|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 11 (June 1), 1998:
pp. 4020-4027
Cloning and Characterization of Two Toll/Interleukin-1 Receptor-Like
Genes TIL3 and TIL4: Evidence for a Multi-Gene Receptor Family in
Humans
By
Preet M. Chaudhary,
Camari Ferguson,
Vilaska Nguyen,
Oanh Nguyen,
Hillary F. Massa,
Michael Eby,
Alan Jasmin,
Barbara J. Trask,
Leroy Hood, and
Peter S. Nelson
From the Department of Medicine and Molecular Biotechnology,
University of Washington, Seattle, WA.
 |
ABSTRACT |
Remarkable structural and functional similarities exist between the
Drosophila Toll/Cactus/Dorsal signaling pathway and the mammalian cytokine-mediated interleukin-1 receptor
(IL-1R)/I- B/NF-B activation cascade. In addition to a role
regulating dorsal-ventral polarity in the developing Drosophila
embryo, signaling through Drosophila Toll (dToll) activates the
nonclonal, or innate, immune response in the adult fly. Recent evidence
indicates that a human homologue of the dToll protein participates in
the regulation of both innate and adaptive human immunity through the
activation of NF-B and the expression of the NF-B-controlled
genes IL-1, IL-6, and IL-8, thus affirming the evolutionary
conservation of this host defense pathway. We report here the cloning
of two novel human genes, TIL3 and TIL4 (Toll/IL-1R-like-3, -4) that
exhibit homology to both the leucine-rich repeat extracellular domains and the IL-1R-like intracellular domains of human and
Drosophila Toll. Northern analysis showed distinctly different
tissue distribution patterns with TIL3 expressed predominantly in
ovary, peripheral blood leukocytes, and prostate, and TIL4 expressed
primarily in peripheral blood leukocytes and spleen. Chromosomal
mapping by fluorescence in situ hybridization localized the TIL3 gene
to chromosome 1q41-42 and TIL4 to chromosome 4q31.3-32. Functional studies showed that both TIL3 and TIL4 are able to activate NF-B, though in a cell type-dependent fashion. Together with human
Toll, TIL3 and TIL4 encode a family of genes with
conserved structural and functional features involved in immune
modulation.
| |
INTRODUCTION |
THE DROSOPHILA TOLL gene (dToll)
encodes a transmembrane protein with features of a signal-transducing
receptor.1,2 The intracellular and extracellular domains of
dToll exhibit striking structural and functional similarities with
proteins of two distinct families: the interleukin-1 receptor
(IL-1R)-like family3,4 and the superfamily of leucine-rich
repeat (LRR) proteins.5 dToll is involved in establishing
the dorsal/ventral axis of the developing Drosophila embryo
through a conserved signaling pathway involving the downstream
effectors dorsal, an Rel family member with homology to
the transcription factor NF-B,6 and cactus, a protein
with structural homology to I-B.7
The dToll signaling pathway is also involved in the innate nonspecific
Drosophila immune response through the induction of genes
encoding antibacterial8 and antifungal9
peptides. The immune response modulated by dToll reflects an ancestral
conserved system that has homologous components in plants10
and vertebrates, as exemplified by the IL-1/NF-B-mediated induction
of the mammalian inflammatory response.11 Mutagenesis and
deletion analyses have shown that amino acid residues conserved between
the IL-1R and dToll cytoplasmic domains are essential for signal
transduction by these receptors.12,13 Experiments involving
the deletion of the extracellular LRR regions of dToll showed a
dominant gain-of-function activity, suggesting that dToll functions as
a receptor whose intrinsic intracellular signaling activity is
regulated by its extracellular domain.13,14
Two human genes with homology to the Drosophila Toll sequence
have recently been described. Human Toll (hToll) is a type I transmembrane protein with an extracellular domain consisting of LRRs
and a cytoplasmic domain homologous to the cytoplasmic domain of the
human IL-1R protein.15 A constitutively active hToll mutant
induced the activation of NF-B and the expression of
NF-B-controlled genes for inflammatory cytokines. These results support the conservation of a host-defense pathway between
Drosophila and humans.15 A second gene, TIL
(Toll/IL-1R-like), also encodes a protein with regions homologous to
the intracellular and extracellular domains of dToll.16
However, TIL was unable to activate NF-B through a chimeric
IL-1R/TIL receptor complex.17
Three additional Drosophila genes, 18-wheeler, tlr (Toll-like
receptor) and MstProx, exhibit homology to dToll involving both the
intracellular IL-1R-like domain and the extracellular LRRs. Eighteen-wheeler is required for Drosophila morphogenesis and is thought to function as a cell adhesion or receptor molecule that
facilitates cell movements.18 Drosophila tlr is
also involved in embryogenesis with a potential role in cell-to-cell
interactions at critical boundaries during development.19
MstProx is a recently cloned Drosophila gene that has not been
extensively characterized.17
Based on the pivotal role of Drosophila Toll in both
development and immune regulation, we undertook a database search to identify other human genes with sequence homology to dToll. We reasoned
that evidence of a family of Toll-like genes in Drosophila could indicate a similar family of genes in humans. Two novel sequences
were identified that we have named TIL3 and TIL4 (Toll/IL-1R-like-3 and -4). In this study we report the isolation and characterization of
the full-length cDNAs for TIL3 and TIL4, including their chromosomal assignments and tissue expression patterns. We also show that TIL3 and
TIL4 activate NF-B in a cell type-dependent fashion. Together with
hToll, TIL3 and TIL4 encode a family of genes with structural and functional similarities that may serve to modulate the
human immune response.
| |
MATERIALS AND METHODS |
Cell culture and general methods.
DNA manipulations including transformation, plasmid preparation, and
gel electrophoresis were performed according to standard procedures.20 Restriction and modification enzymes
(Boehringer Mannheim, Inc, Life Technologies, Rockville, MD) were used
in accordance with the manufacturers' recommendations. MCF-7 breast carcinoma cells and 293T cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Life Technologies) supplemented with 10% fetal
calf serum. BHK (baby hamster kidney) cells were grown in DMEM supplemented with 5% fetal calf serum.
DNA sequencing and analysis.
Sequencing was performed by the dideoxy chain-termination method using
Taq dye primer and dye terminator kits (Applied Biosystems, Foster
City, CA). The nucleotide sequences were analyzed with an ABI 377 automated sequencer (Applied Biosystems). The final sequences were
confirmed by sequencing both strands. Sequence homology searches and
comparisons were performed using BLASTN and BLASTX
algorithms on the National Center for Biotechnology Information (NCBI)
web-server. Sequence assembly was performed using the Phred, Phrap, and
Consed programs (http://chimera.biotech.washington.edu/UWGC/).
Cloning of TIL3 and TIL4.
Several human sequences in the NCBI expressed-sequence-tag (EST)
database were identified with statistically significant homology to the
Drosophila Toll gene. One EST (IMAGE Consortium Clone 684668) corresponded to the published human gene KIAA0012/TIL (Genbank ID
D13637). One EST (IMAGE Consortium Clone ID 202057) corresponded to a
published human gene, hToll (Genbank accession U93091). Two others
(IMAGE Consortium Clone Ids 80633 and 277229) showing homology to dToll
were obtained (Genome Systems, St Louis, MO) and sequenced in their
entirety. Each comprised a partial open reading frame with homology to
dToll and hToll. Rapid amplification of cDNA ends (RACE) was used to
obtain full-length cDNAs using human peripheral blood leukocyte and
prostate cDNA as template (Clontech, Palo Alto, CA) with gene specific
primers TX360L 5 -CTCTGATGGATTGATGTTTCATC-3 for TIL3 and TW236L
5GAGAGTCACACAGGTAATTTGCTGG 3 for TIL4. RACE products were cloned
using the T/A cloning method according to the
manufacturer's instructions (Invitrogen, La Jolla, CA), sequenced, and
assembled as described above.
Northern blot analysis.
TIL3 (nt 1211-1620) and TIL4 (nt 667-3288) cDNA probes were labeled
with 32P-dCTP (DuPont NEN, Boston, MA) using a
random priming labeling kit following the manufacturers instructions
(Life Technologies). Adult poly(A)+ multiple-tissue
Northern blots (Clontech) were hybridized in Quick-hyb solution
(Clontech) at 68°C according to the manufacturer's instructions. The
filters were washed in three changes of 2× SSC with
0.05% sodium dodecyl sulfate (SDS) at room temperature for 30 minutes
each followed by two changes of 0.1× SSC with 0.1% SDS at 50°C for
20 minutes each. Equal mRNA loading was assessed by stripping the
filter and reprobing with a human 32P-labeled  -actin
probe. Hybridization and washing conditions were as described above.
Chromosomal localization by fluorescence in situ hybridization
(FISH).
TIL3 and TIL4 cDNA probes were labeled as described above and were
hybridized to filters of an arrayed human BAC genomic library (Research
Genetics, Huntsville, AL). Positive clones were identified and
subsequently verified by polymerase chain reaction using TIL3 and TIL4
gene-specific amplification primers. BAC and plasmid DNA clones were
biotinylated by nick translation, prehybridized in the presence of
human Cot1 DNA, and hybridized (at 10 and 50 ng/uL, respectively) to
metaphase spreads of a normal male following procedures described in
detail elsewhere.21 After hybridization and washing, the
hybridization sites were labeled with fluorescein-conjugated avidin.
The chromosomes, which had previously been released from an early-S
methotrexate block in the presence of BrdU, were counterstained with
DAPI to produce a QFH-like banding pattern.
Digital image processing was performed as described
elsewhere.22 The locations of hybridization signals were
analyzed in 10 well-spread, well-banded metaphases for each sample.
Chimeric constructions.
Expression vectors encoding the Fas-hToll, Fas-TIL3, and Fas-TIL4
fusion proteins were made by joining the nucleotides encoding the
extracellular domain of human Fas receptor (aa 1 to 169) to the
nucleotides encoding the transmembrane and cytoplasmic tail of hToll
(aa 629 to 841), TIL3 (aa 630 to 858), and TIL4 (aa 584 to 784),
respectively. The chimeric constructs were cloned into the pCDNA3
expression vector (Invitrogen).
NF-B assay.
For the NF-B reporter assay, 8 × 104 MCF7 human breast
cancer cells were transfected in triplicate with 500 ng of the test constructs or empty vector along with 250 ng of a NF-B reporter construct23 and a LacZ reporter construct (Invitrogen) in a 24-well plate using Superfect (Qiagen, Valencia, CA)
following the manufacturer's instructions. Forty-eight hours after
transfection, cells were lysed and luciferase activity was measured
using the luciferase assay reagent (Promega, Madison, WI)
as described previously.23 Baby hamster kidney fibroblast
cells (BHK) and transformed human epithelial kidney 293T cells were
plated as described above and transfected using the calcium phosphate
precipitation method20 with luciferase analysis performed
after 48 or 24 hours, respectively.
| |
RESULTS |
TIL3 and TIL4 are homologs of the Drosophila Toll gene with
homology to IL-1R cytoplasmic domain (IL-1Rcd) and LRR extracellular
domain.
Two human cDNA sequences in the NCBI database of expressed sequence
tags were identified that exhibited significant sequence homology to
the Drosophila Toll protein. These clones were found to contain
partial open reading frames (ORFs) corresponding to TIL3
and TIL4. The RACE methodology was used to obtain full-length cDNA
clones of these genes.
The nucleotide sequence of the TIL3 cDNA contains an open reading frame
of 2,574 bp that starts at the first methionine codon preceded by an
appropriate Kozak consensus sequence for the initiation of
translation.24 The predicted protein sequence derived from the open reading frame produces an 858-amino acid polypeptide (Fig
1A). The nucleotide sequence of the TIL4
cDNA contains an open reading frame of 2,352 bp that starts at the
first methionine codon preceded by an appropriate Kozak consensus
sequence for the initiation of translation. The predicted protein
sequence derived from the open reading frame produces a 784-amino acid polypeptide (Fig 1B).
View larger version (85K):
[in this window]
[in a new window]
| Fig 1.
(A) Amino acid sequence of TIL3. The predicted signal
peptide (residues 1 to 30) is underlined. The predicted transmembrane segment (residues 642 to 660) is in bold and underlined. (B) Amino acid
sequence of TIL4. The predicted signal peptide (residues 1 to 20) is
underlined. The predicted transmembrane segment (residues 590 to 609)
is in bold and underlined.
|
|
The TIL3 and TIL4 amino acid sequences exhibit features of type I
integral membrane proteins. Each contains two regions of hydrophobicity
corresponding to a signal peptide located at the amino terminus, and a
transmembrane region near the midportion (Fig 1). TIL3 and TIL4 share
40% overall amino acid similarity and 24% amino acid identity (Fig
2). They exhibit homology with both the
intracellular and extracellular regions of the Drosophila Toll,1 human Toll,15 and TIL25
proteins (Fig 2).
View larger version (71K):
[in this window]
[in a new window]
| Fig 2.
(A) Alignment of the amino acid sequence of the
cytoplasmic domains of the IL-1R and the Toll/IL-1R-like family
members: Drosophila wheeler and Toll, human Toll, TIL, TIL3,
and TIL4. Alignments were performed using the Clustal
algorithm49 and Boxshade
(http://ulrec3.unil.ch/software/BOX_faq.html). Sequence identity
(black) or similarity (gray) between at least 40% of the sequence
members are shaded. Inactivating dToll mutations are marked with an
asterisk (*).13 Critical amino acid residues for IL-1R
activation of IL-2 are denoted by a solid circle
( ),12,42 for IL-1R activation of IL-8 by a cross
(+),45 and IL-1R activation of NF-B by a box
( ).43 (B) Alignment of the extracellular LRR
terminal-flanking sequences of the LRR proteins TIL3, TIL4, TIL, hToll,
dToll, human platelet glycoprotein 1b- (Gp1b-) and 1b-
(gp1b-),27,47 platelet glycoprotein IX
(gpIX),28 leucine-rich glycoprotein (LRG),29
and the oncofetal antigen 5T4 (ofg-5T4).30 The
extracellular region of dToll contains two cysteine-rich LRR domains
(dToll #1 and dToll#2). Sequence identity (black) or similarity (gray)
between at least 40% of the sequence members are shaded. The mutations
responsible for the dominant, constitutively active dToll proteins are
denoted by asterisk (*) and are located in the second dToll terminal
repeat.13
|
|
The TIL3 and TIL4 polypeptides contain the two distinct
structural/functional motifs characteristic of dToll: the IL-1R-like region in the cytoplasmic portion of the protein and the LRR domain in
the extracellular portion. An amino acid multiple sequence alignment of
the cytoplasmic IL-1R-like regions of TIL3, TIL4, and other IL-1R
family members is shown in Fig 2A. Several of the specific amino acid
residues shown to be of functional importance in IL-1R-mediated
activities such as activation of IL-2, IL-8, and NF-B are conserved
in the predicted TIL3 and TIL4 protein sequences (Fig 2A). However,
several of these critical amino acids diverge significantly between the
IL-1R and the IL-1R-related proteins. For example, two of six residues
involved in IL-1R-mediated NF-B activation, amino acids 518 and
519, are divergent in the hToll sequence. Nonetheless,
hToll has been shown to activate NF-B.15 Further, of
three inactivating mutations found in the cytoplasmic portion of the
Drosophila Toll protein,13 all three wild-type
functional residues are conserved in the TIL3 and TIL sequences, but
only two retain conservation in TIL4, hToll, and IL-1R (Fig 2A).
The similarities among the deduced amino acid sequences of the
LRR-flanking regions of the extracellular TIL3 and TIL4 proteins and
other LRR family members are shown in Fig 2B. Previous reports have
emphasized the similarity between the dToll protein and the human
membrane receptor platelet glycoprotein 1b- (Gp1b-) by virtue of
their common LRRs1 and a sequence of 60 amino acids containing two to four conserved cysteine residues located immediately C-terminal to the block of LRRs.13,26 This sequence is
conserved in several other human proteins, including platelet
glycoprotein 1b-,27 platelet glycoprotein
IX,28 serum leucine-rich glycoprotein (LRG),29
and the oncofetal antigen 5T4 (ofg-5T4).30 The high level
of sequence conservation indicates that this region is likely to be of
structural and/or functional significance. A role for the
conserved cysteine residues in the formation of disulfide-linked extracellular domains that may be involved in cell adhesion and ligand
binding has been suggested.26,31
Expression distribution of TIL3 and TIL4.
To examine the expression pattern of TIL3 and TIL4, cDNA fragments for
each gene were used to probe Northern blots containing poly(A)+ RNA from several human tissues. The TIL3 cDNA
hybridized to an mRNA species of approximately 3.3 kb, which was
present predominantly in peripheral blood leukocytes (PBL), ovary, and
prostate, and showed lower expression in other tissues (Fig
3A). Several less prominent bands of higher
molecular weight were also detected. The TIL4 cDNA hybridized to an
mRNA species of approximately 2.8 kb present predominantly in PBL and
spleen with weak expression in the remaining tissues (Fig 3B). The
predominant message sizes correspond to the full-length TIL3 and TIL4
cDNA clones we have isolated by RACE.
View larger version (92K):
[in this window]
[in a new window]
| Fig 3.
Multiple tissue Northern analysis of poly
(A)+ RNA with TIL3 and TIL4. (A) TIL3 is predominantly
expressed in PBL and ovary with a lower expression in prostate and
testis. (B) TIL4 is predominantly expressed in PBL. Tissues examined:
SP, spleen; TH, thymus; PR, prostate; TE, testis; OV, ovary; SI, small
intestine; CO, colon; PBL, peripheral blood leukocytes. A human
-actin probe was used as a control for equivalent RNA loading.
|
|
Chromosomal localization of TIL3 and TIL4.
TIL3 and TIL4 were mapped to their chromosome location by FISH. BACs
22D07 and 21K16, containing TIL3 and TIL4, respectively, were
biotinylated and hybridized to metaphase spreads of a normal male
donor. The TIL3 BAC hybridized to three locations, 1q41-q42, 9p12, and
9q12-13 (not shown), suggesting that the BAC either is chimeric or
contains sequences that are present at multiple locations. To determine
which of these locations harbors the TIL3 gene, a plasmid, TX667U3288L,
containing 2.6 kb of the TIL3 sequence was used for FISH (Fig
4A). Signals were observed with the plasmid only at 1q41-q42, thereby localizing the TIL3 gene to this location. FISH analyses of BAC 21K16 place the TIL4 gene at 4q31.3-32 (Fig 4B).
View larger version (17K):
[in this window]
[in a new window]
| Fig 4.
Localization of TIL3 and TIL4 to human chromosome regions
1q41-q42 and 4q31.3-q32, respectively, by FISH. (A) TIL3. Summary of
the locations of hybridization signals observed among 10 mitotic cells
hybridized with plasmid TX667U3288L. Signals were observed in the
1q41-q42 region on both homologs (black circles) of 6 cells and only a
single homolog (gray circles) in 4 cells, for an overall efficiency of
80%. Signals were not observed consistently at any other location. (B)
TIL4. Summary of the locations of FISH signals observed among 10 mitotic cells hybridized with BAC 21K16, which contains TIL4.
Hybridization signals were observed at 4q31.3-q32 on both homologs in
each cell.
|
|
TIL3 and TIL4 activate NF-B in a cell type-specific
manner.
The sequence similarity of the cytoplasmic domains of TIL3 and TIL4
with the type IL-1R suggests that the TIL proteins are signal
transducing molecules that may participate in similar intracellular signaling pathways. Stimulation of the IL-1R is known to result in
activation of the transcription factor NF-B, and this activity has
been localized to a critical region spanning amino acids 508 to 529 of
the IL-1R cytoplasmic domain exhibiting considerable homology to both
dToll and hToll.32 As hToll was recently shown to activate
NF-B and upregulate inflammatory cytokines,15 we investigated whether the sequence conservation observed between TIL3,
TIL4, and the IL-1R also reflects a functional conservation with regard
to downstream signaling events. Because the natural ligands for hToll,
TIL3, and TIL4 have not been identified, we constructed chimeric
receptors comprising the transmembrane and intracellular regions of
TIL3, TIL4, and hToll, each joined to the extracellular domain of the
Fas (CD95) receptor. Fas, a member of the tumor necrosis factor (TNF)
family of receptors, has been shown to spontaneously aggregate and
activate in a ligand-independent fashion when overexpressed in
mammalian cells.33
The chimeric receptors were tested for their ability to activate
NF-B in vivo in an overexpression assay. The constructs were
transiently transfected into MCF7 human breast carcinoma cells, along
with a NF-B/luciferase reporter plasmid. Forty-eight hours later,
cells were lysed and assayed for luciferase activity. As shown in Fig
5A, all three human Toll-like proteins were
able to activate NF-B when overexpressed in MCF7 cells. The
strongest activation was seen with the Fas-hToll construct. TIL3 and
TIL4 were also able to activate NF-B in BHK cells (hToll was not
assayed) (Fig 5B). A tissue-specific difference in the signaling
pathways used by the TIL proteins is indicated by the NF-B
activation in 293T cells. hToll activated NF-B effectively in these
cells, but TIL4 failed to activate NF-B, and TIL3 showed only a weak response (Fig 5C). We also compared the ability of TIL3 and TIL4 to
activate NF-B relative to DR3/WSL/TRAMP/APO3 (hereafter DR3), an
NF-B-inducing member of the tumor necrosis factor
receptor family.34 Although all three receptors could
activate NF-B in MCF7 cells, NF-B activation by DR3 was an order
of magnitude greater than that seen with TIL3 and TIL4 (Fig 5D).
View larger version (36K):
[in this window]
[in a new window]
| Fig 5.
NF-B activation by hToll, TIL3, and TIL4. Expression
plasmids encoding Fas-hToll, Fas-TIL3, Fas-TIL4, or empty vector were cotransfected with a -galactosidase (LacZ) expression plasmid into
different cell lines in triplicate. Forty-eight hours later cells were
lysed from two of the wells and luciferase activity measured as
described previously.23 Cells from the third well were
fixed with glutaraldehyde (0.5% in phosphate-buffered saline) and
stained with X-gal (5-bromo-4-chloro-3-indoxyl-b-D-galactosidase) to
obtain relative transfection efficiency.
|
|
| |
DISCUSSION |
We have isolated two human cDNAs, TIL3 and TIL4, that exhibit extensive
sequence homology with the Drosophila Toll protein in both the
IL-1Rcd and the LRR extracellular domain. TIL3 and TIL4 are also very
similar to the previously described human Toll-like genes, hToll and
TIL.15,16 After submission of this manuscript, the cloning
and expression profiles of four complete and one partial human
Toll-like receptors (TLRs) were described.35 These genes were designated TLRs 1 through 5. The sequence of TIL3 is
similar to the partial clone termed TLR5, whereas TIL4 and hToll
correspond to TLR2 and TLR4, respectively. In addition to dToll, three
additional Drosophila proteins, designated 18-wheeler, tlr, and
MstProx, exhibit both IL1-Rcd and LRR homology. Together, these
Toll/IL-1R-like genes encode a novel family of signal transducing
transmembrane proteins with putative functions involving the immune
response, morphogenesis, and cell adhesion. The structure of the Toll
family of proteins is biologically unique in combining both the IL-1R and LRR domains in a single molecule. This configuration has
significant functional implications in view of the many proteins from
diverse biological systems that exhibit homology to these motifs.
The sequence similarity observed between dToll and the IL-1Rcd is
highly significant in view of the striking evolutionary conservation of
their respective signal transduction pathways involving the
Drosophila genes dorsal, cactus, pelle, and their human
counterparts NF-B, I-B, IRAK, and IRAK2.34,36 In
addition to a functional role in establishing dorsal-ventral polarity
in the developing Drosophila embryo, the dToll signaling
pathway participates in the adult Drosophila innate immune
response via induction of antifungal and antibacterial
peptides.9 The recent demonstration of the ability of hToll
to activate NF-B and induce effector cytokines such as IL-1, IL-6,
and IL-8 provided the first direct evidence for the conservation of
this pathway of innate immunity in vertebrates.15 We have
shown here that TIL3 and TIL4 resemble hToll in their ability to
activate NF-B, thereby providing further evidence of the
conservation of Toll signaling in mammals. This result is consistent
with the high degree of sequence homology in the cytoplasmic domains of
these three proteins and the cytoplasmic domains of other IL-1R-like
proteins, which are known activators of NF-B in mammals.
The cytoplasmic domains of TIL3, TIL4, and hToll are also homologous to
the cytoplasmic domain of the human gene TIL (Fig 2A). Previous studies
with TIL in the form of a chimeric IL-1R extracellular domain and TIL
intracellular domain failed to activate NF-B in COS7
cells.17 There are several explanations for this result.
The NF-B/luciferase reporter assay used in the present study is much
more sensitive than the gel-shift assay used in the TIL study, and a
weak activation of NF-B might not have been detected. Alternatively,
although TIL may not activate NF-B in COS7 cells, it may show
activity in other cell types. This possibility is exemplified by the
ability of TIL4 to activate NF-B in MCF7 and BHK cells, but not 293T
cells.
We also observed a difference in the relative level of activation
affected by TIL3 and TIL4 in the different cell lines tested. These
cell-dependent behaviors may reflect a difference in the accessory/adapter molecules that interact with these proteins and play
critical roles in their signal transduction pathways. The distinct
tissue expression patterns exhibited by these receptors lend support to
cell type-specific activity. Studies with hToll have shown expression
in a wide spectrum of human tissues with the highest level in spleen
and peripheral blood leukocytes including monocytes, macrophages,
dendritic cells, B cells, and T cells.15 TIL3 is expressed
in PBLs, ovary, and prostate, and TIL4 is predominantly expressed in
PBLs and spleen. The observed amino acid sequence divergences between
these proteins may also influence receptor function by providing
alternative protein conformations leading to distinct binding
affinities for interacting proteins.
If the signaling pathway involving these Toll/IL-1R-like proteins
mirrors the IL-1R pathway, then upstream and downstream events will
likely involve molecules homologous to those in the IL-1R pathway. The
IL-1R is a multisubunit complex,37 as shown by the
identification of the IL-1R accessory protein.38 The downstream signaling events involve two IL-1R-associated kinases, IRAK39 and IRAK2,40 and the recently described
putative IL-1R adapter/regulator, MyD88.40 Interestingly,
the dToll and IL-1 signal pathways retain their striking conservation
with the finding that IRAK and IRAK2 are homologous to Pelle, a protein
kinase in the dToll pathway.39
The IL-1 and TNF receptor families represent the two known families of
cell-surface receptor proteins that can lead to activation of the
NF-B pathway in mammalian cells.41 Our study suggests that although both families can activate NF-B, they differ in their
relative activity. The TNF receptor family member DR3 exhibits much
stronger stronger NF-B activation than do TIL3 or TIL4. This result
may be supported by recent reports suggesting the presence of distinct
downstream adapter proteins, such as TRAF2 and TRAF6, that participate
in the signal transduction of these two receptor
families.41 However, this conclusion is based on ligand-independent receptor activation in a transient
transfection-over-expression system. It is possible that the observed
difference reflects a variation in the abilities of these two receptor
types to self-activate when overexpressed, and not in their inherent
abilities to activate NF-B in the presence of their cognate ligands.
The identification of ligands for TIL3, TIL4, and hToll will help to
define signal specificity and regulation through the native receptor
complex.
The essential functional regions of the dToll and IL-1R proteins have
been delineated through detailed deletion and mutational analysis
experiments. Seven conserved residues of the IL-1Rcd are critical for
full signal transduction as assayed by IL-2
activation,12,42 and six of seven of these residues are
also conserved in the dToll protein. The human Toll/IL-1-like genes
retain 3 or 4 of these residues, but only hToll Phe-807 is conserved in
all of the Toll/IL-1R-like proteins and IL-1R (Fig 2A). Several of
these conserved residues have also been shown to be essential for IL-1R
activation of NF-B.43 The region corresponding to aa 435 to 484 of IL-1R is similar in sequence to the box 1- and box2-like
elements present in gp130, the signal-transducing subunit of the IL-6R
family.44 Amino acid mutagenesis of the hydrophobic
elements within the gp130 homologous region in the IL-1R identified
several residues critical for the capacity to induce IL-8 gene
expression.45 These residues are highly conserved in the
Toll/IL-1R-like protein family (Fig 2A).
Deletion of the extracellular LRR portion of dToll leads to a
constitutively active protein.14 Examination of
Drosophila embryo mutants revealed nine gain-of-function
mutations, all located in the extracellular domain. Of these mutations,
three involve cysteine-to-tyrosine residue changes in the region
located immediately outside the transmembrane domain.13
These cysteines, adjacent to the LRRs, are thought to be involved in
the formation of intramolecular disulfide bonds,13 and are
conserved in all of the Toll/IL-1R-like proteins that we have
examined.
LRRs are short protein modules of 20 to 29 amino acids characterized by
a periodic arrangement of hydrophobic residues that are found in a
diverse group of extracellular, membrane, and cytoplasmic proteins.46 A subset of the LRR protein superfamily
comprises proteins with LRR flanking cysteine clusters, an arrangement
that appears to be a property of adhesive proteins and receptors. This group includes the TIL/IL-1R-like proteins, leucine-rich
glycoprotein,29 the metastasis-associated oncofetal antigen
5T4,30 and components of the platelet glycoprotein 1b-V-IX
complex.27,28 Platelet glycoprotein 1b is a membrane
receptor involved in the adhesion of platelets to subendothelial
connective tissue at sites of endothelial damage.47 dToll
has also been shown to promote cell adhesion in either a direct manner
involving the LRR domains, or indirectly by transducing an
extracellular signal that causes activation of other adhesion molecules
on the cell surface.26
In view of their sequence homology with the LRR extracellular domains
of dToll and the platelet glycoproteins, it is likely that the human
Toll/IL-1R proteins may also have adhesive properties. It is
interesting to speculate how the adhesive and immunoregulatory functions of Toll/IL-1R proteins could be linked. In view of dToll's diverse functions in development, immune regulation, and adhesion, the
Toll/IL-1 signaling pathway may not be dedicated to specific target
genes, but instead may control completely divergent genes involved in
distinct processes.48 The intimate involvement of Toll in
developmental events coupled with the striking conservation of the Toll
signaling pathway from plants to vertebrates should make the
Toll/IL-1R-related genes hToll, TIL, TIL3, and TIL4 prime candidates
for the investigation of developmentally associated diseases linked to
their respective chromosomal locations.
| |
FOOTNOTES |
Submitted January 13, 1998;
accepted March 9, 1998.
Supported by the CaPCURE Foundation and the Stowers
Institute for Medical Research, a postdoctoral fellowship from the
Damon Runyon-Walter Winchell Foundation (P.M.C.), and a grant
(DE-GF03-96ER62173) from the United States Department of Energy (O.N.,
H.F.M., B.J.T.).
The Genbank accession numbers of TIL3 and TIL4 are AF051151 and
AF051152, respectively.
Address reprint requests to Peter S. Nelson, MD, Department of
Molecular Biotechnology, Box 357730 HSB K-360, University of Washington, Seattle, Washington 98195.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
We thank Steve Lasky and Carol Loretz for sequencing assistance.
| |
REFERENCES |
1.
Hashimoto C,
Hudson KL,
Anderson KV:
The Toll gene of Drosophila, required for dorsal-ventral embryonic polarity, appears to encode a transmembrane protein.
Cell
52:269,
1988[Medline]
[Order article via Infotrieve]
2.
Hashimoto C,
Gerttula S,
Anderson KV:
Plasma membrane localization of the Toll protein in the syncytial Drosophila embryo: Importance of transmembrane signaling for dorsal-ventral pattern formation.
Development
111:1021,
1991[Abstract/Free Full Text]
3.
Dinarello CA:
The interleukin-1 family: 10 years of discovery.
FASEB J
8:1314,
1994[Abstract]
4. (letter)
Gay NJ,
Keith FJ:
Drosophila Toll and IL-1 receptor.
Nature
351:355,
1991
5.
Kobe B,
Deisenhofer J:
Proteins with leucine-rich repeats.
Curr Opin Struct Biol
5:409,
1995[Medline]
[Order article via Infotrieve]
6.
Wasserman SA:
A conserved signal transduction pathway regulating the activity of the rel-like proteins dorsal and NF-kappa B.
Mol Biol Cell
4:767,
1993[Medline]
[Order article via Infotrieve]
7.
Geisler R,
Bergmann A,
Hiromi Y,
Nusslein-Volhard C:
Cactus, a gene involved in dorsoventral pattern formation of Drosophila, is related to the I kappa B gene family of vertebrates.
Cell
71:613,
1992[Medline]
[Order article via Infotrieve]
8.
Rosetto M,
Engstrom Y,
Baldari CT,
Telford JL,
Hultmark D:
Signals from the IL-1 receptor homolog, Toll, can activate an immune response in a Drosophila hemocyte cell line.
Biochem Biophys Res Commun
209:111,
1995[Medline]
[Order article via Infotrieve]
9.
Lemaitre B,
Nicolas E,
Michaut L,
Reichhart JM,
Hoffmann JA:
The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults.
Cell
86:973,
1996[Medline]
[Order article via Infotrieve]
10.
Staskawicz BJ,
Ausubel FM,
Baker BJ,
Ellis JG,
Jones JD:
Molecular genetics of plant disease resistance.
Science
268:661,
1995[Abstract/Free Full Text]
11.
Baeuerle PA,
Henkel T:
Function and activation of NF-kappa B in the immune system.
Annu Rev Immunol
12:141,
1994[Medline]
[Order article via Infotrieve]
12.
Heguy A,
Baldari CT,
Macchia G,
Telford JL,
Melli M:
Amino acids conserved in interleukin-1 receptors (IL-1Rs) and the Drosophila toll protein are essential for IL-1R signal transduction.
J Biol Chem
267:2605,
1992[Abstract/Free Full Text]
13.
Schneider DS,
Hudson KL,
Lin TY,
Anderson KV:
Dominant and recessive mutations define functional domains of Toll, a transmembrane protein required for dorsal-ventral polarity in the Drosophila embryo.
Genes Dev
5:797,
1991[Abstract/Free Full Text]
14.
Winans KA,
Hashimoto C:
Ventralization of the Drosophila embryo by deletion of extracellular leucine-rich repeats in the Toll protein.
Mol Biol Cell
6:587,
1995[Abstract]
15.
Medzhitov R,
Preston-Hurlburt P,
Janeway Jr CA:
A human homologue of the Drosophila Toll protein signals activation of adaptive immunity.
Nature
388:394,
1997[Medline]
[Order article via Infotrieve]
16.
Taguchi T,
Mitcham JL,
Dower SK,
Sims JE,
Testa JR:
Chromosomal location of TIL, a gene encoding a protein related to the Drosophila transmembrane receptor Toll, to human chromosome 4p14.
Genomics
32:486,
1996[Medline]
[Order article via Infotrieve]
17.
Mitcham JL,
Parnet P,
Bonnert TP,
Garka KE,
Gerhart MJ,
Slack JL,
Gayle MA,
Dower SK,
Sims JE:
T1/ST2 signalling establishes it as member of an expanding interleukin-1 receptor family.
J Biol Chem
271:5777,
1996[Abstract/Free Full Text]
18.
Eldon E,
Kooyer S,
D'Evelyn D,
Duman M,
Lawinger P,
Botas J,
Bellen H:
The Drosophila 18 wheeler is required for morphogenesis and has striking similarities to Toll.
Development
120:885,
1994[Abstract]
19.
Chiang C,
Beachy PA:
Expression of a novel Toll-like gene spans the parasegment boundary and contributes to hedgehog function in the adult eye of Drosophila.
Mech Dev
47:225,
1994[Medline]
[Order article via Infotrieve]
20.
Maniatis T,
Fritsch EF,
Sambrook J:
Molecular Cloning
A Laboratory Manual
(2).
Cold Spring Harbor, NY, Cold Spring Harbor Press
, 1989
21. Trask BJ: Fluorescence in situ hybridization. Cold Spring
Harbor, NY, Cold Spring Harbor Laboratory Press, 1997
22.
Wise CA,
Clines GA,
Massa H,
Trask BJ,
Lovett M:
Identification and localization of the gene for EXTL, a third member of the multiple exostoses gene family.
Genome Res
7:10,
1997[Abstract/Free Full Text]
23.
Berberich I,
Shu GL,
Clark EA:
Cross-linking CD40 on B cells rapidly activates nuclear factor-kappa B.
J Immunol
153:4357,
1994[Abstract]
24.
Kozak M:
An analysis of 5-noncoding sequences from 699 vertebrate messenger RNAs.
Nucleic Acids Res
15:8125,
1987[Abstract/Free Full Text]
25.
Nomura N,
Miyajima N,
Sazuka T,
Tanaka A,
Kawarabayasi Y,
Sato S,
Nagase T,
Seki N,
Ishikawa K,
Tabata S:
Prediction of the coding sequences of unidentified human genes. I. The coding sequences of 40 new genes (KIAA0001-KIAA0040) deduced by analysis of randomly sampled cDNA clones from human immature myeloid cell line KG-1.
DNA Res
1:27,
1994[Abstract/Free Full Text]
26.
Keith FJ,
Gay NJ:
The Drosophila membrane receptor Toll can function to promote cellular adhesion.
EMBO J
9:4299,
1990[Medline]
[Order article via Infotrieve]
27.
Lopez JA,
Chung DW,
Fujikawa K,
Hagen FS,
Davie EW,
Roth GJ:
The alpha and beta chains of human platelet glycoprotein Ib are both transmembrane proteins containing a leucine-rich amino acid sequence.
Proc Natl Acad Sci USA
85:2135,
1988[Abstract/Free Full Text]
28.
Hickey MJ,
Williams SA,
Roth GJ:
Human platelet glycoprotein IX: An adhesive prototype of leucine-rich glycoproteins with flank-center-flank structures.
Proc Natl Acad Sci USA
86:6773,
1989[Abstract/Free Full Text]
29.
Takahashi N,
Takahashi Y,
Putnam FW:
Periodicity of leucine and tandem repetition of a 24-amino acid segment in the primary structure of leucine-rich alpha 2-glycoprotein of human serum.
Proc Natl Acad Sci USA
82:1906,
1985[Abstract/Free Full Text]
30.
Myers KA,
Rahi-Saund V,
Davison MD,
Young JA,
Cheater AJ,
Stern PL:
Isolation of a cDNA encoding 5T4 oncofetal trophoblast glycoprotein. An antigen associated with metastasis contains leucine-rich repeats.
J Biol Chem
269:9319,
1994[Abstract/Free Full Text]
31.
Harmon JT,
Jamieson GA:
The glycocalicin portion of platelet glycoprotein Ib expresses both high and moderate affinity receptor sites for thrombin. A soluble radioreceptor assay for the interaction of thrombin with platelets.
J Biol Chem
261:13224,
1986[Abstract/Free Full Text]
32.
Leung K,
Betts JC,
Xu L,
Nabel GJ:
The cytoplasmic domain of the interleukin-1 receptor is required for nuclear factor-kappa B signal transduction.
J Biol Chem
269:1579,
1994[Abstract/Free Full Text]
33.
Boldin MP,
Mett IL,
Varfolomeev EE,
Chumakov I,
Shemer-Avni Y,
Camonis JH,
Wallach D:
Self-association of the "death domains" of the p55 tumor necrosis factor (TNF) receptor and Fas/APO1 prompts signaling for TNF and Fas/APO1 effects.
J Biol Chem
270:387,
1995[Abstract/Free Full Text]
34.
Chinnaiyan AM,
O'Rourke K,
Yu GL,
Lyons RH,
Garg M,
Duan DR,
Xing L,
Gentz R,
Ni J,
Dixit VM:
Signal transduction by DR3, a death domain-containing receptor related to TNFR-1 and CD95.
Science
274:990,
1996[Abstract/Free Full Text]
35.
Rock FL,
Hardiman G,
Timans JC,
Kastelein RA,
Bazan JF:
A family of human receptors structurally related to Drosophila Toll.
Proc Natl Acad Sci USA
95:588,
1998[Abstract/Free Full Text]
36.
Belvin MP,
Anderson KV:
A conserved signaling pathway: The Drosophila toll-dorsal pathway.
Ann Rev Cell Dev Biol
12:393,
1996[Medline]
[Order article via Infotrieve]
37.
Lewis C,
Mazzei G,
Shaw A:
Monoclonal antibodies reacting with the interleukin 1 receptor define a multi-molecular complex.
Eur J Immunol
20:207,
1990[Medline]
[Order article via Infotrieve]
38.
Greenfeder SA,
Nunes P,
Kwee L,
Labow M,
Chizzonite RA,
Ju G:
Molecular cloning and characterization of a second subunit of the interleukin 1 receptor complex.
J Biol Chem
270:13757,
1995[Abstract/Free Full Text]
39.
Cao Z,
Henzel WJ,
Gao X:
IRAK: A kinase associated with the interleukin-1 receptor.
Science
271:1128,
1996[Abstract]
40.
Muzio M,
Ni J,
Feng P,
Dixit VM:
IRAK (Pelle) family member IRAK-2 and MyD88 as proximal mediators of IL-1 signaling.
Science
278:1612,
1997[Abstract/Free Full Text]
41.
Stancovski I,
Baltimore D:
NF-kappaB activation: The I kappaB kinase revealed?
Cell
91:299,
1997[Medline]
[Order article via Infotrieve]
42.
Guida S,
Heguy A,
Melli M:
The chicken IL-1 receptor: Differential evolution of the cytoplasmic and extracellular domains.
Gene
111:239,
1992[Medline]
[Order article via Infotrieve]
43.
Croston GE,
Cao Z,
Goeddel DV:
NF-kappa B activation by interleukin-1 (IL-1) requires an IL-1 receptor-associated protein kinase activity.
J Biol Chem
270:16514,
1995[Abstract/Free Full Text]
44.
Kishimoto T,
Akira S,
Narazaki M,
Taga T:
Interleukin-6 family of cytokines and gp130.
Blood
86:1243,
1995[Free Full Text]
45.
Kuno K,
Okamoto S,
Hirose K,
Murakami S,
Matsushima K:
Structure and function of the intracellular portion of the mouse interleukin 1 receptor (type I). Determining the essential region for transducing signals to activate the interleukin 8 gene.
J Biol Chem
268:13510,
1993[Abstract/Free Full Text]
46.
Buchanan SG,
Gay NJ:
Structural and functional diversity in the leucine-rich repeat family of proteins.
Prog Biophys Mol Biol
65:1,
1996[Medline]
[Order article via Infotrieve]
47.
Lopez JA,
Chung DW,
Fujikawa K,
Hagen FS,
Papayannopoulou T,
Roth GJ:
Cloning of the alpha chain of human platelet glycoprotein Ib: A transmembrane protein with homology to leucine-rich alpha 2-glycoprotein.
Proc Natl Acad Sci USA
84:5615,
1987[Abstract/Free Full Text]
48.
Rusch J,
Levine M:
Regulation of the dorsal morphogen by the Toll and torso signaling pathways: A receptor tyrosine kinase selectively masks transcriptional repression.
Genes Dev
8:1247,
1994[Abstract/Free Full Text]
49.
Thompson JD,
Higgins DG,
Gibson TJ:
CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.
Nucleic Acids Res
22:4673,
1994[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
A. R. Ashtekar, P. Zhang, J. Katz, C. C. S. Deivanayagam, P. Rallabhandi, S. N. Vogel, and S. M. Michalek
TLR4-mediated activation of dendritic cells by the heat shock protein DnaK from Francisella tularensis
J. Leukoc. Biol.,
December 1, 2008;
84(6):
1434 - 1446.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. O. Vogel, R. J.R.J. Janssen, M. A.M. van den Brand, C. E.J. Dieteren, S. Verkaart, W. J.H. Koopman, P. H.G.M. Willems, W. Pluk, L. P.W.J. van den Heuvel, J. A.M. Smeitink, et al.
Cytosolic signaling protein Ecsit also localizes to mitochondria where it interacts with chaperone NDUFAF1 and functions in complex I assembly
Genes & Dev.,
March 1, 2007;
21(5):
615 - 624.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Machida, K. T. H. Cheng, V. M.-H. Sung, A. M. Levine, S. Foung, and M. M. C. Lai
Hepatitis C Virus Induces Toll-Like Receptor 4 Expression, Leading to Enhanced Production of Beta Interferon and Interleukin-6
J. Virol.,
January 15, 2006;
80(2):
866 - 874.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Aslam, E. R. Speck, M. Kim, A. R. Crow, K. W. A. Bang, F. P. Nestel, H. Ni, A. H. Lazarus, J. Freedman, and J. W. Semple
Platelet Toll-like receptor expression modulates lipopolysaccharide-induced thrombocytopenia and tumor necrosis factor-{alpha} production in vivo
Blood,
January 15, 2006;
107(2):
637 - 641.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y.-C. Chen, E. Giovannucci, R. Lazarus, P. Kraft, S. Ketkar, and D. J. Hunter
Sequence Variants of Toll-Like Receptor 4 and Susceptibility to Prostate Cancer
Cancer Res.,
December 15, 2005;
65(24):
11771 - 11778.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Mandell, A. P. Moran, A. Cocchiarella, J. Houghton, N. Taylor, J. G. Fox, T. C. Wang, and E. A. Kurt-Jones
Intact Gram-Negative Helicobacter pylori, Helicobacter felis, and Helicobacter hepaticus Bacteria Activate Innate Immunity via Toll-Like Receptor 2 but Not Toll-Like Receptor 4
Infect. Immun.,
November 1, 2004;
72(11):
6446 - 6454.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F Y Liew, M Komai-Koma, and D Xu
A toll for T cell costimulation
Ann Rheum Dis,
November 1, 2004;
63(suppl_2):
ii76 - ii78.
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Komai-Koma, L. Jones, G. S. Ogg, D. Xu, and F. Y. Liew
TLR2 is expressed on activated T cells as a costimulatory receptor
PNAS,
March 2, 2004;
101(9):
3029 - 3034.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. A. Kurt-Jones, M. Chan, S. Zhou, J. Wang, G. Reed, R. Bronson, M. M. Arnold, D. M. Knipe, and R. W. Finberg
Herpes simplex virus 1 interaction with Toll-like receptor 2 contributes to lethal encephalitis
PNAS,
February 3, 2004;
101(5):
1315 - 1320.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. P. Tierney, S. Tulac, S.-T. J. Huang, and L. C. Giudice
Activation of the protein kinase A pathway in human endometrial stromal cells reveals sequential categorical gene regulation
Physiol Genomics,
December 16, 2003;
16(1):
47 - 66.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Meng, A. Grabiec, M. Vallon, B. Ebe, S. Hampel, W. Bessler, H. Wagner, and C. J. Kirschning
Cellular Recognition of Tri-/Di-palmitoylated Peptides Is Independent from a Domain Encompassing the N-terminal Seven Leucine-rich Repeat (LRR)/LRR-like Motifs of TLR2
J. Biol. Chem.,
October 10, 2003;
278(41):
39822 - 39829.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Janssens and R. Beyaert
Role of Toll-Like Receptors in Pathogen Recognition
Clin. Microbiol. Rev.,
October 1, 2003;
16(4):
637 - 646.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Beutler, K. Hoebe, X. Du, and R. J. Ulevitch
How we detect microbes and respond to them: the Toll-like receptors and their transducers
J. Leukoc. Biol.,
October 1, 2003;
74(4):
479 - 485.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. G. Jacchieri, R. Torquato, and R. R. Brentani
Structural Study of Binding of Flagellin by Toll-Like Receptor 5
J. Bacteriol.,
July 15, 2003;
185(14):
4243 - 4247.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Nakahara, T. Tsunoda, T. Baba, S. Asabe, and H. Tahara
Dendritic Cells Stimulated with a Bacterial Product, OK-432, Efficiently Induce Cytotoxic T Lymphocytes Specific to Tumor Rejection Peptide
Cancer Res.,
July 15, 2003;
63(14):
4112 - 4118.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. B. Mizel, A. P. West, and R. R. Hantgan
Identification of a Sequence in Human Toll-like Receptor 5 Required for the Binding of Gram-negative Flagellin
J. Biol. Chem.,
June 20, 2003;
278(26):
23624 - 23629.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Martin, S. M. Michalek, and J. Katz
Role of Innate Immune Factors in the Adjuvant Activity of Monophosphoryl Lipid A
Infect. Immun.,
May 1, 2003;
71(5):
2498 - 2507.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. A. Kurt-Jones, L. Mandell, C. Whitney, A. Padgett, K. Gosselin, P. E. Newburger, and R. W. Finberg
Role of Toll-like receptor 2 (TLR2) in neutrophil activation: GM-CSF enhances TLR2 expression and TLR2-mediated interleukin 8 responses in neutrophils
Blood,
August 13, 2002;
100(5):
1860 - 1868.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Iwaki, H. Mitsuzawa, S. Murakami, H. Sano, M. Konishi, T. Akino, and Y. Kuroki
The Extracellular Toll-like Receptor 2 Domain Directly Binds Peptidoglycan Derived from Staphylococcus aureus
J. Biol. Chem.,
June 28, 2002;
277(27):
24315 - 24320.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. Haehnel, L. Schwarzfischer, M. J. Fenton, and M. Rehli
Transcriptional Regulation of the Human Toll-Like Receptor 2 Gene in Monocytes and Macrophages
J. Immunol.,
June 1, 2002;
168(11):
5629 - 5637.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Knuefermann, S. Nemoto, G. Baumgarten, A. Misra, N. Sivasubramanian, B. A. Carabello, and J. G. Vallejo
Cardiac Inflammation and Innate Immunity in Septic Shock* : Is There a Role for Toll-Like Receptors?
Chest,
April 1, 2002;
121(4):
1329 - 1336.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Fox-Marsh and L. C. Harrison
Emerging evidence that molecules expressed by mammalian tissue grafts are recognized by the innate immune system
J. Leukoc. Biol.,
March 1, 2002;
71(3):
401 - 409.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P.-L. Wang and K. Ohura
PORPHYROMONAS GINGIVALIS LIPOPOLYSACCHARIDE SIGNALING IN GINGIVAL FIBROBLASTS-CD14 AND TOLL-LIKE RECEPTORS
Critical Reviews in Oral Biology & Medicine,
March 1, 2002;
13(2):
132 - 142.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Murakami, D. Iwaki, H. Mitsuzawa, H. Sano, H. Takahashi, D. R. Voelker, T. Akino, and Y. Kuroki
Surfactant Protein A Inhibits Peptidoglycan-induced Tumor Necrosis Factor-alpha Secretion in U937 Cells and Alveolar Macrophages by Direct Interaction with Toll-like Receptor 2
J. Biol. Chem.,
February 22, 2002;
277(9):
6830 - 6837.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Li, Y. Wang, L. Gao, J. Zhang, J. Shao, S. Wang, W. Feng, X. Wang, M. Li, and Z. Chang
Expression of Toll-like Receptors 2 and 4 and CD14 during Differentiation of HL-60 Cells Induced by Phorbol 12-Myristate 13-Acetate and 1{alpha}, 25-Dihydroxy-Vitamin D3
Cell Growth Differ.,
January 1, 2002;
13(1):
27 - 38.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Martin, J. Katz, S. N. Vogel, and S. M. Michalek
Differential Induction of Endotoxin Tolerance by Lipopolysaccharides Derived from Porphyromonas gingivalis and Escherichia coli
J. Immunol.,
November 1, 2001;
167(9):
5278 - 5285.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Galdiero, M. D'Isanto, M. Vitiello, E. Finamore, L. Peluso, and M. Galdiero
Porins from Salmonella enterica serovar Typhimurium induce TNF-{alpha}, IL-6 and IL-8 release by CD14-independent and CD11a/CD18-dependent mechanisms
Microbiology,
October 1, 2001;
147(10):
2697 - 2704.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. E. Medvedev, P. Henneke, A. Schromm, E. Lien, R. Ingalls, M. J. Fenton, D. T. Golenbock, and S. N. Vogel
Induction of Tolerance to Lipopolysaccharide and Mycobacterial Components in Chinese Hamster Ovary/CD14 Cells Is Not Affected by Overexpression of Toll-Like Receptors 2 or 4
J. Immunol.,
August 15, 2001;
167(4):
2257 - 2267.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Muzio and A. Mantovani
Toll-like receptors (TLRs) signalling and expression pattern
Innate Immunity,
August 1, 2001;
7(4):
297 - 300.
[Abstract]
[PDF]
|
|
|
|
|
|
|
M. A. S. Campos, I. C. Almeida, O. Takeuchi, S. Akira, E. P. Valente, D. O. Procopio, L. R. Travassos, J. A. Smith, D. T. Golenbock, and R. T. Gazzinelli
Activation of Toll-Like Receptor-2 by Glycosylphosphatidylinositol Anchors from a Protozoan Parasite
J. Immunol.,
July 1, 2001;
167(1):
416 - 423.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Alexander and E. Th. Rietschel
Invited review: Bacterial lipopolysaccharides and innate immunity
Innate Immunity,
June 1, 2001;
7(3):
167 - 202.
[Abstract]
[PDF]
|
|
|
|
|
|
|
B. Beutler and A. Poltorak
The Sole Gateway to Endotoxin Response: How Lps Was Identified as Tlr4, and Its Role in Innate Immunity
Drug Metab. Dispos.,
April 1, 2001;
29(4):
474 - 478.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
R. R. Ingalls, E. Lien, and D. T. Golenbock
Membrane-Associated Proteins of a Lipopolysaccharide-Deficient Mutant of Neisseria meningitidis Activate the Inflammatory Response through Toll-Like Receptor 2
Infect. Immun.,
April 1, 2001;
69(4):
2230 - 2236.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Musikacharoen, T. Matsuguchi, T. Kikuchi, and Y. Yoshikai
NF-{{kappa}}B and STAT5 Play Important Roles in the Regulation of Mouse Toll-Like Receptor 2 Gene Expression
J. Immunol.,
April 1, 2001;
166(7):
4516 - 4524.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. H. Flo, O. Halaas, S. Torp, L. Ryan, E. Lien, B. Dybdahl, A. Sundan, and T. Espevik
Differential expression of Toll-like receptor 2 in human cells
J. Leukoc. Biol.,
March 1, 2001;
69(3):
474 - 481.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
O. Equils, E. Faure, L. Thomas, Y. Bulut, S. Trushin, and M. Arditi
Bacterial Lipopolysaccharide Activates HIV Long Terminal Repeat Through Toll-Like Receptor 4
J. Immunol.,
February 15, 2001;
166(4):
2342 - 2347.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Nishiguchi, M. Matsumoto, T. Takao, M. Hoshino, Y. Shimonishi, S. Tsuji, N. A. Begum, O. Takeuchi, S. Akira, K. Toyoshima, et al.
Mycoplasma fermentans Lipoprotein M161Ag-Induced Cell Activation Is Mediated by Toll-Like Receptor 2: Role of N-Terminal Hydrophobic Portion in its Multiple Functions
J. Immunol.,
February 15, 2001;
166(4):
2610 - 2616.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. M. Hajjar, D. S. O'Mahony, A. Ozinsky, D. M. Underhill, A. Aderem, S. J. Klebanoff, and C. B. Wilson
Cutting Edge: Functional Interactions Between Toll-Like Receptor (TLR) 2 and TLR1 or TLR6 in Response to Phenol-Soluble Modulin
J. Immunol.,
January 1, 2001;
166(1):
15 - 19.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Visintin, A. Mazzoni, J. H. Spitzer, D. H. Wyllie, S. K. Dower, and D. M. Segal
Regulation of Toll-Like Receptors in Human Monocytes and Dendritic Cells
J. Immunol.,
January 1, 2001;
166(1):
249 - 255.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Ozinsky, D. M. Underhill, J. D. Fontenot, A. M. Hajjar, K. D. Smith, C. B. Wilson, L. Schroeder, and A. Aderem
The repertoire for pattern recognition of pathogens by the innate immune system is defined by cooperation between Toll-like receptors
PNAS,
November 22, 2000;
(2000)
250476497.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
R. I. Tapping, S. Akashi, K. Miyake, P. J. Godowski, and P. S. Tobias
Toll-Like Receptor 4, But Not Toll-Like Receptor 2, Is a Signaling Receptor for Escherichia and Salmonella Lipopolysaccharides
J. Immunol.,
November 15, 2000;
165(10):
5780 - 5787.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. R. Ingalls, E. Lien, and D. T. Golenbock
Differential roles of TLR2 and TLR4 in the host response to Gram-negative bacteria: lessons from a lipopolysaccharide-deficient mutant of Neisseria meningitidis
Innate Immunity,
October 1, 2000;
6(5):
411 - 415.
[Abstract]
[PDF]
|
|
|
|
|
|
|
S. Tauszig, E. Jouanguy, J. A. Hoffmann, and J.-L. Imler
Toll-related receptors and the control of antimicrobial peptide expression in Drosophila
PNAS,
September 5, 2000;
(2000)
180130797.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
L. A. J. O'Neill
The Interleukin-1 Receptor/Toll-like Receptor Superfamily: Signal Transduction During Inflammation and Host Defense
Sci. Signal.,
August 8, 2000;
2000(44):
re1 - re1.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Beutler and A. Poltorak
Review: The search for Lps: 1993--1998
Innate Immunity,
August 1, 2000;
6(4):
269 - 293.
[Abstract]
[PDF]
|
|
|
|
|
|
|
M. Fujihara, S. Wakamoto, T. Ito, M. Muroi, T. Suzuki, H. Ikeda, and K. Ikebuchi
Lipopolysaccharide-triggered desensitization of TNF-{alpha} mRNA expression involves lack of phosphorylation of I{kappa}B{alpha} in a murine macrophage-like cell line, P388D1
J. Leukoc. Biol.,
August 1, 2000;
68(2):
267 - 276.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
M. Hirschfeld, Y. Ma, J. H. Weis, S. N. Vogel, and J. J. Weis
Cutting Edge: Repurification of Lipopolysaccharide Eliminates Signaling Through Both Human and Murine Toll-Like Receptor 2
J. Immunol.,
July 15, 2000;
165(2):
618 - 622.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Mokuno, T. Matsuguchi, M. Takano, H. Nishimura, J. Washizu, T. Ogawa, O. Takeuchi, S. Akira, Y. Nimura, and Y. Yoshikai
Expression of Toll-Like Receptor 2 on {gamma}{delta} T Cells Bearing Invariant V{gamma}6/V{delta}1 Induced by Escherichia coli Infection in Mice
J. Immunol.,
July 15, 2000;
165(2):
931 - 940.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. E. Medvedev, K. M. Kopydlowski, and S. N. Vogel
Inhibition of Lipopolysaccharide-Induced Signal Transduction in Endotoxin-Tolerized Mouse Macrophages: Dysregulation of Cytokine, Chemokine, and Toll-Like Receptor 2 and 4 Gene Expression
J. Immunol.,
June 1, 2000;
164(11):
5564 - 5574.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Muzio, D. Bosisio, N. Polentarutti, G. D'amico, A. Stoppacciaro, R. Mancinelli, C. van't Veer, G. Penton-Rol, L. P. Ruco, P. Allavena, et al.
Differential Expression and Regulation of Toll-Like Receptors (TLR) in Human Leukocytes: Selective Expression of TLR3 in Dendritic Cells
J. Immunol.,
June 1, 2000;
164(11):
5998 - 6004.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Krisanaprakornkit, J. R. Kimball, A. Weinberg, R. P. Darveau, B. W. Bainbridge, and B. A. Dale
Inducible Expression of Human beta -Defensin 2 by Fusobacterium nucleatum in Oral Epithelial Cells: Multiple Signaling Pathways and Role of Commensal Bacteria in Innate Immunity and the Epithelial Barrier
Infect. Immun.,
May 1, 2000;
68(5):
2907 - 2915.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Y. Hsu and A. J. W. Hsueh
Discovering New Hormones, Receptors, and Signaling Mediators in the Genomic Era
Mol. Endocrinol.,
May 1, 2000;
14(5):
594 - 604.
[Full Text]
|
|
|
|
|
|
|
M. Watari, H. Watari, I. Nachamkin, and J. F. Strauss III
Lipopolysaccharide Induces Expression of Genes Encoding Pro-Inflammatory Cytokines and the Elastin-Degrading Enzyme, Cathepsin S, in Human Cervical Smooth-Muscle Cells
Reproductive Sciences,
May 1, 2000;
7(3):
190 - 198.
[Abstract]
[PDF]
|
|
|
|
|
|
|
S. Akashi, R. Shimazu, H. Ogata, Y. Nagai, K. Takeda, M. Kimoto, and K. Miyake
Cutting Edge: Cell Surface Expression and Lipopolysaccharide Signaling Via the Toll-Like Receptor 4-MD-2 Complex on Mouse Peritoneal Macrophages
J. Immunol.,
April 1, 2000;
164(7):
3471 - 3475.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Nomura, S. Akashi, Y. Sakao, S. Sato, T. Kawai, M. Matsumoto, K. Nakanishi, M. Kimoto, K. Miyake, K. Takeda, et al.
Cutting Edge: Endotoxin Tolerance in Mouse Peritoneal Macrophages Correlates with Down-Regulation of Surface Toll-Like Receptor 4 Expression
J. Immunol.,
April 1, 2000;
164(7):
3476 - 3479.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. H. Flo, O. Halaas, E. Lien, L. Ryan, G. Teti, D. T. Golenbock, A. Sundan, and T. Espevik
Human Toll-Like Receptor 2 Mediates Monocyte Activation by Listeria monocytogenes, But Not by Group B Streptococci or Lipopolysaccharide
J. Immunol.,
February 15, 2000;
164(4):
2064 - 2069.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. M. Underhill, A. Ozinsky, K. D. Smith, and A. Aderem
Toll-like receptor-2 mediates mycobacteria-induced proinflammatory signaling in macrophages
PNAS,
December 7, 1999;
96(25):
14459 - 14463.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Lien, T. J. Sellati, A. Yoshimura, T. H. Flo, G. Rawadi, R. W. Finberg, J. D. Carroll, T. Espevik, R. R. Ingalls, J. D. Radolf, et al.
Toll-like Receptor 2 Functions as a Pattern Recognition Receptor for Diverse Bacterial Products
J. Biol. Chem.,
November 19, 1999;
274(47):
33419 - 33425.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Kopp, R. Medzhitov, J. Carothers, C. Xiao, I. Douglas, C. A. Janeway, and S. Ghosh
ECSIT is an evolutionarily conserved intermediate in the Toll/IL-1 signal transduction pathway
Genes & Dev.,
August 15, 1999;
13(16):
2059 - 2071.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
A. M. van Furth, E. M. Verhard-Seijmonsbergen, J. A. M. Langermans, J. T. van Dissel, and R. van Furth
Anti-CD14 Monoclonal Antibodies Inhibit the Production of Tumor Necrosis Factor Alpha and Interleukin-10 by Human Monocytes Stimulated with Killed and Live Haemophilus influenzae or Streptococcus pneumoniae Organisms
Infect. Immun.,
August 1, 1999;
67(8):
3714 - 3718.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Schwandner, R. Dziarski, H. Wesche, M. Rothe, and C. J. Kirschning
Peptidoglycan- and Lipoteichoic Acid-induced Cell Activation Is Mediated by Toll-like Receptor 2
J. Biol. Chem.,
June 18, 1999;
274(25):
17406 - 17409.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Shimazu, S. Akashi, H. Ogata, Y. Nagai, K. Fukudome, K. Miyake, and M. Kimoto
MD-2, a Molecule that Confers Lipopolysaccharide Responsiveness on Toll-like Receptor 4
J. Exp. Med.,
June 7, 1999;
189(11):
1777 - 1782.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. A. Hoffmann, F. C. Kafatos, C. A. Janeway Jr., and R. A. Ezekowitz
Phylogenetic Perspectives in Innate Immunity
Science,
May 21, 1999;
284(5418):
1313 - 1318.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
J. C. Chow, D. W. Young, D. T. Golenbock, W. J. Christ, and F. Gusovsky
Toll-like Receptor-4 Mediates Lipopolysaccharide-induced Signal Transduction
J. Biol. Chem.,
April 16, 1999;
274(16):
10689 - 10692.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
X. Meng, B. S. Khanuja, and Y. T. Ip
Toll receptor-mediated Drosophila immune response requires Dif, an NF-kappa B factor
Genes & Dev.,
April 1, 1999;
13(7):
792 - 797.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
F. X. Zhang, C. J. Kirschning, R. Mancinelli, X.-P. Xu, Y. Jin, E. Faure, A. Mantovani, M. Rothe, M. Muzio, and M. Arditi
Bacterial Lipopolysaccharide Activates Nuclear Factor-kappa B through Interleukin-1 Signaling Mediators in Cultured Human Dermal Endothelial Cells and Mononuclear Phagocytes
J. Biol. Chem.,
March 19, 1999;
274(12):
7611 - 7614.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. D. Wright
Toll, A New Piece in the Puzzle of Innate Immunity
J. Exp. Med.,
February 15, 1999;
189(4):
605 - 609.
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. J. Kirschning, H. Wesche, T. Merrill Ayres, and M. Rothe
Human Toll-like Receptor 2 Confers Responsiveness to Bacterial Lipopolysaccharide
J. Exp. Med.,
December 7, 1998;
188(11):
2091 - 2097.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. L. Born, D. E. Smith, K. E. Garka, B. R. Renshaw, J. S. Bertles, and J. E. Sims
Identification and Characterization of Two Members of a Novel Class of the Interleukin-1 Receptor (IL-1R) Family. DELINEATION OF A NEW CLASS OF IL-1R-RELATED PROTEINS BASED ON SIGNALING
J. Biol. Chem.,
September 22, 2000;
275(39):
29946 - 29954.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Okamura, M. Watari, E. S. Jerud, D. W. Young, S. T. Ishizaka, J. Rose, J. C. Chow, and J. F. Strauss III
The Extra Domain A of Fibronectin Activates Toll-like Receptor 4
J. Biol. Chem.,
March 23, 2001;
276(13):
10229 - 10233.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. da Silva Correia and R. J. Ulevitch
MD-2 and TLR4 N-Linked Glycosylations Are Important for a Functional Lipopolysaccharide Receptor
J. Biol. Chem.,
January 11, 2002;
277(3):
1845 - 1854.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Tauszig, E. Jouanguy, J. A. Hoffmann, and J.-L. Imler
From the Cover: Toll-related receptors and the control of antimicrobial peptide expression in Drosophila
PNAS,
September 12, 2000;
97(19):
10520 - 10525.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Ozinsky, D. M. Underhill, J. D. Fontenot, A. M. Hajjar, K. D. Smith, C. B. Wilson, L. Schroeder, and A. Aderem
The repertoire for pattern recognition of pathogens by the innate immune system is defined by cooperation between Toll-like receptors
PNAS,
December 5, 2000;
97(25):
13766 - 13771.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract