|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 11 (June 1), 1998:
pp. 4028-4037
The Partner Gene of AML1 in t(16;21) Myeloid Malignancies Is a
Novel Member of the MTG8(ETO) Family
By
Toshie Gamou,
Eiko Kitamura,
Fumie Hosoda,
Kimiko Shimizu,
Kenji Shinohara,
Yasuhide Hayashi,
Takahiro Nagase,
Yasunobu Yokoyama, and
Misao Ohki
From the Radiobiology Division, National Cancer Center Research
Institute, Tokyo; Division of Hematology, Department of Medicine,
Yamaguchi Prefecture Central Hospital, Yamaguchi; Department of
Pediatrics, Faculty of Medicine, University of Tokyo, Tokyo; Kazusa DNA
Research Institute, Chiba; and the Center for Molecular Biology and
Cytogenetics, SRL, Inc, Tokyo, Japan.
 |
ABSTRACT |
The t(16;21)(q24;q22) translocation is a rare but recurrent
chromosomal abnormality associated with therapy-related myeloid malignancies and a variant of the t(8;21) translocation in which the
AML1 gene on chromosome 21 is rearranged. Here we report the molecular definition of this chromosomal aberration in four patients. We cloned cDNAs from the leukemic cells of a patient carrying t(16;21)
by the reverse transcription polymerase chain reaction using an
AML1-specific primer. The structural analysis of the cDNAs
showed that AML1 was fused to a novel gene named MTG16
(Myeloid Translocation Gene on chromosome
16) which shows high homology to MTG8
(ETO/CDR) and MTGR1. Northern blot analysis using
MTG16 probes mainly detected 4.5 kb and 4.2 kb RNAs, along with
several other minor RNAs in various human tissues. As in t(8;21), the t(16;21) breakpoints occurred between the exons 5 and 6 of
AML1, and between the exons 1 and 2 or the exons 3 and 4 of
MTG16. The two genes are fused in-frame, resulting in the
characteristic chimeric transcripts of this translocation. Although the
reciprocal chimeric product, MTG16-AML1, was also detected in
one of the t(16;21) patients, its protein product was predicted to be
truncated. Thus, the AML1-MTG16 gene fusion in t(16;21)
leukemia results in the production of a protein that is very similar to
the AML1-MTG8 chimeric protein.
 |
INTRODUCTION |
SPECIFIC CHROMOSOMAL translocations are
frequently found in hematopoietic malignant tumors and some types of
solid tumors.1 Molecular analysis of the chromosomal
translocations of leukemia has shown rearrangements of genes involved
in the programmed regulation of proliferation and differentiation
during hematopoietic development. In many myeloid leukemias,
chromosomal alterations have been shown to result in the production of
unusual chimeric proteins.2,3
A number of different and recurring aberrations involving chromosomal
band 21q22 have been observed in human acute myeloid leukemia (AML),
myelodysplastic syndrome (MDS), and the blast crisis phase of chronic
myelogenous leukemia (CML). Previously, we cloned the AML1 gene
on chromosome 21q22 from patients with the t(8;21)
translocation4 which occurs frequently (approximately 40%)
in subtype M2 of AML.5 It was shown that the AML1
gene is the most frequent target of chromosome translocations in human leukemia.6 In the t(8;21) translocation, the AML1
gene was shown to be juxtaposed to the gene which encodes a zinc
finger-containing protein, MTG8 (ETO/CDR), on
chromosome 8q22, resulting in the expression of AML1-MTG8 chimeric
proteins.7-10 In addition, the AML1 gene was found
to be fused with the TEL gene, which encodes a member of the
Ets family of transcription factors, to form a TEL-AML1 chimeric
product by the t(12;21) translocation.11,12 The resultant
chimeric transcripts are detected in pediatric B-cell progenitor acute
lymphoblastic leukemia, the most common form of leukemia observed in
children. Furthermore, AML1-containing fusion products are formed by
the t(3;21) translocation which occurs in MDS and in the blast crisis
phase of CML.13-17
Shimada et al18 have previously shown that a cosmid clone
covering the region spanning exons 5 and 6 of the AML1 gene is split in fluorescence in situ hybridization (FISH) analysis of leukemic
cells with t(16;21)(q24;q22) translocation. This is where the
translocation breakpoints of t(8;21) AML are clustered. We therefore
isolated the partner gene of AML1 by asymmetric polymerase chain reaction (PCR) using AML1-specific primers. The
results show that the AML1 gene is juxtaposed to a novel gene,
MTG16, on chromosome 16. Isolation and characterization of the
wild-type MTG16 cDNA showed that MTG16 is another member of the
MTG8 family of proteins, which display a high degree of sequence
similarity. The AML1-MTG16 chimeric protein shares several structural
features with AML1-MTG8, including the presence of the AML1 runt domain and the four evolutionary conserved motifs of MTG8.
 |
MATERIALS AND METHODS |
Patient samples.
Leukemia cells with t(16;21)(q24;q22) translocation were obtained from
four patients suffering from malignant myeloid diseases. The clinical
and cytogenetic data of the patients have been reported previously.18,19 One patient (no. 1) had a non-Hodgkin
malignant lymphoma, but after receiving cytotoxic chemotherapy
developed therapy-related AML in the absence of MDS. Two patients who
had lung (no. 2) or oviductal (no. 3) cancer as their primary
malignancies received cytotoxic chemotherapy. They were diagnosed as
being in the transitional stage from therapy-related MDS to AML M2. One
patient (no. 4) had de novo hypoplastic MDS.
Cloning of chimeric cDNA.
Total RNA was isolated from the peripheral lymphocytes of patient no. 1 by the acid guanidium thiocyanate/phenol/chloroform method.20 The poly(A)+ RNA was purified from
total RNA using oligotex-dT30 (Daiichi kagaku-yakuhin,
Tokyo, Japan). The cDNA was synthesized with random hexamer primers
using the Marathon cDNA Synthesis Kit (Clontech, Palo Alto,
CA) and was ligated with a cDNA adaptor according to the
manufacturer's instruction. The fragments containing the chimeric cDNA
were amplified by the asymmetric PCR method using an AML1 exon
5-specific primer, AMLex5f1 (CCACCTACCACAGAGCCATCAAAA) and adaptor-specific primers AP1 and/or AP2. PCR amplification was performed for a total of 35 cycles (94°C for 1 minute, 5 cycles of
94°C for 5 seconds, and 72°C for 4 minutes; 5 cycles of 94°C for
5 seconds, and 70°C for 4 minutes; and 25 cycles of 94°C for 5 seconds, and 68°C for 4 minutes) in a Gene Amp PCR system 9600 (Perkin-Elmer Japan, Chiba, Japan). Amplified fragments
were size-fractionated by low melting temperature agarose gel
electrophoresis and were cloned in a plasmid vector, pGEM-T
Easy (Promega, Madison, WI). The AML1 exon 5- and exon
6-specific fragments were isolated using PCR primers AML1C
(GAGGGAAAAGCTTCACTCTG) and AMLP (TTCGAGGTTCTCGGGGCCC), and ABF
(GACATCGGCAGAAACTAGAT) and ABR (CCTGCATCTGACTCTGAGGC), respectively,
and labeled with 32P using the Multiprime DNA labeling
system (Amersham, Buckinghamshire, UK). Positive
AML1 exon 5 and negative AML1 exon 6 clones were selected by colony hybridization of the transformants. DNA sequencing was performed using the PRISM dye-terminator FS cycle sequencing kit
and a ABI PRISM 377 DNA Sequencer (Perkin-Elmer Japan).
cDNA cloning.
To isolate the entire MTG16 cDNA sequence, a human adult brain
cDNA library21 and a human immature myeloid cell line,
KG-1, cDNA library22 were screened with the PCR-amplified
fragment prepared using primers MTG16f1 (TGATGAACGGCAGCAGCCACTCAC) and MTG16-2 (CGTCAATGTCGAGTTCACCAGGCC).
Reverse transcription (RT)-PCR and primers.
From 1 µg of poly(A)+ RNA or total RNA of peripheral
blood from patients and normal individuals, cDNAs were synthesized with random hexamer primers and reverse transcriptase using the Superscript Preamplification System (GlBCO-BRL, Rockville, MD). The
reaction was diluted 20-fold and 0.5 µL was used for PCR. PCR
amplification was performed for 35 cycles (94°C for 30 seconds,
58°C for 60 seconds, and 72°C for 60 seconds), followed by
denaturation at 94°C for 3 minutes and extension at 72°C for 10 minutes. PCR products were separated by electrophoresis through a
1% Sea Plaque GTG agarose gel (FMC,
Rockland, ME) in 1× TAE (Tris-acetate/EDTA electrophoresis buffer). Fragments were excised from the gel and
sequenced directly. PCR primers for the AML1 and MTG16
were designed according to the known cDNA sequences as follows:
AMLex5f1 shown above, AMLex4f2 (GATGGCTGGCAATGATGAAAACTACTCG), AMLex6r2
(ACTCTGAGGCTGAGGGTTAAAGGCAGTG), MTG16r2 (GTTCTCGTTGACTTCCAGTAGCAG),
and MF1 (GTGAAGACGCAGCCCCG).
Genomic cloning.
A P1 library of the total human genome (Du Pont,
Wilmington, DE) was screened by the PCR method as
described.23 Two P1 clones, P24H2 and P122F9, were isolated
using PCR primers MTG16f8 (CGTCTCCATATGTGTAGGAAAGGAC) and MTG16r6
(CTATGTACACGGTCAGGGTCTTCC). The P1 clone P70A4 was isolated using PCR
primers P122F9S-F1 (CTCTGCCTGGGATGATCC) and P122F9S-R
(TCTGGCTGACCTGTCTTCG) obtained from the SP6-end sequence of P122F9. The
location of exons was determined by restriction mapping and Southern
blot analysis of P1 clones using various parts of MTG16 cDNA as
probes. The exon-intron boundaries of the gene were determined by the
direct sequencing of PCR-amplified fragments or subclones using primers
taken from the cDNA sequence.
FISH.
P1 clones were labeled with biotin-16-dUTP and/or
digoxigenin-11-dUTP by nick translation. Hybridization to metaphase
cells was performed as described previously.24 The nuclear
DNA was counter stained with 4,6-diamidino-2-phenylindole
(DAPI).
Southern blot analysis.
Genomic DNAs were isolated from patient no. 1 and from a human normal
lymphocyte cell line, C496. The DNAs were digested with EcoR1,
separated by electrophoresis on an agarose gel, and transferred to
NyTRAN 0,45 membrane (Schleicher & Schuell, Dassel,
Germany). The PCR-amplified product (434 bp) obtained
using primers 124r5R1 (AACAGTGCTGCCAGAACG) and MTG16r5
(CAGACCATAGACCATTTTAAGCAGCC), and the EagI-EcoRI
restricted 2-kb fragment were used as probes. Hybridizations were
performed at 42°C under stringent conditions. The final washing was
in 0.1× standard saline citrate (SSC)/0.1% sodium
dodecyl sulfate (SDS) at 65°C. Autoradiography was performed using a
bioimage analyzer, Fujix BAS2000 (Fuji shashin film,
Tokyo, Japan).
Northern blot analysis.
Membranes containing Poly(A)+ RNA from a wide variety of
human tissues were purchased from Clontech. Hybridization and
autoradiography were performed as for Southern blot analysis.
 |
RESULTS |
Cloning of fusion cDNA from a patient with t(16;21).
Because it was shown by FISH analysis18 that the
AML1 gene is split in a region spanning exons 5 and 6 in
t(16;21)(q24;q22) translocation, we performed asymmetric PCR using an
AML1 exon 5-specific primer, AMLex5f1, to obtain the fusion
cDNA. The fusion cDNA obtained from patient no. 1 shows that the 5
portion of the AML1 gene is joined to a novel sequence in an
in-frame manner. The 5 portion of the fusion cDNA sequence
corresponded to a nucleotide sequence present in AML1b mRNA
(nucleotides 1983 to 2110; the nucleotide position 2110 corresponds to
the end of exon 5).25 The sequence of the 3 portion of the
fusion cDNA was unknown, but showed significant homology to
MTG8 (72% in nucleotide), a gene implicated in the t(8;21)
translocation of acute myeloid leukemia.7,8 Hence we named
this novel gene MTG16 (Myeloid Translocation
Gene on chromosome 16).
Cloning and characterization of the wild-type MTG16 gene.
The wild-type MTG16 cDNA clones were isolated from the cDNA
libraries of a human adult brain and a KG-1 myeloid cell line using the
novel, partial sequence of MTG16 as a probe. Nucleotide sequence analysis of seven overlapping clones identified two types of
composite cDNA sequences, named MTG16a and MTG16b,
which differ in the sequences of their 5 regions. MTG16a
(identified as 4227 bp) and MTG16b (identified as 4024 bp)
possess distinct 309-bp and 181-bp sequences, respectively, in their
5 -end portions. These sequences are then followed by a 153-bp sequence
that is common to both cDNAs, by a 75-bp sequence specific to
MTG16a, and by a common 3690-bp sequence present in the 3
portion of both cDNAs (Fig 1; the identical
3 sequence of 3690 bp in both types is not shown). We extensively
searched MTG16b-type clones from a KG-1 cell line cDNA library,
but could not find any clones containing the 75-bp sequence specific to
MTG16a as shown in Fig 1. Each of the types was determined by
sequencing at least two independent cDNA clones. Because these two
types of MTG16 cDNAs were also detected in normal human
peripheral blood using RT-PCR method (data not shown), both types
probably correspond to alternatively spliced forms of MTG16.
The predicted open reading frame of MTG16b cDNA has an in-frame
stop codon before a potential methionine start codon at nucleotide
position of 214 (Fig 1), and would code for a 567-amino acid protein.
MTG16a cDNA, which has no in-frame stop codon and two
potential, methionine start codons at nucleotide positions 149 and 222, would code for a 653-amino acid protein if translation started from
the former methionine (Fig 1). We have no evidence in favor of the use
of either methionine start codon, but the upstream sequence containing
the first methionine codon has been confirmed repeatedly.

View larger version (49K):
[in this window]
[in a new window]
| Fig 1.
Nucleotide sequences of the 5 portions of MTG16a
and MTG16b cDNA. The 5 -end sequences that differ
between MTG16a and MTG16b cDNA and the deduced amino
acid sequences are shown. The shaded area of the sequence indicates the
153 nucleotide region common to both MTG16a and
MTG16b cDNA and the underlined sequence indicates the 75 nucleotide region specific to MTG16a. ATG codons are boxed and
their upstream stop codons are double-underlined. The entire nucleotide
sequence data reported here has been deposited in the DDBJ/EMBL/Genebank database under the accession number AA010419 and
AA010420.
|
|
Both of the predicted protein products of MTG16a and MTG16b are highly
homologous to MTG8b (67% and 75% identity,
respectively)7,8 and MTGR1, another member of the MTG8
family (54% and 61% identity, respectively).26 From a
comparison of the amino acid sequences of MTG8b, MTGR1, and
Nervy,27 a putative Drosophila homologue of MTG8,
we previously identified four evolutionary conserved regions termed NHR
(Nervy homology region) 1, 2, and 3, and a zinc finger domain (or
NHR4).26 Figure 2 shows that
these NHRs and the C-terminal zinc finger domain are completely
conserved in MTG16a and MTG16b. Three proline/serine/threonine-rich
regions (designated as PST) found in MTG8 and MTGR1 are also conserved in MTG16 at the corresponding position, except that the first PST
region is disrupted by an intervening 25-amino acid region in MTG16a.

View larger version (95K):
[in this window]
[in a new window]
| Fig 2.
Comparison of the amino acid sequences of MTG16a, MTG16b,
MTG8b, and MTGR1. Identical residues shared by more than two proteins are shaded. Horizontal bars above the sequences indicate the positions of NHR1, NHR2, NHR3, and the zinc finger domain. Horizontal wavy lines
also indicate the positions of PST region. The cysteine residues of the
zinc finger motifs are marked by an asterisk below the sequence. The
amino acid sequences of the two proteins are identical to one another
after the 127th leucine of MTG16a and after the 41st leucine of
MTG16b.
|
|
MTG16 mRNA is expressed in many tissues with broad tissue
specificity. The most common species were 4.5 kb, 4.2 kb, and 3.1 kb,
with the exception of liver where only 2.95-kb and 2.5-kb transcripts
were detected. The MTG16 expression level is relatively high in
heart, pancreas, skeletal muscle, spleen, thymus, and peripheral blood
leukocytes, and low in testis and ovary. No MTG16 RNA was
detected in kidney (Fig 3). The 4.5-kb and
4.2-kb species of RNA seem to correspond to the MTG16a and
MTG16b transcripts, respectively, because their lengths
coincide well with the sizes of the corresponding cDNAs. The origin and
significance of the 3.1-kb RNA, and the 2.95-kb and 2.5-kb RNAs
specific to liver remain to be determined. These might represent
alternative splicing forms of MTG16.

View larger version (107K):
[in this window]
[in a new window]
| Fig 3.
Northern blot analysis of the expression of MTG16
in human tissues. Northern blot filters from human adult tissues
(Clontech) were used for analysis. Probes: (A), whole MTG16a
cDNA (nucleotides 1 to 4227); (B), G3PDH. Lanes 1, heart; 2, brain; 3, placenta; 4, lung; 5, liver; 6, skeletal muscle; 7, kidney;
8, pancreas; 9, spleen; 10, thymus; 11, prostate; 12, testis; 13, ovary; 14, small intestine; 15, colon; 16, peripheral blood
leukocyte.
|
|
Genomic organization of MTG16 gene.
The genomic clones P24H2 and P122F9 were isolated from a human genomic
P1 library using the PCR primers specific to the 3 portion of
MTG16 cDNA. Restriction mapping and MTG16 exon mapping of P24H2 and P122F9 revealed that they overlapped in the 3 region of
the gene and that P122F9 contained most but not all of the MTG16 gene. Genomic walking from the SP6-end of P122F9 was
performed and yielded the clone P70A4 containing the 5 -end sequence of MTG16 cDNA. The MTG16 gene has 13 exons (1a, 1b, and
2-12) which have been aligned on the restriction map of P70A4 and
P122F9 in Fig 4. Genomic sequencing
analysis revealed that exon 1b was located at the terminus of the 18kb
NotI-SalI fragment of P70A4. Detailed restriction
analysis of the region containing exon 1a was not performed, but it was
mapped to the 40 kb NotI fragment of P70A4 by Southern
hybridization. The exon/intron boundary sequences of the MTG16
gene were determined (Table 1). All of
exon/intron boundaries determined possess consensus splice donor and
acceptor sequences,28 including the GT-AG motif. The sizes
of introns (intron 2 to 11) were also determined by genomic PCR. Based
on this map, we estimate that the MTG16 gene is larger than 73 kb, although the location of exon 1a has not been determined precisely.

View larger version (12K):
[in this window]
[in a new window]
| Fig 4.
The structure of MTG16 gene. Three P1 clones
covering the entire MTG16 gene are shown in the upper part of
the figure. Exons of the MTG16 gene are represented by boxes on
the restriction map. Horizontal bars indicate breakpoints in t(16;21)
patients. Breakpoints in patients 2 and 3 indicate sites predicted from cDNA sequences. Sa, N, E, and Bg indicate the restriction site for
Sa/I, NotI, EcoRI, and BglII,
respectively. Horizontal bars under the restriction map indicates the
probes that were used in Southern blot analysis of the genomic DNAs.
Schematic representation of alternative splicing forms of the
MTG16 transcripts, MTG16a and MTG16b, are also
shown. The positions of deduced start codons and stop codons are shown
by ATG and TGA, respectively.
|
|
Expression of the AML1-MTG16 fusion gene in t(16;21) AML
patients.
The expression of AML1, MTG16, AML1-MTG16, and MTG16-AML1 was examined
by RT-PCR method using total RNA isolated from the peripheral blood of
t(16;21) patients and a normal control. AML1 and MTG16
were detected with the expected product size in both the t(16;21)
patients and normal individuals (Fig 5C and
D). On the other hand, AML1-MTG16 chimera was detected as a
product of 545 bp in three t(16;21) AML patients (no. 1, 2, and 3) and
as a product of 773 bp in patient no. 4 using AMLex5f1 and MTG16r2 primers (Fig 5A). Sequence analysis of the PCR-amplified chimeric AML1-MTG16 fragments indicated that three of the four patients (no. 1, 2, and 3) had breaks between exon 3 and exon 4 (type 1), and
that one patient (no. 4) had a break between exon 1 and exon 2 of
MTG16 (type 2) (Fig 6). The
predicted products of AML1-MTG16 would be 704 amino acids (type
1) and 780 amino acids (type 2) in length.

View larger version (65K):
[in this window]
[in a new window]
| Fig 5.
RT-PCR analysis of the AML1-MTG16 and the
MTG16-AML1 chimeric transcripts in four t(16;21) patients.
Poly(A)+ RNA and total RNA samples from peripheral blood
were reverse transcribed into cDNA. The primer pairs, AML1ex5f1 and
MTG16r2, MF1 and AML1ex6r2, AML1ex4f2 and AML1ex6r2, and MF1 and
MTG16r2 were used for amplification of AML1-MTG16 (A),
MTG16-AML1 (B), AML1 (C), and MTG16 (D)
transcripts, respectively (their locations are shown in Fig 6). Lane 1, poly(A)+ RNA from patient no. 1; lanes 2 through 5, total
RNA from patients no. 1 through 4; lanes 6 and 7, total RNA from normal
individuals; lane 8, template-free. Arrows indicate the detected
transcripts with their sizes in bp. The two AML1-MTG16 chimeric
products (545 bp in lanes 1 through 4 and 773 bp in lane 5 seen in
[A]) and the one MTG16-AML1 chimeric product (357 bp in lanes
1 and 2 seen in [B]) were purified and sequenced.
|
|

View larger version (32K):
[in this window]
[in a new window]
| Fig 6.
Schematic diagram of the wild-type proteins of AML1 and
MTG16, the chimeric proteins AML1-MTG16 type 1 and type 2, and the reciprocal chimeric protein MTG16-AML1 type 1R detected in patient no.
1. Vertical arrowheads indicate breakpoints of AML1 and MTG16. Horizontal arrowheads indicate the location of primers used for RT-PCR.
Regions that correspond to the structural or functional domains of the
proteins are shown: runt, runt domain; PST,
proline/serine/threonine-rich region; NHR1-3, Drosophila Nervy
homologous region 1-3; Zn finger, zinc finger domain. Nucleotide
sequences and positions near the junction of chimeric proteins are also
shown and those derived from MTG16 are indicated by italic.
|
|
The expression of the reciprocal MTG16-AML1 chimera was
examined using MF1 and AMLex6r2 primers. A 357-bp PCR product of the expected size was observed specifically in the leukemic cells of
patient no. 1, but it did not appear in the other patients (Fig 5B).
Because patients no. 1, 2, and 3 expressed the same AML1-MTG16
fusion product, we expected that the reciprocal MTG16-AML1 product would be of the same size in these patients. However, the same
357-bp product was not repeatedly detected in the remaining two
patients (no. 2 and 3) by RT-PCR. This fact might indicate that an
additional aberration such as a deletion had occurred at the junction
point on the der(21) chromosome. At least in the peripheral blood of
patient no. 1, the MTG16-AML1 chimera derived from der(21)
chromosome was expressed as well as AML1-MTG16 chimera derived
from der(16) chromosome. However, sequence analysis predicted that the
resulting MTG16-AML1 product would be truncated at the fusion
point, because the UGA stop codon is located at the MTG16-AML1 junction (Fig 6). The absence of MTG16-AML1 transcripts from
most patients and the presence of a putative, truncated
MTG16-AML1 protein in patient no. 1 suggest that
AML1-MTG16 rather than MTG16-AML1 is involved in the
pathogenesis of t(16;21) leukemia.
FISH analysis and detection of genomic rearrangements.
To confirm the rearrangements of the MTG16 gene in t(16;21)
patients, FISH analysis and Southern blot analysis were performed using
the genomic P1 clone, P122F9 and P24H2, or DNA fragments derived from
P122F9. The location of P122F9 on chromosome 16q24 of a
normal human individual was confirmed by metaphase FISH (Fig 7B). On
the other hand, P122F9 signals were detected as triple signals in the
t(16;21)(q24;q22) patient (no. 3) (Fig 7A).
P24H2 containing the 3 portion of MTG16 gene located distal to
the breakpoints was mapped on the der(16) chromosome as well as on the
normal chromosome 16 of patient no. 3 (data not shown), indicating that
the direction of transcription of MTG16 is from telomere to
centromere, like in the case of AML1.5

View larger version (110K):
[in this window]
[in a new window]
| Fig 7.
FISH. (A) and (B) illustrate the mapping of the P1 clone
P122F9 in cells from the patient no. 3 and in cells from a normal individual, respectively. The P122F9 probe hybridized to both of the
der(16) and the der(21) chromosomes, as well as to normal chromosome 16 in patient no. 3. The normal 16 and the der(16) chromosomes are
indicated by an arrowhead, and the der(21) chromosome is indicated by
an arrow.
|
|
In genomic Southern hybridization of patient no. 1, the downstream
fragment of MTG16 exon 3 (the 2-kb EagI-EcoRI
fragment shown as probe II in Fig 4) detected rearranged bands of 15 kb and 3.7 kb in addition to a germline 12-kb EcoRI band. On the other hand, the upstream fragment of exon 3 (PCR-amplified 434-bp fragment shown as probe I in Fig 4) detected the 15-kb rearranged band
and the normal band (Fig 8). As the
translocation breakpoint in patient no. 1 was found to be located
between exon 3 and exon 4 of MTG16 by sequence analysis of its
fusion cDNA, these results suggest that the breakpoint is located
within the 2-kb region, downstream of exon 3 of MTG16.

View larger version (53K):
[in this window]
[in a new window]
| Fig 8.
Southern blot analysis of the MTG16 gene. Genomic
DNAs were digested with EcoRI and hybridized with probe I and
II shown in Fig 4. Probe I; the PCR-amplified 434-bp genomic fragment
using the primers 124r5R1 and MTG16r5. Probe II; the
EagI-EcoRI 2-kb fragment. Rearranged bands (15-kb band
derived from der(21) chromosome and 3.7-kb band derived from der(16)
chromosome) and germline bands (12 kb) are shown by arrowheads and an
arrow, respectively. Lane 1, a human normal leukocyte cell line C496
was used as a control; lane 2, patient no. 1.
|
|
 |
DISCUSSION |
In this study, we analyzed the translocation breakpoint in
t(16;21)(q24;q22) and identified a novel fusion gene consisting of a
partial sequence from AML1 on chromosome 21 and MTG16
on chromosome 16. The t(16;21)(q24;q22) translocation is a rare but recurrent chromosomal abnormality associated with therapy-related AML
or MDS.18,19,29 Sequence analysis of MTG16 cDNA
revealed two alternative splicing iso-forms, termed MTG16a and
MTG16b, which contain different 5 -end exons. Sequence
comparison of the predicted amino acid sequences of MTG16a and MTG16b
with that of MTG8b shows 67% and 75% identity, respectively, and the
sequence similarity extends over the entire coding region, with the
exception of the N-terminal amino acid sequences. Interestingly, the
MTG16 protein moiety of the fusion gene product faithfully comprises the four evolutionary conserved motifs, NHR1, NHR2, NHR3, and the zinc
finger domain (NHR4) which were uncovered by sequences comparison
between MTG8 and Nervy,26 as well as the corresponding MTG8
portion of AML1-MTG8. The presence of common structural features between MTG8 and MTG16 suggests that AML1-MTG16 may possess
similar, if not the same biological activity as AML1-MTG8.
AML1 is a transcription factor and forms heterodimeric complex with
CBF (also known as PEBP2 ).30,31 The AML1
transcription factor complex regulates the transcription of target
genes by binding to the DNA sequence TGT/cGGT.30-33
Possible transcriptional targets include the T-cell antigen
receptors,32,34,35 the colony-stimulating factor 1 receptor,36 myeloperoxidase, neutrophil elastase,37 granulocyte-macrophage colony-stimulating
factor,38,39 and granzyme B.40 Targeted
disruption has shown that both AML1 and CBF /PEBP2 are essential
for all lineages of definitive hematopoiesis in mouse fetal
liver.41-45 All of these studies indicated tight association between AML1 and hematopoiesis. On the contrary, little is
known about the functional activity of MTG8, the fusion partner of the t(8;21) translocation, in leukemogenesis. The present finding that MTG16, a member of the MTG8 family of proteins, is
targeted by a leukemia-causing translocation may indicate that the
partner genes MTG8 and MTG16 are in some way important
for the leukemogenic nature of the fusion gene products. AML1-MTG8
inhibits granulocytic differentiation in L-G mouse myeloid progenitor
cells and AML1a, which lacks the transactivation domain, shows less
inhibitory activity.26 Additional support for this
prediction comes from another member of the MTG8 family, named MTGR1,
which may be responsible for the repression of AML1-dependent
transcription and, possibly, leukemogenesis.26 All of these
observations strengthen the need for studies to elucidate how MTG8
family members contribute to the mechanism of myeloid leukemogenesis.
Three out of the four patients examined here developed therapy-related
myeloid malignancies after chemotherapy treatment with agents that
included etoposide or adriamycin. The breakpoint in the de novo MDS
patient was mapped in the large intron (greater than 45 kb) between
exons 1 and 2, whereas the breakpoints of therapy-related leukemia were
mapped to another region. It will be interesting to examine if these
breakpoints are associated with the presence of scaffold attachment
regions and high-affinity topoisomerase II binding sites, which have
been observed during the mapping of breakpoints within the MLL
gene (also called ALL-1, HTRX1, or
HRX).46-49 The t(16;21) translocation, which is
predominantly found in therapy-related leukemia, might become another
valuable system for the analysis of the molecular mechanism of
recombination.
The t(8;21) chromosome translocation is one of the most frequent
chromosome abnormalities in leukemia, whereas t(16;21) is quite rare.
The molecular mechanism of recombination that leads to chromosome
translocation remains unsolved. In the present study, we showed that
the structural characteristics of AML1-MTG8 in t(8;21) are
strongly conserved in AML1-MTG16 resulting from t(16;21). One
of the parameters that might determine the frequency of occurrence of
these translocations is the size of target introns. The breakpoints of
both t(8;21) and t(16;21) occur within the same intron of AML1, which is located immediately downstream of a phylogenetically conserved
DNA-binding domain (the runt box). Therefore, the frequency could be
determined by the targeted intron size of the partner genes,
MTG8 and MTG16. Most breakpoints on chromosome 8 fall
within two introns, between two alternative 5 MTG8 exons 1b
and 1a and between exons 1a and 2, and the breakpoint clustered region
is estimated about 20 kb in size.50 In t(16;21), chromosome
breakages occur within two introns of MTG16, the sizes of which
total more than 51 kb. These estimated sizes do not reflect the known
frequency of both leukemias. Thus, the preferential occurrence of the
t(8;21) translocation in leukemia would seem to suggest that the
leukemogenic potential of AML1-MTG16 is not equivalent to that of
AML1-MTG8 and leukemia with t(16;21) requires an another defect in
addition to the formation of AML1-MTG16 fusion gene, or that there
exist recombination hotspots or recombination-specific signals in
MTG8 gene. Functional analysis of both pathogenic gene products
as well as nucleotide sequence analysis of the recombinational junction sites should help to understand this difference in the frequency.
 |
FOOTNOTES |
Submitted February 17, 1998;
accepted March 12, 1998.
Supported in part by the Program of Fundamental Studies in Health
Sciences of the Organization for Drug ADR Relief, R&D Promotion and
Product Review of Japan; by a Grants-in-Aid for Scientific Research on
Priority Areas from the Ministry of Education, Science, Sports and
Culture; by a grant from the Special Coordination Funds for the
Promotion of Science and Technology from Science and Technology Agency;
by a Grant-in-Aid for the Comprehensive 10-year Strategy for Cancer
Control; and by the Grant-in-Aid for Cancer Research from the Ministry
of Health and Welfare of Japan.
Address reprint requests to Fumie Hosoda, PhD,
Radiobiology Division, National Cancer Center Research Institute,
5-1-1, Tsukiji, Chuo-ku, Tokyo 104, Japan.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
 |
ACKNOWLEDGMENT |
We are grateful to Dr T. Matsumoto and Dr K. Matsushita of Imamura
Hospital, and Dr T. Shimizu of Isehara Kyodo Hospital for providing
patient samples. We thank Kazusa DNA Research Institute Foundation for
support to a cDNA Research Program.
 |
REFERENCES |
1.
Rabbitts TH:
Chromosomal translocations in human cancer.
Nature
372:143,
1994[Medline]
[Order article via Infotrieve]
2.
Barr Fg:
The malevolence of matchmaking.
Nat Genet
12:113,
1996[Medline]
[Order article via Infotrieve]
3.
Pedersen-Bjergaad J,
Rowley JD:
The balanced and the unbalanced chromosome aberrations of acute myeloid leukemia may develop in different ways and may contribute differently to malignant transformation.
Blood
83:2780,
1994[Abstract/Free Full Text]
4.
Miyoshi H,
Shimizu K,
Kozu T,
Maseki N,
Kaneko Y,
Ohki M:
t(8;21) breakpoints on chromosome 21 in acute myeloid leukemia are clustered within a limited region of a single gene, AML1.
Proc Natl Acad Sci USA
88:10431,
1991[Abstract/Free Full Text]
5.
Mitelman F,
Heim S:
Quantitative acute leukemia cytogenetics.
Genes Chromosomes Cancer
5:57,
1992[Medline]
[Order article via Infotrieve]
6.
Nucifora G,
Rowley JD:
AML1 and the 8;21 and 3;21 translocations in acute and chronic myeloid leukemia.
Blood
86:1,
1995[Free Full Text]
7.
Miyoshi H,
Kozu T,
Shimizu K,
Enomoto K,
Maseki N,
Kaneko Y,
Kamada N,
Ohki M:
The t(8;21) translocation in acute myeloid leukemia results in production of an AML1-MTG8 fusion transcript.
EMBO J
12:2715,
1993[Medline]
[Order article via Infotrieve]
8.
Kozu T,
Miyoshi H,
Shimizu K,
Maseki N,
Kaneko Y,
Asou H,
Kamada N,
Ohki M:
Junction of the AML1/MTG8(ETO) fusion are constant in t(8;21) acute myeloid leukemia detected by reverse transcription polymerase chain reaction.
Blood
82:1270,
1993[Abstract/Free Full Text]
9.
Erickson P,
Gao J,
Chang KS,
Look T,
Whisenant E,
Raimondi S,
Lasher R,
Trujillo J,
Rowley J,
Drabkin H:
Identification of breakpoints in t(8;21) acute myelogenous leukemia and isolation of a fusion transcript, AML1/ETO, with similarity to Drosophila segmentation gene, runt.
Blood
80:1825,
1992[Abstract/Free Full Text]
10.
Nisson PE,
Watkins PC,
Sacchi N:
Transcriptionally active chimeric gene derived from the fusion of the AML1 gene and a novel gene on chromosome 8 in t(8;21) leukemic cells.
Cancer Genet Cytogenet
63:81,
1992[Medline]
[Order article via Infotrieve]
11.
Golub TR,
Barker GF,
Bohlander SK,
Hiebert SW,
Ward DC,
Bray-Ward P,
Morgan E,
Raimondi SC,
Rowley JD,
Gilliland DG:
Fusion of the TEL gene on 12p13 to the AML1 gene on 21q22 in acute lymphoblastic leukemia.
Proc Natl Acad Sci USA
92:4917,
1995[Abstract/Free Full Text]
12.
Romana SP,
Mauchauffe M,
Le Coniet M,
Chumakov I,
Le Paslier D,
Berger R,
Bernard OA:
The t(12;21) of acute lymphoblastic leukemia results in a TEL-AML1 gene fusion.
Blood
85:3662,
1995[Abstract/Free Full Text]
13.
Rubin CM,
Larson RA,
Anastasi J,
Winter JN,
Thangavelu M,
Vardiman J,
Rowley JD,
LeBeau MM:
t(3;21)(q26;q22): A recurring chromosomal abnormality in therapy-related myelodysplastic syndrome and acute myeloid leukemia.
Blood
76:2594,
1990[Abstract/Free Full Text]
14.
Nucifora G,
Birn DJ,
Espinosa R III,
Erickson P,
LeBeau MM,
Roulston D,
McKeithan TW,
Drabkin H,
Rowley JD:
Involvement of the AML1 gene in the t(3;21) in therapy-related leukemia and in chronic myeloid leukemia in blast crisis.
Blood
81:2728,
1993[Abstract/Free Full Text]
15.
Nucifora G,
Begy CR,
Erickson P,
Drabkin HA,
Rowley JD:
The 3;21 translocation in myelodysplasia results in a fusion transcript between the AML1 gene and the gene for EAP, a highly conserved protein associated with the Epstein-Barr virus small RNA EBER 1.
Proc Natl Acad Sci USA
90:7784,
1993[Abstract/Free Full Text]
16.
Mitani K,
Ogawa S,
Tanaka T,
Miyoshi H,
Kurokawa M,
Mano H,
Yazaki Y,
Ohki M,
Hirai H:
Generation of the AML1-EVI-1 fusion gene in the t(3;21)(q26;q22) causes blastic crisis in chronic myelocytic leukemia.
EMBO J
13:504,
1994[Medline]
[Order article via Infotrieve]
17.
Nucifora G,
Begy CR,
Kobayashi H,
Roulston D,
Claxton D,
Pedersen-Bjergaad J,
Parganas E,
Ihle JN,
Rowley JD:
Consistent intergenic splicing and production of multiple transcripts between AML1 at 21q22 and unrelated genes at 3q26 in (3;21)(q26;q22) translocations.
Proc Natl Acad Sci USA
91:4004,
1994[Abstract/Free Full Text]
18.
Shimada M,
Ohtsuka E,
Shimizu T,
Matsumoto T,
Matsushita K,
Tanimoto F,
Kajii T:
A recurrent translocation, t(16;21)(q24;q22), associated with acute myelogenous Leukemia: Identification by fluorescence in situ hybridization.
Cancer Genet Cytogenet
96:102,
1997[Medline]
[Order article via Infotrieve]
19. Takeda K, Shinohara K, Kameda N, Ariyoshi K: A case of
therapy-related acute myeloblastic leukemia with t(16;21)(q24;q22) after chemotherapy with DNA topoisomerase II inhibitors, etoposide and
mitoxantrone, and the alkylating agent, cyclophosphamide. Int J Hematol
(in press)
20.
Chomczynski P,
Sacchi N:
Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chroloform extraction.
Anal Biochem
162:156,
1987[Medline]
[Order article via Infotrieve]
21.
Ohara O,
Nagase T,
Ishikawa K,
Nakajima D,
Ohira M,
Seki N,
Nomura N:
Construction and characterization of human brain cDNA libraries suitable for analysis of cDNA clones encoding relatively large proteins.
DNA Res
4:53,
1997[Abstract]
22.
Nomura N,
Miyajima N,
Sazuka T,
Tanaka A,
Kawarabayashi Y,
Sato S,
Nagase T,
Seki N,
Ishikawa K,
Tabata S:
Prediction of the coding sequences of unidentified human genes. I. The coding sequences of 40 new genes (KIAA0001-KIAA0040) deduced by analysis of randomly sampled cDNA clones from human immature myeloid cell line KG-1.
DNA Res
1:27,
1994[Abstract/Free Full Text]
23.
Ohira M,
Ichikawa H,
Suzuki E,
Iwaki M,
Suzuki K,
Saito-Ohara F,
Ikeuchi T,
Chumakov I,
Tanahashi H,
Tashiro K,
Sakaki Y,
Ohki M:
A 1.6-Mb P1-based physical map of the down syndrome region on chromosome 21.
Genomics
33:65,
1996[Medline]
[Order article via Infotrieve]
24.
Kallioniemi A,
Kallioniemi O-P,
Sudar D,
Rutovitz D,
Gray JW,
Waldman F,
Pinkel D:
Comparative genomic hybridization for molecular cytogenetic analysis of solid tumors.
Science
258:818,
1992[Abstract/Free Full Text]
25.
Miyoshi H,
Ohira M,
Shimizu K,
Mitani K,
Hirai H,
Imai T,
Yokoyama K,
Soeda E,
Ohki M:
Alternative splicing and genomic structure of the AML1 gene involved in acute myeloid leukemia.
Nucleic Acids Res
23:2762,
1995[Abstract/Free Full Text]
26.
Kitabayashi I,
Ida K,
Morohoshi F,
Yokoyama A,
Mitsuhashi N,
Shimizu K,
Nomura N,
Hayashi Y,
Ohki M:
The AML1-MTG8 leukemic fusion protein forms a complex with a novel member of the MTG(ETO/CDR) family, MTGR1.
Mol Cell Biol
18:846,
1998[Abstract/Free Full Text]
27.
Feinstein PG,
Kornfeld K,
Hogness DS,
Mann RS:
Identification of homeotic target genes in Drosophila melanogaster including nervy, a proto-oncogene homologue.
Genetics
140:573,
1995[Abstract]
28.
Shapiro MB,
Senapathy P:
RNA splice junctions of different classes of eukaryotes: Sequence statistics and functional implications in gene expression.
Nucleic Acids Res
15:7155,
1987[Abstract/Free Full Text]
29.
Berger R,
Coniat ML,
Romana SP,
Jonveaux P:
Secondary acute myeloblastic leukemia with t(16;21)(q24;q22) involving the AML1 gene.
Hematol Cell Ther
38:183,
1996 [Medline]
[Order article via Infotrieve]
30.
Ogawa E,
Maruyama M,
Kagoshima H,
Inuzuka M,
Lu J,
Satake M,
Shigesada K,
Ito Y:
PEBP2/PEA2 represents a family of transcription factors homologous to the products of the Drosophila runt gene and the human AML1 gene.
Proc Natl Acad Sci USA
90:6859,
1993[Abstract/Free Full Text]
31.
Ogawa E,
Inuzuka M,
Maruyama M,
Satake M,
NAito-Fujimoto M,
Ito Y,
Shigesada K:
Molecular cloning and characterization of PEBP2 , the heterodimeric partner of a novel Drosophila runt-related DNA binding protein PEBP2 .
Virology
194:314,
1993[Medline]
[Order article via Infotrieve]
32.
Wang S,
Wang Q,
Crute BE,
Melnikova IN,
Keller SR,
Speck NA:
Cloning and characterization of subunits of the T-cell receptor and murine leukemia virus enhancer core-binding factor.
Mol Cell Biol
13:3324,
1993[Abstract/Free Full Text]
33.
Mayers S,
Dowing JR,
Hiebert SW:
Identification of AML-1 and the (8;21) translocation protein (AML1-1/ETO) as sequence-specific DNA-binding proteins: The runt homology domain is required for DNA binding and protein-protein interactions.
Mol Cell Biol
13:6336,
1993[Abstract/Free Full Text]
34.
Prosser HM,
Wotton D,
Gegonne A,
Ghysdael J,
Wang S,
Speck NA,
Owen MJ:
A phorbol ester response element within the human T-cell receptor -chain enhancer.
Proc Natl Acad Sci USA
89:9934,
1992[Abstract/Free Full Text]
35.
Redondo JM,
Pfohl JL,
Hernandez-Munain C,
Wang S,
Speck NA,
Krangel MS:
Indistinguishable nuclear factor binding to functional core sites of the T-cell receptor and murine leukemia virus enhancers.
Mol Cell Biol
12:4817,
1992[Abstract/Free Full Text]
36.
Zhang DE,
Fujioka K,
Hetherington CJ,
Shapiro LH,
Chen HM,
Look AT,
Tenen DG:
Identification of a region which directs the monocytic activity of the colony-stimulating factor 1 (macrophage colony-stimulating factor) receptor promoter and binds PEBP2/CBF (AML1).
Mol Cell Biol
14:8085,
1994[Abstract/Free Full Text]
37.
Nuchprayoon I,
Meyers S,
Scott LM,
Suzow J,
Hiebert S,
Friedman AD:
PEBP2/CBF, the murine homolog of the human myeloid AML1 and PEBP2 /CBF proto oncoproteins, regulates the murine myeloperoxidase and neutrophil elastase genes in immature myeloid cells.
Mol Cell Biol
14:5558,
1994[Abstract/Free Full Text]
38.
Takahashi A,
Satake M,
Yamaguchi-Iwai Y,
Bae SC,
Lu J,
Maruyama M,
Zhang YM,
Oka H,
Arai N,
Arai K,
Ito Y:
Positive and negative regulation of granulocyte macrophage colony-stimulating factor promoter activity by AML1-related transcription factor, PEBP2.
Blood
86:607,
1995[Abstract/Free Full Text]
39.
Frank R,
Zhang J,
Meyers S,
Hiebert SW,
Nimer SD:
The AML1/ETO fusion protein blocks transactivation of the GM-CSF promoter by AML1B.
Oncogene
11:2667,
1995[Medline]
[Order article via Infotrieve]
40.
Wargnier A,
Legros-Maida S,
Bosselut R,
Bourge JF,
Lafaurie C,
Ghysdael J,
Sasportes M,
Paul P:
Identification of human granzyme B promoter regulatory elements interacting with activated T-cell-specific proteins: Implication of Ikaros and CBF binding sites in promoter activation.
Proc Natl Acad Sci USA
92:6930,
1995[Abstract/Free Full Text]
41.
Okuda T,
van Deusen J,
Hiebert SW,
Grosveld G,
Downing JR:
AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis.
Cell
84:321,
1996[Medline]
[Order article via Infotrieve]
42.
Sasaki K,
Yagi H,
Bronson RT,
Tominaga K,
Matsunashi T,
Deguchi K,
Tani Y,
Kishimoto T,
Komori T:
Absence of fetal liver hematopoiesis in mice deficient in transcriptional coactivator core binding factor .
Proc Natl Acad Sci USA
93:12359,
1996[Abstract/Free Full Text]
43.
Wang Q,
Stacy T,
Binder M,
Marin-Padilla M,
Sharpe AH,
Speck NA:
Disruption of the Cbfa2 gene causes necrosis and hemorrhaging in the central nervous system and blocks definitive hematopoiesis.
Proc Natl Acad Sci USA
93:3444,
1996[Abstract/Free Full Text]
44.
Wang Q,
Stacy T,
Miller JD,
Lewis AF,
Gu TL,
Huang X,
Bushweller JH,
Bories JC,
Alt FW,
Ryan G,
Liu PP,
Wynshaw-Boris A,
Binder M,
Marin-Padilla M,
Sharpe AH,
Speck NA:
The CBF subunit is essential for CBF 2 (AML1) function in vivo.
Cell
87:697,
1996[Medline]
[Order article via Infotrieve]
45.
Niki M,
Okada H,
Takano H,
Kuno J,
Tani K,
Hibino H,
Asano S,
Ito Y,
Satake M,
Noda T:
Hematopoiesis in the fetal liver is impaired by targeted mutagenesis of a gene encoding a non-DNA binding subunit of the transcription factor, polyomavirus enhancer binding protein 2/core binding factor.
Proc Natl Acad Sci USA
94:5697,
1997[Abstract/Free Full Text]
46.
Negrini M,
Felix CA,
Martin C,
Lange BJ,
Nakamura T,
Canaani E,
Croce CM:
Potential topoisomerase II DNA-binding sites at the breakpoints of a t(9;11) chromosome translocation in acute myeloid leukemia.
Cancer Res
53:4489,
1993[Abstract/Free Full Text]
47.
Gu Y,
Alder H,
Nakamura T,
Schichman SA,
Prasad R,
Canaani O,
Saito H,
Croce CM,
Canaani E:
Sequence analysis of the breakpoint cluster region in the ALL-1 gene involved in acute leukemia.
Cancer Res
54:2327,
1994
48.
Pamela L,
Broeker S,
Super HG,
Thirman MJ,
Pomykala H,
Yonebayashi Y,
Tanabe S,
Zeleznik-Le N,
Rowley JD:
Distribution of 11q23 breakpoints within the MLL breakpoint cluster region in de novo acute leukemia and in treatment-related acute myeloid leukemia: Correlation with scafford attachment regions and topoisomerase II consensus binding sites.
Blood
87:1912,
1996[Abstract/Free Full Text]
49.
Cimino G,
Rapanotti MC,
Biondi A,
Elia L,
Lo Coco F,
Price C,
Rossi V,
Rivoita A,
Canaani E,
Croce CM,
Mandelli F,
Greaves M:
Infant acute leukemia show the same biased distribution of ALL1 gene breaks as topoisomerase II related secondary acute leukemias.
Cancer Res
57:2879,
1997[Abstract/Free Full Text]
50.
Tighe JE,
Calabi F:
t(8;21) breakpoints are clustered between alternatively spliced exons of MTG8.
Clin Sci
89:215,
1995[Medline]
[Order article via Infotrieve]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
E. DE BRAEKELEER, C. FEREC, and M. DE BRAEKELEER
RUNX1 Translocations in Malignant Hemopathies
Anticancer Res,
April 1, 2009;
29(4):
1031 - 1037.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. J. Chyla, I. Moreno-Miralles, M. A. Steapleton, M. A. Thompson, S. Bhaskara, M. Engel, and S. W. Hiebert
Deletion of Mtg16, a Target of t(16;21), Alters Hematopoietic Progenitor Cell Proliferation and Lineage Allocation
Mol. Cell. Biol.,
October 15, 2008;
28(20):
6234 - 6247.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Hamlett, J. Draper, J. Strouboulis, F. Iborra, C. Porcher, and P. Vyas
Characterization of megakaryocyte GATA1-interacting proteins: the corepressor ETO2 and GATA1 interact to regulate terminal megakaryocyte maturation
Blood,
October 1, 2008;
112(7):
2738 - 2749.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Kumar, K. M. Cheney, R. McKirdy, P. M. Neilsen, R. B. Schulz, J. Lee, J. Cohen, G. W. Booker, and D. F. Callen
CBFA2T3-ZNF652 Corepressor Complex Regulates Transcription of the E-box Gene HEB
J. Biol. Chem.,
July 4, 2008;
283(27):
19026 - 19038.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. F. Peterson, M. Yan, and D.-E. Zhang
The p21Waf1 pathway is involved in blocking leukemogenesis by the t(8;21) fusion protein AML1-ETO
Blood,
May 15, 2007;
109(10):
4392 - 4398.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Kumar, J. Manning, H. E. Spendlove, G. Kremmidiotis, R. McKirdy, J. Lee, D. N. Millband, K. M. Cheney, M. R. Stampfer, P. P. Dwivedi, et al.
ZNF652, A Novel Zinc Finger Protein, Interacts with the Putative Breast Tumor Suppressor CBFA2T3 to Repress Transcription
Mol. Cancer Res.,
September 1, 2006;
4(9):
655 - 665.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. L. Brown, C. R. Wilkinson, S. R. Waterman, C. H. Kok, D. G. Salerno, S. M. Diakiw, B. Reynolds, H. S. Scott, A. Tsykin, G. F. Glonek, et al.
Genetic regulators of myelopoiesis and leukemic signaling identified by gene profiling and linear modeling
J. Leukoc. Biol.,
August 1, 2006;
80(2):
433 - 447.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. H. Schuh, A. J. Tipping, A. J. Clark, I. Hamlett, B. Guyot, F. J. Iborra, P. Rodriguez, J. Strouboulis, T. Enver, P. Vyas, et al.
ETO-2 Associates with SCL in Erythroid Cells and Megakaryocytes and Provides Repressor Functions in Erythropoiesis
Mol. Cell. Biol.,
December 1, 2005;
25(23):
10235 - 10250.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Amann, B. J. I. Chyla, T. C. Ellis, A. Martinez, A. C. Moore, J. L. Franklin, L. McGhee, S. Meyers, J. E. Ohm, K. S. Luce, et al.
Mtgr1 Is a Transcriptional Corepressor That Is Required for Maintenance of the Secretory Cell Lineage in the Small Intestine
Mol. Cell. Biol.,
November 1, 2005;
25(21):
9576 - 9585.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Ishizuka and M. A. Lazar
The Nuclear Receptor Corepressor Deacetylase Activating Domain Is Essential for Repression by Thyroid Hormone Receptor
Mol. Endocrinol.,
June 1, 2005;
19(6):
1443 - 1451.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. G. Giresi, E. J. Stevenson, J. Theilhaber, A. Koncarevic, J. Parkington, R. A. Fielding, and S. C. Kandarian
Identification of a molecular signature of sarcopenia
Physiol Genomics,
April 14, 2005;
21(2):
253 - 263.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. A. Nguyen, P. P. Pandolfi, Y. Aikawa, Y. Tagata, M. Ohki, and I. Kitabayashi
Physical and functional link of the leukemia-associated factors AML1 and PML
Blood,
January 1, 2005;
105(1):
292 - 300.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Ibanez, A. Sharma, S. Buonamici, A. Verma, S. Kalakonda, J. Wang, S. Kadkol, and Y. Saunthararajah
AML1-ETO Decreases ETO-2 (MTG16) Interactions with Nuclear Receptor Corepressor, an Effect That Impairs Granulocyte Differentiation
Cancer Res.,
July 1, 2004;
64(13):
4547 - 4554.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-Y. Cho, Y. Akbarali, L. F. Zerbini, X. Gu, J. Boltax, Y. Wang, P. Oettgen, D.-E. Zhang, and T. A. Libermann
Isoforms of the Ets Transcription Factor NERF/ELF-2 Physically Interact with AML1 and Mediate Opposing Effects on AML1-mediated Transcription of the B Cell-specific blk Gene
J. Biol. Chem.,
May 7, 2004;
279(19):
19512 - 19522.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Chevallier, C. M. Corcoran, C. Lennon, E. Hyjek, A. Chadburn, V. J. Bardwell, J. D. Licht, and A. Melnick
ETO protein of t(8;21) AML is a corepressor for Bcl-6 B-cell lymphoma oncoprotein
Blood,
February 15, 2004;
103(4):
1454 - 1463.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Li, J. Yan, C. J. Matheny, T. Corpora, J. Bravo, A. J. Warren, J. H. Bushweller, and N. A. Speck
Energetic Contribution of Residues in the Runx1 Runt Domain to DNA Binding
J. Biol. Chem.,
August 29, 2003;
278(35):
33088 - 33096.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Barseguian, B. Lutterbach, S. W. Hiebert, J. Nickerson, J. B. Lian, J. L. Stein, A. J. van Wijnen, and G. S. Stein
Multiple subnuclear targeting signals of the leukemia-related AML1/ETO and ETO repressor proteins
PNAS,
November 26, 2002;
99(24):
15434 - 15439.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kochetkova, O. L. D. McKenzie, A. J. Bais, J. M. Martin, G. A. Secker, R. Seshadri, J. A. Powell, S. J. Hinze, A. E. Gardner, H. E. Spendlove, et al.
CBFA2T3 (MTG16) Is a Putative Breast Tumor Suppressor Gene from the Breast Cancer Loss of Heterozygosity Region at 16q24.3
Cancer Res.,
August 15, 2002;
62(16):
4599 - 4604.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Zhang, P. Strissel, R. Strick, J. Chen, G. Nucifora, M. M. Le Beau, R. A. Larson, and J. D. Rowley
Genomic DNA breakpoints in AML1/RUNX1 and ETO cluster with topoisomerase II DNA cleavage and DNase I hypersensitive sites in t(8;21) leukemia
PNAS,
February 20, 2002;
(2002)
42702899.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. V. Schillace, S. F. Andrews, G. A. Liberty, M. P. Davey, and D. W. Carr
Identification and Characterization of Myeloid Translocation Gene 16b as a Novel A Kinase Anchoring Protein in T Lymphocytes
J. Immunol.,
February 15, 2002;
168(4):
1590 - 1599.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Amann, J. Nip, D. K. Strom, B. Lutterbach, H. Harada, N. Lenny, J. R. Downing, S. Meyers, and S. W. Hiebert
ETO, a Target of t(8;21) in Acute Leukemia, Makes Distinct Contacts with Multiple Histone Deacetylases and Binds mSin3A through Its Oligomerization Domain
Mol. Cell. Biol.,
October 1, 2001;
21(19):
6470 - 6483.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Yuan, L. Zhou, T. Miyamoto, H. Iwasaki, N. Harakawa, C. J. Hetherington, S. A. Burel, E. Lagasse, I. L. Weissman, K. Akashi, et al.
AML1-ETO expression is directly involved in the development of acute myeloid leukemia in the presence of additional mutations
PNAS,
August 28, 2001;
98(18):
10398 - 10403.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Burel, N. Harakawa, L. Zhou, T. Pabst, D. G. Tenen, and D.-E. Zhang
Dichotomy of AML1-ETO Functions: Growth Arrest versus Block of Differentiation
Mol. Cell. Biol.,
August 15, 2001;
21(16):
5577 - 5590.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Miller, T. Stacy, P. P. Liu, and N. A. Speck
Core-binding factor {beta} (CBF{beta}), but not CBF{beta}-smooth muscle myosin heavy chain, rescues definitive hematopoiesis in CBF{beta}-deficient embryonic stem cells
Blood,
April 15, 2001;
97(8):
2248 - 2256.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Hromas, T. Busse, A. Carroll, D. Mack, R. Shopnick, D.-E. Zhang, H. Nakshatri, and K. Richkind
Fusion AML1 transcript in a radiation-associated leukemia results in a truncated inhibitory AML1 protein
Blood,
April 1, 2001;
97(7):
2168 - 2170.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Zhang, B. A. Hug, E. Y. Huang, C. W. Chen, V. Gelmetti, M. Maccarana, S. Minucci, P. G. Pelicci, and M. A. Lazar
Oligomerization of ETO Is Obligatory for Corepressor Interaction
Mol. Cell. Biol.,
January 1, 2001;
21(1):
156 - 163.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. D. Wood, F. C. Nucifora Jr., K. Duan, C. Zhang, J. Wang, Y. Kim, G. Schilling, N. Sacchi, J. M. Liu, and C. A. Ross
Atrophin-1, the Dentato-Rubral and Pallido-Luysian Atrophy Gene Product, Interacts with Eto/Mtg8 in the Nuclear Matrix and Represses Transcription
J. Cell Biol.,
September 4, 2000;
150(5):
939 - 948.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Shimada, H. Ichikawa, S. Nakamura, R. Katsu, M. Iwasa, I. Kitabayashi, and M. Ohki
Analysis of genes under the downstream control of the t(8;21) fusion protein AML1-MTG8: overexpression of the TIS11b (ERF-1, cMG1) gene induces myeloid cell proliferation in response to G-CSF
Blood,
July 15, 2000;
96(2):
655 - 663.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Okuda, K. Takeda, Y. Fujita, M. Nishimura, S. Yagyu, M. Yoshida, S. Akira, J. R. Downing, and T. Abe
Biological Characteristics of the Leukemia-Associated Transcriptional Factor AML1 Disclosed by Hematopoietic Rescue of AML1-Deficient Embryonic Stem Cells by Using a Knock-in Strategy
Mol. Cell. Biol.,
January 1, 2000;
20(1):
319 - 328.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
B. Lutterbach, Y. Hou, K. L. Durst, and S. W. Hiebert
The inv(16) encodes an acute myeloid leukemia 1 transcriptional corepressor
PNAS,
October 26, 1999;
96(22):
12822 - 12827.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. J. Michelson, M. W. Collard, A. J. Ziemba, J. Persinger, B. Bartholomew, and J. I. Huggenvik
Nuclear DEAF-1-related (NUDR) Protein Contains a Novel DNA Binding Domain and Represses Transcription of the Heterogeneous Nuclear Ribonucleoprotein A2/B1 Promoter
J. Biol. Chem.,
October 22, 1999;
274(43):
30510 - 30519.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Fenrick, J. M. Amann, B. Lutterbach, L. Wang, J. J. Westendorf, J. R. Downing, and S. W. Hiebert
Both TEL and AML-1 Contribute Repression Domains to the t(12;21) Fusion Protein
Mol. Cell. Biol.,
October 1, 1999;
19(10):
6566 - 6574.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. F. Lewis, T. Stacy, W. R. Green, L. Taddesse-Heath, J. W. Hartley, and N. A. Speck
Core-Binding Factor Influences the Disease Specificity of Moloney Murine Leukemia Virus
J. Virol.,
July 1, 1999;
73(7):
5535 - 5547.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
B. Lutterbach, J. J. Westendorf, B. Linggi, A. Patten, M. Moniwa, J. R. Davie, K. D. Huynh, V. J. Bardwell, R. M. Lavinsky, M. G. Rosenfeld, et al.
ETO, a Target of t(8;21) in Acute Leukemia, Interacts with the N-CoR and mSin3 Corepressors
Mol. Cell. Biol.,
December 1, 1998;
18(12):
7176 - 7184.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
D. Roulston, R. Espinosa III, G. Nucifora, R. A. Larson, M. M. Le Beau, and J. D. Rowley
CBFA2(AML1) Translocations With Novel Partner Chromosomes in Myeloid Leukemias: Association With Prior Therapy
Blood,
October 15, 1998;
92(8):
2879 - 2885.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-Y. Tang, J. Shi, L. Zhang, A. Davis, J. Bravo, A. J. Warren, N. A. Speck, and J. H. Bushweller
Energetic and Functional Contribution of Residues in the Core Binding Factor beta (CBFbeta ) Subunit to Heterodimerization with CBFalpha
J. Biol. Chem.,
December 8, 2000;
275(50):
39579 - 39588.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Zhang, P. Strissel, R. Strick, J. Chen, G. Nucifora, M. M. Le Beau, R. A. Larson, and J. D. Rowley
Genomic DNA breakpoints in AML1/RUNX1 and ETO cluster with topoisomerase II DNA cleavage and DNase I hypersensitive sites in t(8;21) leukemia
PNAS,
March 5, 2002;
99(5):
3070 - 3075.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|