.1 µmol/L represents optimal stimulatory concentration) for
stimulation of K562 and HepG2 cells (5 × 106 cells/mL) in
serum-free media for 16 hours. The EPO concentration was measured in
supernatant by ELISA29 (EMP1 does not crossreact with
anti-EPO antibodies). Error bars represent EPO concentration ± standard deviation.
|
|
Hypoxia or cobalt chloride upregulates EPO erythroid expression.
The effect of hypoxia on EPO expression (determined by immunoblotting)
was measured in K562 and HepG2 cell lines. The incubation of these
cells on 1% of oxygen increased EPO expression at the protein level
1.2 and 1.5 times, respectively. Similar augmentation of EPO production
was seen when these cells were incubated with cobalt chloride (data not
shown). To further study the effect of cobalt chloride on regulation of
erythropoiesis we enumerated BFU-E colonies derived from PBMCs or
CD34+ cells in the absence and in the presence of a
suboptimal stimulatory concentration of rhEPO (0 and 2 U/mL) under
different concentrations of cobalt chloride. We show that
cobalt chloride stimulated the formation of BFU-E colonies in the
absence of EPO and increased their numbers when a submaximal
concentration of EPO was used (Fig 7). The
stimulatory effect of cobalt chloride on BFU-E colony formation
(derived from CD34+) was statistically significant for 25 µmol/L (P < .05) or 75 µmol/L (P < .01)
according to the Student's t-test.

View larger version (15K):
[in this window]
[in a new window]
| Fig 7.
BFU-E colonies derived from PBMCs (A) and
CD34+ (B) cells were stimulated with cobalt chloride in
semisolid cultures. Cobalt chloride stimulated formation of BFU-E
colonies derived from PBMCs (2 × 105/mL) and
CD34+ cells (104/mL) in the absence
(P < .01) and in the presence of suboptimal concentration of
rhEPO (2 U/mL; P < .05) in semisolid cultures. Colony
numbers are expressed as mean ± standard deviation.
|
|
 |
DISCUSSION |
We report that early human hematopoietic progenitors,
CD34+lin+ cells but not uncommitted
CD34+lin progenitors, express EPO. With
the progressive commitment of human differentiating hematopoietic
progenitors, EPO and EPOR are expressed only in erythroid, but not in
nonerythroid progenitors. EPO production was previously detected in
some erythroleukemia cells,16,17 and the EPO transcript was
found in mouse unseparated bone marrow cells.15 It was also
reported that murine macrophages can express EPO mRNA.35,36
Here we show that normal human CFU-GM colonies derived from
CD34+ hematopoietic progenitors or BMMCs have undetectable
EPO and EPOR mRNAs under the conditions used. Additionally, human
peripheral blood macrophages isolated by adherence on plastic showed no
detectable EPO on Western blots. EPO expression, either at the mRNA or
protein level, has not been previously reported in normal human
erythroid precursors. Because erythroid precursors differentiate from
early hematopoietic progenitors in the presence of EPO, we could not distinguish in our cultures an extrinsic or intrinsic origin of EPO
detected in erythroid precursors. We then used EMP,
EMP1,18-20 and differentiated early hematopoietic
progenitors to erythroid precursors in vitro (BFU-E colonies)
in the absence of extrinsic EPO. EPO detected in BFU-E colony cells by
immunoblotting clearly showed the intrinsic nature of EPO that is newly
synthesized by erythroid precursors.
We show that the EPO production increases with increasing stimulation
of EPOR by EMP in the hepatocarcinoma cell line HepG2, which has been
used as a model of EPO production and its regulation.37-40 We also show upregulation of EPO expression by EMP in normal bone marrow cells as well as in the human erythroleukemia cell line K562,
which was not previously reported to produce EPO.
It has been recently reported that BFU-Es exposed to hypoxia in the
presence of EPO have formed larger numbers of BFU-E colonies compared
with normoxic control. Hypoxia was shown to increase proliferation of
BFU-Es whereas their terminal differentiation was
inhibited.41 We showed that cobalt chloride, a known
stimulator of EPO expression, augmented the formation of BFU-E colonies
from either PBMCs or CD34+ cells in the absence and in the
presence of EPO. These experiments suggest the important role of
intrinsic erythroid EPO expression in the regulation of erythroid
differentiation.
The results reported here, suggesting a role of erythroid EPO in
terminal erythroid differentiation, are supported by studies in EPO or
EPOR knock-out mice, in which the erythroid commitment takes place but
erythroid differentiation does not proceed beyond the level of BFU-E
progenitors.12-14 This contention is also supported by our
previous work showing that neutralizing anti-EPO or anti-EPOR antibodies block erythroid differentiation of early
BFU-Es.42,43 However, the addition of these antibodies to
cultures of cells at later stages of erythroid differentiation does not
inhibit BFU-E colony formation.42 The upregulation of
erythroid EPO production by EPOR stimulation suggested that EPO
expression in hematopoietic cells may play an important supportive role
in erythropoiesis. However, the physiological role of intrinsic EPO and
its precise role in the regulation of erythropoiesis has to be defined
and further studies on genetically engineered cell lines and animals will be required.
 |
FOOTNOTES |
Submitted October 23, 1997;
accepted January 12, 1998.
Supported by a Veterans Administration Hospital Merit Grant, the United
States Public Health Service, National Institutes of Health Grants No.
HL51650 and HL50077, and by Internal Grant Agency of Czech Republic
Grant No. 4917-3.
Address reprint requests to J.T. Prchal, MD, 1900 University Blvd, #513
THT, Birmingham, AL 35294.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
 |
ACKNOWLEDGMENT |
We thank the R.W. Johnson Pharmaceutical Research Institute for
allowing us to use the peptide mimicking EPO and especially Dr Dana L. Johnson for information concerning the use of EMP peptide. We thank Drs
V. Divoky, T. Townes, E. Goldwasser, and R. Kralovics for helpful
discussion and M. Divoka for technical assistance.
 |
REFERENCES |
1.
Krantz SB:
Ertythropoietin.
Blood
77:419,
1991[Free Full Text]
2.
Jacobs K,
Shoemaker C,
Rudersdorf R,
Neill SD,
Kaufman RJ,
Mufson A,
Seehra J,
Jones SS,
Hewick R,
Fritsch EF,
Kawakita M,
Shimitzu T,
Miyake T:
Isolation and characterization of genomic and cDNA clones of human erythropoietin.
Nature
313:806,
1985[Medline]
[Order article via Infotrieve]
3.
Jacobson LO,
Goldwasser E,
Fried W,
Pizak L:
Nature
179:633,
1957[Medline]
[Order article via Infotrieve]
4.
Beru N,
McDonald J,
Lacombe C,
Goldwasser E:
Expression of the erythropoietin gene.
Mol Cell Biol
6:2571,
1986[Abstract/Free Full Text]
5.
Eckhardt KU:
The ontogeny of the biological role and production of erythropoietin.
J Perinat Med
23:19,
1995[Medline]
[Order article via Infotrieve]
6.
Jones SS,
D'Andrea AD,
Haines LL,
Wong GG:
Human erythropoietin receptor: Cloning, expression, and biologic characterization.
Blood
76:31,
1990[Abstract/Free Full Text]
7.
Watowich SS,
Yoshimura A,
Longmore GD,
Hilton DJ,
Yoshimura Y,
Lodish HF:
Homodimerization and constitutive activation of the erythropoietin receptor.
Proc Natl Acad Sci USA
89:2140,
1992[Abstract/Free Full Text]
8.
Kirby S,
Cook D,
Walton W,
Smithies O:
Proliferation of multipotent hematopoietic cells controlled by truncated erythropoietin receptor transgene.
Proc Natl Acad Sci USA
93:9402,
1996[Abstract/Free Full Text]
9.
Penta K,
Sawyer ST:
Erythropoietin induces the tyrosine phosphorylation, nuclear translocation, and DNA binding of STAT 1 and STAT 5 in erythroid cells.
J Biol Chem
270:31282,
1995[Abstract/Free Full Text]
10.
Liboi E,
Carroll M,
D'Andrea A,
Mathey-Prevot B:
Erythropoietin receptor signals both proliferation and erythroid-specific differentiation.
Proc Natl Acad Sci USA
90:11351,
1993[Abstract/Free Full Text]
11.
Kelley LL,
Koury MJ,
Bondurant MC,
Koury ST,
Sawyer ST,
Wickrema A:
Survival or death of individual proerythroblasts results from differing erythropoietin sensitivities: A mechanism for controlled rates of erythrocyte production.
Blood
82:2340,
1993[Abstract/Free Full Text]
12.
Kieran M,
Perkins A,
Orkin S,
Zon L:
Thrombopoietin rescues in vitro erythroid formation from mouse embryos lacking the erythropoietin receptor.
Proc Natl Acad Sci USA
93:9126,
1996[Abstract/Free Full Text]
13.
Wu H,
Liu X,
Jaenisch R,
Lodish HF:
Generation of committed erythroid BFU-E and CFU-E progenitors does not require erythropoietin or the erythropoietin receptor.
Cell
83:59,
1995[Medline]
[Order article via Infotrieve]
14.
Lin Ch,
Lim S,
D'Agati V,
Costantini F:
Differential effects of an erythropoietin receptor gene disruption on primitive and definitive erythropoiesis.
Genes Dev
10:154,
1996[Abstract/Free Full Text]
15.
Hermine O,
Beru N,
Pech N,
Goldwasser E:
An autocrine role for erythropoietin in mouse hematopoietic cell differentiation.
Blood
78:2253,
1991[Abstract/Free Full Text]
16.
Mitjavila M,
Le Couedic JP,
Casadevall N,
Navarro S,
Villeval JL,
Dubart A,
Vainchenker W:
Autocrine stimulation by erythropoietin and autonomous growth of human erythroid leukemic cells in vitro.
J Clin Invest
88:789,
1991
17.
Villeval JL,
Mitjavila MT,
Dusanter-Fourt I,
Wendling F,
Mayeux P,
Vainchenker W:
Autocrine stimulation by erythropoietin (Epo) requires Epo secretion.
Blood
84:2649,
1994[Abstract/Free Full Text]
18.
Livnah O,
Stura EA,
Johnson DL,
Middlton SA,
Mulcahy LS,
Wrighton NC,
Dower WJ,
Jolliffe LK,
Wilson IA:
Functional mimicry of a protein hormone by a peptide agonist: The EPO receptor complex at 2.8 A.
Science
273:464,
1996[Abstract]
19.
Middleton SA,
Johnson DL,
Jin R,
McMahon FJ,
Collins A,
Tullai J,
Gruninger RH,
Jolliffe LK,
Mulcahy LS:
Identification of a critical ligand binding determinant of the human erythropoietin receptor. Evidence for common ligand binding motifs in the cytokine receptor family.
J Biol Chem
271:14045,
1996[Abstract/Free Full Text]
20.
Wrighton NC,
Farrell FX,
Chang R,
Kasyap AK,
Barbone FP,
Mulcafy LS,
Johnson DL,
Barrett RW,
Jolliffe LK,
Dower WJ:
Small peptides as potent mimetics of the protein hormone erythropoietin.
Science
273:458,
1996[Abstract]
21.
Ema H,
Suda T,
Miura Y,
Nakauchi H:
Colony formation of clone-sorted human hematopoietic progenitors.
Blood
75:1941,
1990[Abstract/Free Full Text]
22.
Miltenyi S,
Muller W,
Weichel W,
Radbruch A:
High gradient magnetic cell separation with MACS.
Cytometry
11:231,
1990[Medline]
[Order article via Infotrieve]
23.
Prchal JF,
Axelrad AA:
Bone-marrow responses in polycythemia vera.
N Engl J Med
289:132,
1974
24.
Eaves CJ,
Eaves AC:
Erythropoietin (Ep) dose-response curves for three classes of erythroid progenitors in normal human bone marrow and in patients with polycythemia vera.
Blood
52:1196,
1978[Free Full Text]
25.
Myers T,
Gelfand D:
Reverse transcription and DNA amplification by Thermos thermophilus DNA polymerase.
Biochemistry
30:7661,
1991[Medline]
[Order article via Infotrieve]
26.
Mrug M,
Stopka T,
Julian BA,
Prchal JF,
Prchal JT:
Angiotensin II stimulates proliferation of normal early erythroid progenitors.
J Clin Invest
100:2310,
1997[Medline]
[Order article via Infotrieve]
27.
Towbin H,
Staehelin T,
Gordon J:
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: Procedure and some applications.
Proc Natl Acad Sci
76:4350,
1979[Abstract/Free Full Text]
28.
Papayannopoulou T,
Brice M,
Farrer D,
Kaushansky K:
Thrombopoietin expands erythroid progenitors, increases red cell production, and enhances erythroid recovery after myelosuppressive therapy.
Exp Hematol
24:660,
1996[Medline]
[Order article via Infotrieve]
29.
Wognum A,
Lansdorp P,
Eaves A,
Krystal G:
An enzyme-linked immunosorbent assay for erythropoietin using monoclonal antibodies, tertrameric immune complexes, and substrate amplification.
Blood
74:622,
1989[Abstract/Free Full Text]
30.
Luhovy M,
McCune S,
Dong JY,
Prchal JF,
Townes TM,
Prchal JT:
Stable transduction of recombinant adeno-associated virus into hematopoietic stem cells from normal and sickle cell patients.
Biol Blood Marrow Transplant
2:24,
1996 [Medline]
[Order article via Infotrieve]
31.
Sasaki D:
Cloning and characterization of K562 cells on hemoglobin synthetic activity.
Biol Pharm Bull
16:548,
1993[Medline]
[Order article via Infotrieve]
32.
Laemli UK:
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680,
1970[Medline]
[Order article via Infotrieve]
33.
Anagnostou A,
Liu Z,
Steiner M,
Chin K,
Lee ES,
Kessimian N,
Noguchi CT:
Erythropoietin receptor mRNA expression in human endothelial cells.
Proc Natl Acad Sci USA
91:3974,
1994[Abstract/Free Full Text]
34.
Ohigashi T,
Yoshioka K,
Fisher JW:
Autocrine regulation of erythropoietin gene expression in human hepatocellular carcinoma cells.
Life Sci
58:421,
1996[Medline]
[Order article via Infotrieve]
35.
Rich IN,
Heit W,
Kubanek B:
External erythropoietin production by macrophages.
Blood
60:1007,
1982[Abstract/Free Full Text]
36.
Vogt C,
Pentz S,
Rich IN:
A role for the macrophage in normal hematopoiesis: III. In vitro and in vivo erythropoietin gene expression in macrophages detected by in situ hybridization.
Exp Hematol
17:391,
1989[Medline]
[Order article via Infotrieve]
37.
Goldberg M,
Glass G,
Cunningham J,
Bunn H:
The regulated expression of erythropoietin by two human hepatoma cell lines.
Proc Natl Acad Sci USA
84:7972,
1987[Abstract/Free Full Text]
38.
Semenza GL,
Roth PH,
Fang HM,
Wang GL:
Transcriptional regulation of genes encoding glycolytic enzymes by hypoxia inducible factor 1.
J Biol Chem
269:1,
1994[Free Full Text]
39.
Wang GL,
Semenza GL:
Characterization of hypoxia-inducible factor 1 and regulation of DNA binding activity by hypoxia.
J Biol Chem
268:2513,
1993[Abstract/Free Full Text]
40.
Maxwell PH,
Pugh CW,
Ratcliffe J:
Inducible operation of the EPO gene 3 enhancer in multiple lines: Evidence for a widespread mechanism.
Proc Natl Acad Sci USA
90:2423,
1993[Abstract/Free Full Text]
41.
Cipolleschi MG,
D'ippolito G,
Bernabei PA,
Caporale R,
Nannini R,
Mariani M,
Fabbiani M,
Rossi-Ferrini P,
Olivotto M,
Sbarba PD:
Severe hypoxia enhances the formation of erythroid bursts from human cord blood cells and the maintenance of BFU-E in vitro.
Exp Hematol
25:1187,
1997[Medline]
[Order article via Infotrieve]
42.
Fisher MJ,
Prchal JF,
Prchal JT,
D'Andrea AD:
Anti-erythropoietin (EPO) receptor monoclonal antibodies distinguish EPO-dependent and EPO-independent erythroid progenitors in polycythemia vera.
Blood
84:1982,
1994[Abstract/Free Full Text]
43.
Kralovics R,
Indrak K,
Stopka T,
Berman BW,
Prchal JF,
Prchal JT:
Two new EPO receptor mutations: Truncated EPO receptors are most frequently associated with primary familial and congenital polycythemias.
Blood
90:2057,
1997[Abstract/Free Full Text]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
T. S. Fisher, S. D. Etages, L. Hayes, K. Crimin, and B. Li
Analysis of ARD1 Function in Hypoxia Response Using Retroviral RNA Interference
J. Biol. Chem.,
May 6, 2005;
280(18):
17749 - 17757.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Scortegagna, K. Ding, Q. Zhang, Y. Oktay, M. J. Bennett, M. Bennett, J. M. Shelton, J. A. Richardson, O. Moe, and J. A. Garcia
HIF-2{alpha} regulates murine hematopoietic development in an erythropoietin-dependent manner
Blood,
April 15, 2005;
105(8):
3133 - 3140.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-T. Chang, L. Sefc, O. Psenak, M. Vokurka, and E. Necas
Early Fetal Liver Readily Repopulates B Lymphopoiesis in Adult Bone Marrow
Stem Cells,
February 1, 2005;
23(2):
230 - 239.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Akel, C. Petrow-Sadowski, M. J. Laughlin, and F. W. Ruscetti
Neutralization of Autocrine Transforming Growth Factor-{beta} in Human Cord Blood CD34+CD38-Lin- Cells Promotes Stem-Cell-Factor-Mediated Erythropoietin-Independent Early Erythroid Progenitor Development and Reduces Terminal Differentiation
Stem Cells,
September 1, 2003;
21(5):
557 - 567.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Giron-Michel, A. Caignard, M. Fogli, D. Brouty-Boye, D. Briard, M. van Dijk, R. Meazza, S. Ferrini, C. Lebousse-Kerdiles, D. Clay, et al.
Differential STAT3, STAT5, and NF-{kappa}B activation in human hematopoietic progenitors by endogenous interleukin-15: implications in the expression of functional molecules
Blood,
July 1, 2003;
102(1):
109 - 117.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Acs, P. J. Zhang, C. M. McGrath, P. Acs, J. McBroom, A. Mohyeldin, S. Liu, H. Lu, and A. Verma
Hypoxia-Inducible Erythropoietin Signaling in Squamous Dysplasia and Squamous Cell Carcinoma of the Uterine Cervix and Its Potential Role in Cervical Carcinogenesis and Tumor Progression
Am. J. Pathol.,
June 1, 2003;
162(6):
1789 - 1806.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Pawlak, M. Koda, S. Pawlak, S. Wolczynski, and W. Buczko
Contribution of quinolinic acid in the development of anemia in renal insufficiency
Am J Physiol Renal Physiol,
April 1, 2003;
284(4):
F693 - F700.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. D. Pastore, J. Jelinek, S. Ang, Y. Guan, E. Liu, K. Jedlickova, L. Krishnamurti, and J. T. Prchal
Mutations in the VHL gene in sporadic apparently congenital polycythemia
Blood,
February 15, 2003;
101(4):
1591 - 1595.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Hisakawa, D. Sugiyama, I. Nishijima, M.-j. Xu, H. Wu, K. Nakao, S. Watanabe, M. Katsuki, S. Asano, K.-i. Arai, et al.
Human granulocyte-macrophage colony-stimulating factor (hGM-CSF) stimulates primitive and definitive erythropoiesis in mouse embryos expressing hGM-CSF receptors but not erythropoietin receptors
Blood,
December 15, 2001;
98(13):
3618 - 3625.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Magnanti, O. Gandini, L. Giuliani, P. Gazzaniga, H. H. Marti, A. Gradilone, L. Frati, A. M. Agliano, and M. Gassmann
Erythropoietin expression in primary rat Sertoli and peritubular myoid cells
Blood,
November 1, 2001;
98(9):
2872 - 2874.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Majka, A. Janowska-Wieczorek, J. Ratajczak, K. Ehrenman, Z. Pietrzkowski, M. A. Kowalska, A. M. Gewirtz, S. G. Emerson, and M. Z. Ratajczak
Numerous growth factors, cytokines, and chemokines are secreted by human CD34+ cells, myeloblasts, erythroblasts, and megakaryoblasts and regulate normal hematopoiesis in an autocrine/paracrine manner
Blood,
May 15, 2001;
97(10):
3075 - 3085.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Tordjman, S. Delaire, J. Plouet, S. Ting, P. Gaulard, S. Fichelson, P.-H. Romeo, and V. Lemarchandel
Erythroblasts are a source of angiogenic factors
Blood,
April 1, 2001;
97(7):
1968 - 1974.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Janowska-Wieczorek, M. Majka, J. Ratajczak, and M. Z. Ratajczak
Autocrine/Paracrine Mechanisms in Human Hematopoiesis
Stem Cells,
February 1, 2001;
19(2):
99 - 107.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. Gupta, P. T. Mungai, and E. Goldwasser
A new transacting factor that modulates hypoxia-induced expression of the erythropoietin gene
Blood,
July 15, 2000;
96(2):
491 - 497.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Yin and K. L. Blanchard
DNA methylation represses the expression of the human erythropoietin gene by two different mechanisms
Blood,
January 1, 2000;
95(1):
111 - 119.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. L. Ebert and H. F. Bunn
Regulation of the Erythropoietin Gene
Blood,
September 15, 1999;
94(6):
1864 - 1877.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Aiuti, L. Turchetto, M. Cota, A. Cipponi, A. Brambilla, C. Arcelloni, R. Paroni, E. Vicenzi, C. Bordignon, and G. Poli
Human CD34+ Cells Express CXCR4 and Its Ligand Stromal Cell-Derived Factor-1. Implications for Infection by T-Cell Tropic Human Immunodeficiency Virus
Blood,
July 1, 1999;
94(1):
62 - 73.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|