|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 10 (May 15), 1998:
pp. 3920-3926
Inactivation of the ATM Gene in T-Cell Prolymphocytic
Leukemias
By
Dominique Stoppa-Lyonnet,
Jean Soulier,
Anthony Laugé,
Hélène Dastot,
Richard Garand,
François Sigaux, and
Marc-Henri Stern
From the Unité INSERM U462, Hôpital Saint Louis, Paris,
France; Unité de Génétique Oncologique, Institut
Curie, Paris, France; and the Laboratoire d'Hématologie, Nantes,
France; for the Groupe Français d'Hématologie Cellulaire.
 |
ABSTRACT |
T-cell prolymphocytic leukemia (T-PLL) is a rare form of mature
leukemia that occurs both in adults as a sporadic disease and in
younger patients suffering an hereditary condition, ataxia telangiectasia (AT). The ATM gene, located in the 11q22-23
chromosomal region, is consistently mutated in AT patients. The strong
predisposition of AT patients to develop T-PLL and the high frequency
of T-cell leukemias/lymphomas observed in atm-deficient mice,
together with the known functions of the ATM protein, led us to
evaluate the ATM gene as a potential tumor suppressor gene
involved in T-PLL. Paired leukemic and nonleukemic cells were obtained
from a series of 15 patients suffering sporadic T-PLLs, allowing loss
of heterozygosity (LOH) analysis. LOH of the 11q22-23 region was
detected in 10 of these 15 cases (67%). The minimal deleted region was
defined as an approximately 2.5 Mb interval that contained the ATM
gene. No ATM rearrangement or biallelic deletion was
detected by Southern blotting in the T-PLL series. However, in five
T-PLLs with LOH of the 11q22-23 region, Western blot analysis showed
either undetectable (3 cases) or decreased levels (1 case) of ATM
protein, whereas ATM was present at high levels in cases without LOH.
The protein truncation test (PTT) was then used to search for mutations
in the ATM gene. Four mutations (1 nonsense, 2 aberrant
splicings, and 1 missense) were detected in patients with LOH and none
in patients without LOH of the region. The acquired character of these
ATM mutations was demonstrated in three patients. Altogether, allelic
ATM inactivations by large deletions or mutations were found in
approximately two thirds of T-PLL. ATM is thus a tumor suppressor gene whose inactivation is a key event in the development of
T-cell prolymphocytic leukemias.
 |
INTRODUCTION |
T-CELL PROLYMPHOCYTIC leukemia (T-PLL) is
a rare lymphoid neoplasm generally associated with a high count of
atypical lymphocytes with a postthymic phenotype, lymphadenopathy,
splenomegaly, skin lesions, and an aggressive clinical
course.1 Molecular characterization of recurrent
chromosomal aberrations associated with T-PLL led to the identification
of the MTCP1 and TCL1 genes located on the Xq28 and
14q32.1 regions, respectively.2-4 These genes code for a
new class of oncoproteins of, as yet, unknown cellular
functions.5,6 On the other hand, the relationship between a
rare genetic condition, ataxia telangiectasia (AT) and the occurrence
of T-PLL has been progressively recognized.7-9 Four lines
of evidence support this link: (1) peripheral blood karyotypes show
clonal aberrations in approximately 10% of AT
patients.10-14 These aberrations have been shown to occur
in lymphoid T-cell populations (named AT clonal proliferations or
ATCP), which share many morphologic, immunologic, cytogenetic, and
molecular features of T-PLL, except that they are not associated with
lymphocytosis or with clinical evidence of
malignancy2-4,6,7,15,16 (for reviews, see
Stern8 and Taylor et al9). (2) The progression
of a few cases of ATCP into a bona fide T-PLL with an aggressive
clinical course further argues that ATCP represents the preleukemic
stage of T-PLL.9,11,12,17-19 (3) Epidemiological data
highlight the strong predisposition of AT patients to develop T-cell
leukemias/lymphomas, including T-PLL.9 (4) Knock-out mice
with a complete AT-like phenotype consistently develop immature T-cell
malignancies in a few months.20-22
Positional cloning has allowed the identification of ATM, a
unique gene consistently inactivated by mutation in patients with a
classical AT phenotype.23 The ATM gene, located in
the 11q22-23 chromosomal region, spans 184 kb of genomic DNA and
consists of 66 exons.24,25 The 13-kb ATM transcript
encodes a 3056 amino acid (aa) protein belonging to a subgroup of
kinases sharing homologies with the catalytic domain of
phosphatidylinositol 3-kinase and thought to be involved in DNA
metabolism and cell cycle checkpoint control.23,26
The association between ATM deficiency and occurrence of T-PLL
prompted us to search for ATM allelic deletions or
rearrangements in sporadic T-PLLs with no history of AT. We therefore
screened a T-PLL series for allelic loss of the ATM gene region
and for abnormalities of the ATM gene.
 |
MATERIALS AND METHODS |
Cells.
A series of 15 T-PLL cases with frozen leukemic cells available was
assembled by a call to the French Hematologic centers. Patients had
major lymphocytosis and no history of ataxia telangiectasia. Diagnosis
of T-PLL was established according to the French-American-British (FAB)
criteria for chronic (mature) leukemia.27 DNA samples from
each of these patients were prepared from buccal cavity epithelial cells, fractionated granular cells, or Epstein-Barr virus
(EBV)-transformed cell lines established from blood
samples, allowing the analysis of paired normal and leukemic DNAs.
Loss of heterozygosity (LOH) analysis.
Nine polymorphic DNA markers flanking and within the ATM gene
on 11q22-q23 were amplified by polymerase chain reaction (PCR), allowing the heterozygosity status analysis. The 11q22-23
microsatellite markers D11S1817, D11S1819, D11S2179, D11S1778,
D11S1294, D11S2180, D11S2178, D11S1300, and D11S1391 (from centromere
to telomere) were selected, in view of the map described by Savitsky et
al23 and by Laake et al28 (see Table 1). Eight
additional markers on chromosome 11 were used to explore the extent of
the deletions, namely D11S932 (located on chromosomal band 11p15),
D11S913 (11q12), D11S901 (11q13.5), D11S917 (11q14.3), D11S938 (11q23),
D11S925 (11q23), D11S934 (11q23.3), and D11S910 (11q25). The primer
sets were synthesized by Genset (Paris, France). The relative
intensities of the two amplified allelic markers were compared after
autoradiography. In patients showing a germinal heterozygosity for a
given marker, the complete, or near complete ( 90% decreased
intensity) absence of an allele in the tumor samples consistent with
loss of one allele and a low level of nonleukemic cell contamination,
was interpreted as LOH.
Southern blot analysis.
High molecular weight DNA was extracted from leukemic samples,
digested with BamHI, SacI, or HindIII
restriction enzymes and the resulting fragments were separated
according to size by electrophoresis through 0.8% agarose gels. After
alkaline transfer to Hybond N+ membranes (Amersham, Les
Ulis, France) samples were hybridized with 32P radiolabeled
probes to partially explore the ATM locus. Four ATM
probes were prepared by PCR amplification of reverse transcribed peripheral blood lymphocyte (PBL) RNA using the following
primer pairs: 5 -TTTCCAAGGCTATTCAGTGTGC-3 and
5 -TGCTCTATTCCCATTTTTACCG-3 (ATM1, 1.0 kb),
5 -GGGTGTCCTTGGCTGCTACTG-3 and
5 -TGCGAACTTGGTGATGATTGTC-3 (ATM2, 1.1 kb),
5 -ATTGTGGTGGAGTTATTGATGACG-3 and
5 -AGCGAACAATCCCAGCCTAAAA-3 and
5 -GATGAGGGGATTGCTGTTTCG-3 (ATM3, 2.1 kb), and
5 -AGCGAACAATCCCAGCCTAAAA-3 and
5'-ACACCTTCAACACCCGTAATGC-3' (ATM4, 1.8 kb).
Western blotting.
Cellular proteins were extracted with Triple Detergent Lysis
Buffer,29 quantified using the BCA kit (Pierce, Rockford,
IL), sized fractionated on 5% sodium dodecyl sulfate
(SDS)-polyacrylamide gels, and electrotransfered to nitrocellulose
membranes. The membranes were blocked overnight in 5% nonfat milk
powder in PBST (phosphate-buffered saline, 0.2% Tween 20). The
anti-ATM antiserum, pAb 132, was diluted 1:2000 in the blocking buffer
and applied to the membranes.30 After a 1-hour incubation,
the membranes were washed with PBST and incubated with goat antirabbit
IgG-peroxidase conjugate (Boehringer, Meylan, France) for
1 hour. After three washes in PBST, the membranes were overlaid with
the chemiluminescent substrate solution and developed according to the
instructions of the manufacturer (ECL, Amersham).
Protein truncation test (PTT).
First strand cDNAs were generated from polyA-enriched RNAs using the
QuickPrep Micro mRNA Purification and First-Strand cDNA Synthesis kits
according to the instructions of the manufacturer (Pharmacia, Orsay, France). The coding region of the ATM
gene was divided into seven overlapping regions: region no. 1 (codons 1-533), no. 2 (codons 437-968), no. 3 (900-1388), no. 4 (1321-1818), no. 5 (1760-2177), no. 6 (2107-2618), and no. 7 (2550-3056). Forward primers were designed to include a T7 promoter sequence for the initiation of transcription by T7 RNA polymerase, as well as a translation initiation site. The primer sequences and PCR conditions are available on the Institut Curie (1997) website
(http://www.curie.fr/curie/sm/atm) or upon request. PTT analysis was
performed from the PCR products using the TNT T7 Coupled Reticulocyte
Lysate System as recommended by the manufacturer (Promega,
Lyon, France). 35S-labeled protein products were separated
on 12% SDS-polyacrylamide gel and detected by autoradiography.
Identification of the mutations.
PCR products showing an abnormal pattern in the PTT analysis were
directly sequenced using the dRhodamine Terminator Cycle Sequencing kit
on an ABI 377 automatic sequencer (PE Applied Biosystems, Foster City,
CA). The relevant genomic regions were sequenced from PCR products
using the following primers: for amplification of exon 20 and 29 regions (forward) GTTGTGCCCTTCTCTTAGTGTT (reverse) ACTCATTACATTTAGTCAGCAA, and (forward) CCAGGTCATACAACTTAATGAT (reverse) GAATTTGCTGGCTCATGTAACG, respectively31; for amplification
of the exon 45 region, (forward) TAT CTT AGG GTT CTG TTT TTA (reverse)
AGT AAC TTT GTC TTT TCA TAA T. Numbering of nucleotides is based on
either the ATM transcript sequence (accession number U33841)
for the cDNA, or on the full-length ATM gene sequence
(accession number U82828) for the genomic DNA.25,32
Numbering of codons starts at the initiating ATG.
 |
RESULTS |
LOH of the ATM region in T-PLLs.
As T-PLL is a rare disease associated with a short survival time, most
of the cases included in this series were retrospective, and samples
for these cases were obtained from cryopreserved specimens. Therefore,
to obtain nonleukemic cells and to assemble a series of paired
nonleukemic and leukemic DNAs, EBV-transformed cells lines were derived
from patients' frozen blood samples, and buccal cavity epithelial
cells or fractionated granular cells were obtained from living
patients. Altogether, a series of 15 paired DNAs were assembled from
patients with T-PLL. In 10 of the 15 cases (67%), LOH was demonstrated
for all the informative markers of the D11S1817-D11S2180 interval
(Table 1 and
Fig 1), whereas no LOH was shown in five patients for all informative markers. Analysis of eight additional markers covering chromosome 11 showed various sized regions of LOH. The
minimal region of LOH was defined by patients "Bul" and "Dia" as the interval of approximately 2.5 Mb between markers D11S917 and D11S2178, which included the ATM locus (Table 1).

View larger version (63K):
[in this window]
[in a new window]
| Fig 1.
PCR analysis of LOH. Examples of the PCR analysis of LOH
for two T-PLL cases: "Jun", which showed a large region of LOH
for the 11q22-23 informative markers, and "Bouq," which showed
balanced heterozygosity of the markers. Each autoradiograph includes
PCR products from normal (N) and tumor (T) DNAs. Arrowheads indicate allelic loss in tumor DNAs.
|
|
Southern blot analysis.
All T-PLLs were analyzed by Southern blotting using at least two
restriction digests and four ATM cDNA fragments as probes to
partially explore the 184-kb ATM locus. No biallelic deletion or DNA rearrangement was detected in the 15 T-PLL cases (data not
shown).
Western blot analysis.
Protein extracts were available from seven T-PLL cases, five with LOH
and two without LOH of the 11q22-23 region. The level of expression of
the ATM protein was determined by Western blotting using a polyclonal
antibody pAB132 directed against amino acid residues 819-844 of ATM
(Fig 2).30 ATM was highly
expressed in the two patients without LOH, at levels similar to those
observed in thymocytes and higher than in normal peripheral blood
mononuclear cells. In contrast, ATM was undetectable in three patients
with LOH (cases "Dia", "Big", and "Bul"), and its
level was reduced in patient "Imb". Expression of ATM was similar
in patient "Lec" and in patients without LOH.

View larger version (42K):
[in this window]
[in a new window]
| Fig 2.
Expression of ATM in T-PLLs . Detergent lysates (60 µg/lane) were subjected to SDS-polyacrylamide gel electrophoresis
(SDS-PAGE) through a 5% gel. Immunoblot analysis was performed using
the anti-ATM antiserum pAB 132 (upper panel). Ponceau S staining was used to verify equal loading and protein integrity (lower panel). Samples analyzed were T-PLLs with LOH of the 11q22-23 region: Dia, Big,
Bul, Imb, and Lec; T-PLLs without LOH: Ver and Ber; normal peripheral
lymphocytes (PBL); normal thymocytes (Thy). Molecular weight standards
are given in kD. The ATM specific signal is arrowed.
|
|
ATM mutations detected by PTT.
PTT analysis was performed on nine T-PLLs (seven with LOH and two
without). The ATM coding sequence was divided into seven overlapping
regions, which were amplified by PCR and analyzed after
transcription-translation. Four abnormal patterns were shown, occurring
in regions no. 2, no. 3, and no. 6 (two cases)
(Fig 3). The four relevant PCR products
were directly sequenced on both strands.

View larger version (50K):
[in this window]
[in a new window]
| Fig 3.
Mutation screening by PTT. Upper panel, schematic
representation of the ATM protein with its presently known domains. LZ: putative leucine zipper domain, Abl: Abl-binding region, PI3K: phospho-inositol 3 kinase family domain. The seven regions analyzed by
PTT are shown in relation to the ATM protein. A scale is shown in aa.
Lower panel, PTT analysis of the three regions showing abnormal
patterns. CTL-T: T-PLL sample showing a normal pattern. CTL-EBV:
corresponding EBV-transformed cell line sample. Big-T, Bat-T, Dia-T,
Bul-T: T-PLL samples showing abnormal patterns. Big-EBV, Dia-EBV,
Bul-EBV: corresponding EBV-transformed cell line samples. Dashes
indicate wild-type full-length products and arrows indicate abnormal
bands.
|
|
A protein product slightly smaller than normal was observed in region
no. 2 for patient "Big" (Fig 3). The sequence of this region
showed that a single T nucleotide was inserted at position 2891 [2891insT]. The frameshift created by this insertion led to a stop
codon 51 bases downstream. The predicted ATM protein is a truncated
protein of 901 aa, plus 17 aa added after the frameshift. The predicted
protein product for region no. 2 was compatible with the PTT result.
Analysis of nonleukemic cells (an EBV-transformed cell line) from this
patient showed a normal pattern in PTT (Fig 3) and the absence of the
2891insT mutation in the amplified cDNA fragment. To exclude an
unstable mutated ATM transcript, the corresponding genomic DNA of the
EBV cell line was amplified and its sequence was found to be normal.
An approximately 55-kD product was observed in patient
"Dia" in the PTT analysis of region no. 6, as compared with the
59.5-kD normal product (Fig 3). The amplified cDNA fragment
corresponding to this region was abnormally short and its sequence
showed a 105-bp deletion, encompassing exon 46 [6536del105]. This
deletion created no frameshift and no abnormal codon, and the predicted protein, 35 aa shorter than the wild-type protein, was compatible with
the PTT result. To understand the cause of the direct splicing of exon
45 to exon 47, the fragment containing exon 46 and the adjacent splice
donor and acceptor sites was amplified from leukemic genomic DNA and
sequenced. A single transition G to A in position +1 of the donor site
of exon 46 was detected [IVS46+1G A], putatively explaining the observed exon skipping (Fig
4A). This was an acquired mutation because the analysis of the
nonleukemic cells from this patient showed a normal pattern in PTT and
a cDNA sequence for region no. 6 identical to the published one. The
exon 46 region of genomic DNA was also amplified from "Dia"
nonleukemic cells and showed a genomic sequence identical to the
published one.

View larger version (17K):
[in this window]
[in a new window]
| Fig 4.
Analysis of ATM mutations. (A) Exon skipping in patient
"Dia". Upper panel, normal partial cDNA sequence demonstrated in
the "Dia" EBV cell line sample as compared with the tumor cDNA
sequence, which is deleted for the 105-bp of exon 46. Lower panel,
genomic sequence of germline (EBV) and tumor (T-PLL) DNAs. Exon 46 sequence is indicated in bold. The G>A mutation is double underlined.
(B) Insertion of 29 nt in tumor DNA from patient "Bat". Tumor
cDNA sequences contained, in approximately equal amounts, wild-type and
mutated (4182ins29) sequences. The normal corresponding peptide sequence is indicated. The stop codon due to the frameshift as a
consequence of the 29 nt insertion is indicated in bold and underlined.
Lines indicated the correspondence between the mutated cDNA sequence
and the normal published genomic sequence (accession number U82828).
The genomic sequence of "Bat" tumor DNA was identical to the
published one. The putative splice donor and acceptor sites on each
side of the 29 nt insertion are doubly underlined, and the exon 29 sequence is indicated in bold. Numbering of nucleotides is based on
either the ATM transcript sequence (accession number U33841)
for the cDNA, or on the full-length ATM gene sequence
(accession number U82828) for the genomic DNA.25,32
Numbering of codons starts at the initiating ATG.
|
|
PTT analysis of region no. 3 of case "Bat" showed a weak signal
of normal size and a more intense band of smaller size (Fig 3). Direct
sequence of PCR products showed a mixture of cDNA species: one
corresponding to the normal sequence and the second corresponding to an
insertion of 29 nucleotides [4182ins29] (Fig 4B). The predicted protein coded by the transcripts with the 29 nt insertion is a 1332 aa
truncated ATM protein, plus 17 aa added after the frameshift. Sequence
comparison with published sequences showed that these 29 nucleotides
corresponded to nucleotides 75086 to 75114 from the intron 28 of ATM,
which are surrounded by potential acceptor and donor splice
sites.25 The genomic region containing these 29 bp was
amplified from tumoral "Bat" DNA and sequenced. This sequence was
identical to the published one, and the cause of the 29 nt insertion
remains to be determined.
Although PTT analysis of patient "Bul" showed a normal sized
protein product for region no. 6, the pattern of small byproducts was
different from that usually observed for this test (Fig 3). The
corresponding cDNA fragment was sequenced, showing a transversion C to
G at position 7645 in patient "Bul" [7645C G],
whereas the corresponding sequence in nonleukemic cells from this
patient was normal. The consequence of this mutation is the replacement of an arginine by a glycine at codon 2486 [R2486G].
 |
DISCUSSION |
Here, we tested the hypothesis that ATM alterations could occur
at a somatic level and play a role in T-PLL in patients without AT. To
show LOH for the ATM gene region in T-PLL, we derived
EBV-transformed cell lines from frozen blood samples, or when possible,
obtained nonleukemic cells from living patients. Of the 15 cases for
whom analysis was possible, LOH was demonstrated in 10 (67%).
Deletions were variously sized, and the defined 2.5 Mb minimal
region of deletion contained the ATM gene. No evidence was
found in any case for biallelic deletion or rearrangement of the
ATM locus by Southern blotting. However, in four cases with LOH
of the 11q22-23 region, ATM protein was absent or diminished compared
with cases without LOH. We thus searched for mutations in the second
allele of ATM, using the PTT. This test was chosen considering
the previously described germinal mutations of ATM leading to
truncated proteins.33,34 Nine cases were analyzed by PTT,
seven with LOH, and two without. Abnormal patterns were observed in
four cases and further investigated by sequencing both the cDNA and the
genomic DNA for each case. Heterogeneous abnormalities were
demonstrated: one insertion of a single nucleotide, two splicing
aberrations, and one missense mutation. These mutations most probably
inactivated the ATM protein. The "Dia" mutation led
to transcripts with an in-frame deletion of exon 46, which is
associated with undetectable ATM protein by Western blot. Such
transcripts are probably not functional because an homozygote mutation
has been previously reported in an AT patient (case IARC15/AT4)
associated with the same in-frame deletion of exon 46.33
The R2486G replacement in patient "Bul" was associated with ATM
protein undetectable by Western blotting, which suggests
that this protein was unstable. The mutations in cases
"Big" and "Bat" led to ATM proteins deleted for the kinase domain, the potential leucine zipper domain, and the binding region for
c-ABL kinase product. However, the alternative splicing in patient "Bat" appeared to be leaky, and it is possible that low levels of normal protein exist in this case.
In summary, in the four patients fully investigated, the ATM
gene was inactivated by a large deletion of one allele and by a
mutation in the other. In three cases ("Dia," "Big," and
"Bul"), the acquired character of both events was
demonstrated, fitting with the model of the inactivation of a recessive
gene and the recently refined definition of a tumor suppressor gene for
the ATM gene.35-37 Mutations of ATM in
T-PLL have been recently demonstrated by Vorechovsky et
al38 and by Stilgenbauer et al.39 Our search for LOH of the ATM locus has shown a frequency of ATM deletion of 67%
in our patient series, which is similar to the observed frequencies in
the other series (44% and 54%, respectively).38,39 Their
approaches based on the single strand conformation polymorphism (SSCP)
technique, have allowed the demonstration of a higher number of
ATM mutations than our approach, PTT, which infrequently
detects the missense mutations largely represented in their series (10 of 37 T-PLL cases and four of 24 T-PLL cases,
respectively).38,39
A important question raised by the demonstration of inactivation of
ATM in T-PLL concerns the germinal or somatic origin of the
mutations. Our data showed the ATM mutations were acquired in
the three cases fully investigated. The risk of individuals with
germline heterozygosity for ATM mutation for the development of
T-PLL remains to be established.
The 11q22-23 region has been frequently implicated as the location of a
putative tumor supressor gene in various tumors, including breast
cancers.40,41 Epidemiological studies have raised the possibility that AT carriers may be at risk of developing breast cancers.42 Despite a high frequency of LOH in the 11q22-23
region, further analyses of the ATM gene did not show biallelic
alterations of this gene in breast cancers.28,31 To date,
T-PLL is the only cancer for which frequent inactivation of ATM
has been demonstrated.
ATM deficiency causes pleiotropic cellular defects in AT patients, and
ATM is likely to interact with many proteins, including p53, c-Abl, and
Chk1 (for a review on ATM functions and interactions, see
Westphal43). As has been speculated for p53, ATM
inactivation effects in tumorigenesis may be either direct, by
enhancing cell proliferation and inhibiting apoptosis, or indirect, by
enhancing genome instability. The determination of the
mechanism(s) by which ATM suppresses tumorigenesis will require more
investigations, which could be oriented by the molecular
characterization of T-PLL cases without ATM inactivation.
 |
FOOTNOTES |
Submitted April 22, 1997;
accepted December 29, 1997.
Supported by INSERM, la Fondation contre la Leucémie, le
Comité National, le Comité de Paris et le Comité des
Hauts de Seine de la Ligue Nationale Contre le Cancer, and
Electricité de France.
Address reprint requests to Marc-Henri Stern, MD, PhD,
Unité INSERM U462, Centre Hayem, Hôpital Saint Louis, 75475 Paris Cedex 10, France.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
 |
ACKNOWLEDGMENT |
The authors are indebted to the following physicians who provided us
patient samples: V. Andrieu, M.J. Grange (CHU Bichat, Paris, France);
G. Damaj (CHU Henri Mondor, Creteil, France); V. Leblond (CHU La
Pitié-Salpétrière, Paris, France); F. Valensi, B. Varet (CHU Necker, Paris, France); B. Cazin (CHRU de Lille, Lille,
France); X. Troussard (CHU de Caen, Caen, France); M. Wetterwald (CHG
de Dunkerque, Dunkerque, France); M. Tiab, H. Maisonneuve (CHD de La
Roche-sur-Yon, La Roche-sur-Yon, France); I. Mahé-Péron (La
Verrie, France); S. Daliphard, P. Cornillet (CHRU de Reims, Reims,
France). We thank D.A. Tagle for the gift of the anti-ATM antiserum, S. Olschwang for the gift of the polymorphic marker primers, M.T. Daniel
for cytological expertise, S.D. Goldstone for critical reading of the
manuscript, and A. Baruchel and A. Aurias for helpful discussions.
 |
REFERENCES |
1.
Matutes E,
Brito-Bapapulle V,
Swansbury J,
Ellis J,
Morilla R,
Dearden C,
Sempere A,
Catovsky D:
Clinical and laboratory features of 78 cases of T-prolymphocytic leukemia.
Blood
78:3269,
1991[Abstract/Free Full Text]
2.
Stern MH,
Soulier J,
Rosenzwajg M,
Nakahara K,
Canki-Klain N,
Aurias A,
Sigaux F,
Kirsch IR:
MTCP-1: A novel gene on the human chromosome Xq28 translocated to the T cell receptor alpha/delta locus in mature T cell proliferations.
Oncogene
8:2475,
1993[Medline]
[Order article via Infotrieve]
3.
Fisch P,
Forster A,
Sherrington PD,
Dyer MJ,
Rabbitts TH:
The chromosomal translocation t(X;14)(q28;q11) in T-cell pro-lymphocytic leukaemia breaks within one gene and activates another.
Oncogene
8:3271,
1993[Medline]
[Order article via Infotrieve]
4.
Virgilio L,
Narducci MG,
Isobe M,
Billips LG,
Cooper MD,
Croce CM,
Russo G:
Identification of the TCL1 gene involved in T-cell malignancies.
Proc Natl Acad Sci USA
91:12530,
1994[Abstract/Free Full Text]
5.
Fu TB,
Virgilio L,
Narducci MG,
Facchiano A,
Russo G,
Croce CM:
Characterization and localization of the TCL-1 oncogene product.
Cancer Res
54:6297,
1994[Abstract/Free Full Text]
6.
Madani A,
Choukroun V,
Soulier J,
Cacheux V,
Claisse JF,
Valensi F,
Daliphard S,
Cazin B,
Levy V,
Leblond V,
Daniel MT,
Sigaux F,
Stern MH:
Expression of p13MTCP1 is restricted to T-cell proliferations with t(X;14) translocations.
Blood
87:1923,
1996[Abstract/Free Full Text]
7.
Stern MH,
Theodorou I,
Aurias A,
Maier-Redelsperger M,
Debre M,
Debre P,
Griscelli C:
T-cell nonmalignant clonal proliferation in ataxia telangiectasia: A cytological, immunological, and molecular characterization.
Blood
73:1285,
1989[Abstract/Free Full Text]
8. Stern MH: Clonal T-cell proliferations in ataxia telangiectasia,
in Kirsch IR (ed): The Causes and Consequences of Chromosomal
Aberrations. Boca Raton, FL, CRC, 1993, p 165
9.
Taylor AMR,
Metcalfe JA,
Thick J,
Mak YF:
Leukemia and lymphoma in ataxia telangiectasia.
Blood
87:423,
1996[Abstract/Free Full Text]
10.
Hecht F,
McCaw BK,
Koler RD:
Ataxia-telangiectasia clonal growth of translocation lymphocytes.
N Engl J Med
289:286,
1973
11.
McCaw BK,
Hecht F,
Harnden DG,
Teplitz RL:
Somatic rearrangement of chromosome 14 in human lymphocytes.
Proc Natl Acad Sci USA
72:2071,
1975[Abstract/Free Full Text]
12.
Sparkes RS,
Como R,
Golde DW:
Cytogenetic abnormalities in ataxia telangiectasia with T cell chronic lymphocytic leukemia.
Cancer Genet Cytogenet
1:329,
1980
13.
Taylor AMR,
Oxford JM,
Metcalfe JA:
Spontaneous cytogenetic abnormalities in lymphocytes from thirteen patients with ataxia telangiectasia.
Int J Cancer
27:311,
1981[Medline]
[Order article via Infotrieve]
14.
Aurias A,
Croquette MF,
Nuyts JP,
Griscelli C,
Dutrillaux B:
New data on clonal anomalies of chromosome 14 in ataxia telangiectasia: tct(14;14) and inv(14).
Hum Genet
72:22,
1986[Medline]
[Order article via Infotrieve]
15.
Thick J,
Metcalfe JA,
Mak YF,
Beatty D,
Minegishi M,
Dyer MJ,
Lucas G,
Taylor AMR:
Expression of either the TCL1 oncogene, or transcripts from its homologue MTCP1/c6.1B, in leukaemic and non-leukaemic T cells from ataxia telangiectasia patients.
Oncogene
12:379,
1996[Medline]
[Order article via Infotrieve]
16.
Narducci MG,
Virgilio L,
Isobe M,
Stoppacciaro A,
Elli R,
Fiorilli M,
Carbonari M,
Antonelli A,
Chessa L,
Croce CM,
Russo G:
TCL1 oncogene activation in preleukemic T cells from a case of ataxia-telangiectasia.
Blood
86:2358,
1995[Abstract/Free Full Text]
17.
Davey MP,
Bertness V,
Nakahara K,
Johnson JP,
McBride OW,
Waldmann TA,
Kirsch IR:
Juxtaposition of the T-cell receptor alpha-chain locus (14q11) and a region (14q32) of potential importance in leukemogenesis by a 14;14 translocation in a patient with T-cell chronic lymphocytic leukemia and ataxia-telangiectasia.
Proc Natl Acad Sci USA
85:9287,
1988[Abstract/Free Full Text]
18.
Taylor AMR,
Butterworth SV:
Clonal evolution of T-cell chronic lymphocytic leukaemia in a patient with ataxia telangiectasia.
Int J Cancer
37:511,
1986[Medline]
[Order article via Infotrieve]
19.
Taylor AMR,
Lowe PA,
Stacey M,
Thick J,
Campbell L,
Beatty D,
Biggs P,
Formstone CJ:
Development of T-cell leukaemia in an ataxia telangiectasia patient following clonal selection in t(X; 14)-containing lymphocytes.
Leukemia
6:961,
1992[Medline]
[Order article via Infotrieve]
20.
Barlow C,
Hirotsune S,
Paylor R,
Liyanage M,
Eckhaus M,
Collins F,
Shiloh Y,
Crawley JN,
Ried T,
Tagle D,
Wynshaw-Boris A:
Atm-deficient mice: A paradigm of ataxia telangiectasia.
Cell
86:159,
1996[Medline]
[Order article via Infotrieve]
21.
Xu Y,
Asley T,
Brainerd EE,
Bronson RT,
Meyn MS,
Baltimore D:
Targeted disruption of ATM leads to growth retardation, chromosomal fragmentation during meiosis, immune defects, and thymic lymphoma.
Genes Dev
10:2411,
1996[Abstract/Free Full Text]
22.
Elson A,
Wang Y,
Daugherty CJ,
Morton CC,
Zhou F,
Campos-Torres J,
Leder P:
Pleiotropic defects in ataxia-telangiectasia protein-deficient mice.
Proc Natl Acad Sci USA
93:13084,
1996[Abstract/Free Full Text]
23.
Savitsky K,
Bar-Shira A,
Gilad S,
Rotman G,
Ziv Y,
Vanagaite L,
Tagle DA,
Smith S,
Uziel T,
Sfez S,
Ashkenazi M,
Pecker I,
Frydman M,
Harnik R,
Patanjali SR,
Simmons A,
Clines GA,
Sartiel A,
Gatti RA,
Chessa L,
Sanal O,
Lavin MF,
Jaspers NGJ,
Taylor AMR,
Arlett CF,
Miki T,
Weissman SM,
Lovett M,
Collins FS,
Shiloh Y:
A single ataxia telangiectasia gene with a product similar to PI-3 kinase.
Science
268:1749,
1995[Abstract/Free Full Text]
24.
Uziel T,
Savitsky K,
Platzer M,
Ziv Y,
Helbitz T,
Nehls M,
Boehm T,
Rosenthal A,
Shiloh Y,
Rotman G:
Genomic organization of the ATM gene.
Genomics
33:317,
1996[Medline]
[Order article via Infotrieve]
25.
Platzer M,
Rotman G,
Bauer D,
Uziel T,
Savitsky K,
Bar-Shira A,
Gilad S,
Shiloh Y,
Rosenthal A:
Ataxia-telangiectasia locus: Sequence analysis of 184 kb of human genomic DNA containing the entire ATM gene.
Genome Res
7:592,
1997[Abstract/Free Full Text]
26.
Savitsky K,
Sfez S,
Tagle DA,
Ziv Y,
Sartiel A,
Collins FS,
Shiloh Y,
Rotman G:
The complete sequence of the coding region of the ATM gene reveals similarity to cell cycle regulators in different species.
Hum Mol Genet
4:2025,
1995[Abstract/Free Full Text]
27.
Bennett JM,
Catovsky D,
Daniel MT,
Flandrin G,
Galton DAG,
Gralnick HR,
Sultan C:
Proposals for the classification of chronic (mature) B and T lymphoid leukaemias.
J Clin Pathol
42:567,
1989[Abstract/Free Full Text]
28.
Laake K,
Ødegård Å,
Andersen TI,
Bukholm IK,
Kåresen R,
Nesland JM,
Ottestad L,
Shiloh Y,
Børresen-Dale AL:
Loss of heterozygosity at 11q23.1 in breast carcinomas: Indication for involvement of a gene distal and close to ATM.
Genes Chromosom Cancer
18:175,
1997[Medline]
[Order article via Infotrieve]
29. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1989
30.
Brown KD,
Ziv Y,
Sadanandan SN,
Chessa L,
Collins FS,
Shiloh Y,
Tagle DA:
The ataxia-telangiectasia gene product, a constitutively expressed nuclear protein that is not up-regulated following genome damage.
Proc Natl Acad Sci USA
94:1840,
1997[Abstract/Free Full Text]
31.
Vorechovsky I,
Rasio D,
Luo L,
Monaco C,
Hammarstrom L,
Webster AD,
Zaloudik J,
Barbanti-Brodani G,
James M,
Russo G,
Croce CM,
Negrini M:
The ATM gene and susceptibility to breast cancer: Analysis of 38 breast tumors reveals no evidence for mutation.
Cancer Res
56:2726,
1996[Abstract/Free Full Text]
32.
Savitsky K,
Sfez S,
Tagle DA,
Ziv Y,
Sartiel A,
Collins FS,
Shiloh Y,
Rotman G:
The complete sequence of the coding region of the ATM gene reveals similarity to cell cycle regulators in different species.
Hum Mol Genet
4:2025,
1995
33.
Gilad S,
Khosravi R,
Shkedy D,
Uziel T,
Ziv Y,
Savitsky K,
Rotman G,
Smith S,
Chessa L,
Jorgensen TJ,
Harnik R,
Frydman M,
Sanal O,
Portnoi S,
Goldwicz Z,
Jaspers NG,
Gatti RA,
Lenoir G,
Lavin MF,
Tatsumi K,
Wegner RD,
Shiloh Y,
Bar-Shira A:
Predominance of null mutations in ataxia-telangiectasia.
Hum Mol Genet
5:433,
1996[Abstract/Free Full Text]
34.
Telatar M,
Wang Z,
Udar N,
Liang T,
Bernatowska-Matuszkiewicz E,
Lavin M,
Shiloh Y,
Concannon P,
Good RA,
Gatti RA:
Ataxia-telangiectasia: Mutations in ATM cDNA detected by protein-truncation screening.
Am J Hum Genet
59:40,
1996[Medline]
[Order article via Infotrieve]
35.
Knudson A:
Mutation and cancer: Statistical study of retinoblastoma.
Proc Natl Acad Sci USA
68:820,
1971[Abstract/Free Full Text]
36.
Comings D:
A general theory of carcinogenesis.
Proc Natl Acad Sci USA
70:3324,
1973[Abstract/Free Full Text]
37.
Haber D,
Harlow E:
Tumour-suppressor genes: Evolving definitions in the genomic age.
Nat Genet
16:320,
1997[Medline]
[Order article via Infotrieve]
38.
Vorechovsky I,
Luo L,
Dyer MJ,
Catovsky D,
Amlot PL,
Yaxley JC,
Foroni L,
Hammarstrom L,
Webster AD,
Yuille MA:
Clustering of missense mutations in the ataxia-telangiectasia gene in a sporadic T-cell leukaemia.
Nat Genet
17:96,
1997[Medline]
[Order article via Infotrieve]
39.
Stilgenbauer S,
Schaffner C,
Litterst A,
Liebisch P,
Gilad S,
Bar-Shira A,
James MR,
Lichter P,
Döhner H:
Biallelic mutations in the ATM gene in T-prolymphocytic leukemia.
Nature Med
3:1155,
1997[Medline]
[Order article via Infotrieve]
40.
Carter SL,
Negrini M,
Baffa R,
Gillum DR,
Rosenberg AL,
Schwartz GF,
Croce CM:
Loss of heterozygosity at 11q22-q23 in breast cancer.
Cancer Res
54:6270,
1994[Abstract/Free Full Text]
41.
Hampton GM,
Mannermaa A,
Winquist R,
Alavaikko M,
Blanco G,
Taskinen PJ,
Kiviniemi H,
Newsham I,
Cavenee WK,
Evans GA:
Loss of heterozygosity in sporadic human breast carcinoma: A common region between 11q22 and 11q23.3.
Cancer Res
54:4586,
1994[Abstract/Free Full Text]
42.
Swift M,
Morrell D,
Massey RB,
Chase CL:
Incidence of cancer in 161 families affected by ataxia-telangiectasia.
N Engl J Med
325:1831,
1991[Abstract]
43.
Westphal CH:
Cell-cycle signaling: Atm displays its many talents.
Curr Biol
7:R789,
1997[Medline]
[Order article via Infotrieve]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
Related Letters in Blood Online:
-
Recurrent ATM mutations in T-PLL on diverse haplotypes: no support for their germline origin
- Tatjana Stankovic, A. Malcolm R. Taylor, Martin R. Yuille, and Igor Vorechovsky
Blood 2001 97: 1517-1518.
[Full Text]
[PDF]
-
Locus-specific regulation of HLA-A and HLA-B expression is not determined by nucleotide variation in the X2 box promoter element
- Sam J. P. Gobin, Peter J. van den Elsen, and John Girdlestone
Blood 2001 97: 1518-1521.
[Full Text]
[PDF]
This article has been cited by other articles:

|
 |

|
 |
 
D. Nowak, E. Le Toriellec, M.-H. Stern, N. Kawamata, T. Akagi, M. J. Dyer, W.-K. Hofmann, S. Ogawa, and H. P. Koeffler
Molecular allelokaryotyping of T-cell prolymphocytic leukemia cells with high density single nucleotide polymorphism arrays identifies novel common genomic lesions and acquired uniparental disomy
Haematologica,
April 1, 2009;
94(4):
518 - 527.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Ravandi and S. O'Brien
Chronic Lymphoid Leukemias Other Than Chronic Lymphocytic Leukemia: Diagnosis and Treatment
Mayo Clin. Proc.,
December 1, 2005;
80(12):
1660 - 1674.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
A M R Taylor and P J Byrd
Molecular pathology of ataxia telangiectasia
J. Clin. Pathol.,
October 1, 2005;
58(10):
1009 - 1015.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J. Winrow, D. G. Pankratz, C. R. T. Vibat, T.J. Bowen, M. A. Callahan, A. J. Warren, B. S. Hilbush, A. Wynshaw-Boris, K. W. Hasel, Z. Weaver, et al.
Aberrant recombination involving the granzyme locus occurs in Atm-/- T-cell lymphomas
Hum. Mol. Genet.,
September 15, 2005;
14(18):
2671 - 2684.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Ai, Q. N. Vo, C. Zuo, L. Li, W. Ling, J. Y. Suen, E. Hanna, K. D. Brown, and C.-Y. Fan
Ataxia-Telangiectasia-Mutated (ATM) Gene in Head and Neck Squamous Cell Carcinoma: Promoter Hypermethylation with Clinical Correlation in 100 Cases
Cancer Epidemiol. Biomarkers Prev.,
January 1, 2004;
13(1):
150 - 156.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Starczynski, W. Simmons, J. R. Flavell, P. J. Byrd, G. S. Stewart, H. S. Kullar, A. Groom, J. Crocker, P. A.H. Moss, G. M. Reynolds, et al.
Variations in ATM Protein Expression During Normal Lymphoid Differentiation and Among B-Cell-Derived Neoplasias
Am. J. Pathol.,
August 1, 2003;
163(2):
423 - 432.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Y. Fang, T. C. Greiner, D. D. Weisenburger, W. C. Chan, J. M. Vose, L. M. Smith, J. O. Armitage, R. A. Mayer, B. L. Pike, F. S. Collins, et al.
Oligonucleotide microarrays demonstrate the highest frequency of ATM mutations in the mantle cell subtype of lymphoma
PNAS,
April 29, 2003;
100(9):
5372 - 5377.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Tort, S. Hernandez, S. Bea, A. Martinez, M. Esteller, J. G. Herman, X. Puig, E. Camacho, M. Sanchez, I. Nayach, et al.
CHK2-decreased protein expression and infrequent genetic alterations mainly occur in aggressive types of non-Hodgkin lymphomas
Blood,
December 15, 2002;
100(13):
4602 - 4608.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Gronbak, J. Worm, E. Ralfkiaer, V. Ahrenkiel, P. Hokland, and P. Guldberg
ATM mutations are associated with inactivation of the ARF-TP53 tumor suppressor pathway in diffuse large B-cell lymphoma
Blood,
July 30, 2002;
100(4):
1430 - 1437.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Camacho, L. Hernandez, S. Hernandez, F. Tort, B. Bellosillo, S. Bea, F. Bosch, E. Montserrat, A. Cardesa, P. L. Fernandez, et al.
ATM gene inactivation in mantle cell lymphoma mainly occurs by truncating mutations and missense mutations involving the phosphatidylinositol-3 kinase domain and is associated with increasing numbers of chromosomal imbalances
Blood,
January 1, 2002;
99(1):
238 - 244.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Stankovic, G. S. Stewart, C. Fegan, P. Biggs, J. Last, P. J. Byrd, R. D. Keenan, P. A. H. Moss, and A. M. R. Taylor
Ataxia telangiectasia mutated-deficient B-cell chronic lymphocytic leukemia occurs in pregerminal center cells and results in defective damage response and unrepaired chromosome damage
Blood,
January 1, 2002;
99(1):
300 - 309.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. E. Dearden, E. Matutes, B. Cazin, G. E. Tjonnfjord, A. Parreira, B. Nomdedeu, P. Leoni, F. J. Clark, D. Radia, S. M. B. Rassam, et al.
High remission rate in T-cell prolymphocytic leukemia with CAMPATH-1H
Blood,
September 15, 2001;
98(6):
1721 - 1726.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J Boultwood
Ataxia telangiectasia gene mutations in leukaemia and lymphoma
J. Clin. Pathol.,
July 1, 2001;
54(7):
512 - 516.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Stankovic, A. M. R. Taylor, M. R. Yuille, and I. Vorechovsky
Recurrent ATM mutations in T-PLL on diverse haplotypes: no support for their germline origin
Blood,
March 1, 2001;
97(5):
1517 - 1518.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Stoppa-Lyonnet, A. Lauge, F. Sigaux, M.-H. Stern;, G. J. Vanasse, P. Concannon, and D. M. Willerford
No germline ATM mutation in a series of 16 T-cell prolymphocytic leukemias
Blood,
July 1, 2000;
96(1):
374 - 377.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. K. Khanna
Cancer Risk and the ATM Gene: a Continuing Debate
J Natl Cancer Inst,
May 17, 2000;
92(10):
795 - 802.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. J. Vanasse, P. Concannon, and D. M. Willerford
Regulated Genomic Instability and Neoplasia in the Lymphoid Lineage
Blood,
December 15, 1999;
94(12):
3997 - 4010.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Fukao, H. Kaneko, G. Birrell, M. Gatei, H. Tashita, T. Yoshida, S. Cross, P. Kedar, D. Watters, K. K. Khana, et al.
ATM Is Upregulated During the Mitogenic Response in Peripheral Blood Mononuclear Cells
Blood,
September 15, 1999;
94(6):
1998 - 2006.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Schaffner, S. Stilgenbauer, G. A. Rappold, H. Dohner, and P. Lichter
Somatic ATM Mutations Indicate a Pathogenic Role of ATM in B-Cell Chronic Lymphocytic Leukemia
Blood,
July 15, 1999;
94(2):
748 - 753.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Gritti, H. Dastot, J. Soulier, A. Janin, M.-T. Daniel, A. Madani, G. Grimber, P. Briand, F. Sigaux, and M.-H. Stern
Transgenic Mice for MTCP1 Develop T-Cell Prolymphocytic Leukemia
Blood,
July 15, 1998;
92(2):
368 - 373.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Schaffner, I. Idler, S. Stilgenbauer, H. Dohner, and P. Lichter
Mantle cell lymphoma is characterized by inactivation of the ATM gene
PNAS,
March 14, 2000;
97(6):
2773 - 2778.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|