| |
|
|
|
|
|
|
|||
|
Blood, Vol. 91 No. 11 (June 1), 1998:
pp. 4028-4037
By
From the Radiobiology Division, National Cancer Center Research
Institute, Tokyo; Division of Hematology, Department of Medicine,
Yamaguchi Prefecture Central Hospital, Yamaguchi; Department of
Pediatrics, Faculty of Medicine, University of Tokyo, Tokyo; Kazusa DNA
Research Institute, Chiba; and the Center for Molecular Biology and
Cytogenetics, SRL, Inc, Tokyo, Japan.
The t(16;21)(q24;q22) translocation is a rare but recurrent
chromosomal abnormality associated with therapy-related myeloid malignancies and a variant of the t(8;21) translocation in which the
AML1 gene on chromosome 21 is rearranged. Here we report the molecular definition of this chromosomal aberration in four patients. We cloned cDNAs from the leukemic cells of a patient carrying t(16;21)
by the reverse transcription polymerase chain reaction using an
AML1-specific primer. The structural analysis of the cDNAs
showed that AML1 was fused to a novel gene named MTG16
(Myeloid Translocation Gene on chromosome
16) which shows high homology to MTG8
(ETO/CDR) and MTGR1. Northern blot analysis using
MTG16 probes mainly detected 4.5 kb and 4.2 kb RNAs, along with
several other minor RNAs in various human tissues. As in t(8;21), the t(16;21) breakpoints occurred between the exons 5 and 6 of
AML1, and between the exons 1 and 2 or the exons 3 and 4 of
MTG16. The two genes are fused in-frame, resulting in the
characteristic chimeric transcripts of this translocation. Although the
reciprocal chimeric product, MTG16-AML1, was also detected in
one of the t(16;21) patients, its protein product was predicted to be
truncated. Thus, the AML1-MTG16 gene fusion in t(16;21)
leukemia results in the production of a protein that is very similar to
the AML1-MTG8 chimeric protein.
SPECIFIC CHROMOSOMAL translocations are
frequently found in hematopoietic malignant tumors and some types of
solid tumors.1 Molecular analysis of the chromosomal
translocations of leukemia has shown rearrangements of genes involved
in the programmed regulation of proliferation and differentiation
during hematopoietic development. In many myeloid leukemias,
chromosomal alterations have been shown to result in the production of
unusual chimeric proteins.2,3
A number of different and recurring aberrations involving chromosomal
band 21q22 have been observed in human acute myeloid leukemia (AML),
myelodysplastic syndrome (MDS), and the blast crisis phase of chronic
myelogenous leukemia (CML). Previously, we cloned the AML1 gene
on chromosome 21q22 from patients with the t(8;21)
translocation4 which occurs frequently (approximately 40%)
in subtype M2 of AML.5 It was shown that the AML1
gene is the most frequent target of chromosome translocations in human leukemia.6 In the t(8;21) translocation, the AML1
gene was shown to be juxtaposed to the gene which encodes a zinc
finger-containing protein, MTG8 (ETO/CDR), on
chromosome 8q22, resulting in the expression of AML1-MTG8 chimeric
proteins.7-10 In addition, the AML1 gene was found
to be fused with the TEL gene, which encodes a member of the
Ets family of transcription factors, to form a TEL-AML1 chimeric
product by the t(12;21) translocation.11,12 The resultant
chimeric transcripts are detected in pediatric B-cell progenitor acute
lymphoblastic leukemia, the most common form of leukemia observed in
children. Furthermore, AML1-containing fusion products are formed by
the t(3;21) translocation which occurs in MDS and in the blast crisis
phase of CML.13-17
Shimada et al18 have previously shown that a cosmid clone
covering the region spanning exons 5 and 6 of the AML1 gene is split in fluorescence in situ hybridization (FISH) analysis of leukemic
cells with t(16;21)(q24;q22) translocation. This is where the
translocation breakpoints of t(8;21) AML are clustered. We therefore
isolated the partner gene of AML1 by asymmetric polymerase chain reaction (PCR) using AML1-specific primers. The
results show that the AML1 gene is juxtaposed to a novel gene,
MTG16, on chromosome 16. Isolation and characterization of the
wild-type MTG16 cDNA showed that MTG16 is another member of the
MTG8 family of proteins, which display a high degree of sequence
similarity. The AML1-MTG16 chimeric protein shares several structural
features with AML1-MTG8, including the presence of the AML1 runt domain and the four evolutionary conserved motifs of MTG8.
Patient samples.
Leukemia cells with t(16;21)(q24;q22) translocation were obtained from
four patients suffering from malignant myeloid diseases. The clinical
and cytogenetic data of the patients have been reported previously.18,19 One patient (no. 1) had a non-Hodgkin
malignant lymphoma, but after receiving cytotoxic chemotherapy
developed therapy-related AML in the absence of MDS. Two patients who
had lung (no. 2) or oviductal (no. 3) cancer as their primary
malignancies received cytotoxic chemotherapy. They were diagnosed as
being in the transitional stage from therapy-related MDS to AML M2. One
patient (no. 4) had de novo hypoplastic MDS.
Cloning of chimeric cDNA.
Total RNA was isolated from the peripheral lymphocytes of patient no. 1 by the acid guanidium thiocyanate/phenol/chloroform method.20 The poly(A)+ RNA was purified from
total RNA using oligotex-dT30 (Daiichi kagaku-yakuhin,
Tokyo, Japan). The cDNA was synthesized with random hexamer primers
using the Marathon cDNA Synthesis Kit (Clontech, Palo Alto,
CA) and was ligated with a cDNA adaptor according to the
manufacturer's instruction. The fragments containing the chimeric cDNA
were amplified by the asymmetric PCR method using an AML1 exon
5-specific primer, AMLex5f1 (CCACCTACCACAGAGCCATCAAAA) and adaptor-specific primers AP1 and/or AP2. PCR amplification was performed for a total of 35 cycles (94°C for 1 minute, 5 cycles of
94°C for 5 seconds, and 72°C for 4 minutes; 5 cycles of 94°C for
5 seconds, and 70°C for 4 minutes; and 25 cycles of 94°C for 5 seconds, and 68°C for 4 minutes) in a Gene Amp PCR system 9600 (Perkin-Elmer Japan, Chiba, Japan). Amplified fragments
were size-fractionated by low melting temperature agarose gel
electrophoresis and were cloned in a plasmid vector, pGEM-T
Easy (Promega, Madison, WI). The AML1 exon 5- and exon
6-specific fragments were isolated using PCR primers AML1C
(GAGGGAAAAGCTTCACTCTG) and AMLP (TTCGAGGTTCTCGGGGCCC), and ABF
(GACATCGGCAGAAACTAGAT) and ABR (CCTGCATCTGACTCTGAGGC), respectively,
and labeled with 32P using the Multiprime DNA labeling
system (Amersham, Buckinghamshire, UK). Positive
AML1 exon 5 and negative AML1 exon 6 clones were selected by colony hybridization of the transformants. DNA sequencing was performed using the PRISM dye-terminator FS cycle sequencing kit
and a ABI PRISM 377 DNA Sequencer (Perkin-Elmer Japan).
cDNA cloning.
To isolate the entire MTG16 cDNA sequence, a human adult brain
cDNA library21 and a human immature myeloid cell line,
KG-1, cDNA library22 were screened with the PCR-amplified
fragment prepared using primers MTG16f1 (TGATGAACGGCAGCAGCCACTCAC) and MTG16-2 (CGTCAATGTCGAGTTCACCAGGCC).
Reverse transcription (RT)-PCR and primers.
From 1 µg of poly(A)+ RNA or total RNA of peripheral
blood from patients and normal individuals, cDNAs were synthesized with random hexamer primers and reverse transcriptase using the Superscript Preamplification System (GlBCO-BRL, Rockville, MD). The
reaction was diluted 20-fold and 0.5 µL was used for PCR. PCR
amplification was performed for 35 cycles (94°C for 30 seconds,
58°C for 60 seconds, and 72°C for 60 seconds), followed by
denaturation at 94°C for 3 minutes and extension at 72°C for 10 minutes. PCR products were separated by electrophoresis through a
1% Sea Plaque GTG agarose gel (FMC,
Rockland, ME) in 1× TAE (Tris-acetate/EDTA electrophoresis buffer). Fragments were excised from the gel and
sequenced directly. PCR primers for the AML1 and MTG16
were designed according to the known cDNA sequences as follows:
AMLex5f1 shown above, AMLex4f2 (GATGGCTGGCAATGATGAAAACTACTCG), AMLex6r2
(ACTCTGAGGCTGAGGGTTAAAGGCAGTG), MTG16r2 (GTTCTCGTTGACTTCCAGTAGCAG),
and MF1 (GTGAAGACGCAGCCCCG).
Genomic cloning.
A P1 library of the total human genome (Du Pont,
Wilmington, DE) was screened by the PCR method as
described.23 Two P1 clones, P24H2 and P122F9, were isolated
using PCR primers MTG16f8 (CGTCTCCATATGTGTAGGAAAGGAC) and MTG16r6
(CTATGTACACGGTCAGGGTCTTCC). The P1 clone P70A4 was isolated using PCR
primers P122F9S-F1 (CTCTGCCTGGGATGATCC) and P122F9S-R
(TCTGGCTGACCTGTCTTCG) obtained from the SP6-end sequence of P122F9. The
location of exons was determined by restriction mapping and Southern
blot analysis of P1 clones using various parts of MTG16 cDNA as
probes. The exon-intron boundaries of the gene were determined by the
direct sequencing of PCR-amplified fragments or subclones using primers
taken from the cDNA sequence.
FISH.
P1 clones were labeled with biotin-16-dUTP and/or
digoxigenin-11-dUTP by nick translation. Hybridization to metaphase
cells was performed as described previously.24 The nuclear
DNA was counter stained with 4,6-diamidino-2-phenylindole
(DAPI).
Southern blot analysis.
Genomic DNAs were isolated from patient no. 1 and from a human normal
lymphocyte cell line, C496. The DNAs were digested with EcoR1,
separated by electrophoresis on an agarose gel, and transferred to
NyTRAN 0,45 membrane (Schleicher & Schuell, Dassel,
Germany). The PCR-amplified product (434 bp) obtained
using primers 124r5R1 (AACAGTGCTGCCAGAACG) and MTG16r5
(CAGACCATAGACCATTTTAAGCAGCC), and the EagI-EcoRI
restricted 2-kb fragment were used as probes. Hybridizations were
performed at 42°C under stringent conditions. The final washing was
in 0.1× standard saline citrate (SSC)/0.1% sodium
dodecyl sulfate (SDS) at 65°C. Autoradiography was performed using a
bioimage analyzer, Fujix BAS2000 (Fuji shashin film,
Tokyo, Japan).
Northern blot analysis.
Membranes containing Poly(A)+ RNA from a wide variety of
human tissues were purchased from Clontech. Hybridization and
autoradiography were performed as for Southern blot analysis.
Cloning of fusion cDNA from a patient with t(16;21).
Because it was shown by FISH analysis18 that the
AML1 gene is split in a region spanning exons 5 and 6 in
t(16;21)(q24;q22) translocation, we performed asymmetric PCR using an
AML1 exon 5-specific primer, AMLex5f1, to obtain the fusion
cDNA. The fusion cDNA obtained from patient no. 1 shows that the 5 Cloning and characterization of the wild-type MTG16 gene.
The wild-type MTG16 cDNA clones were isolated from the cDNA
libraries of a human adult brain and a KG-1 myeloid cell line using the
novel, partial sequence of MTG16 as a probe. Nucleotide sequence analysis of seven overlapping clones identified two types of
composite cDNA sequences, named MTG16a and MTG16b,
which differ in the sequences of their 5
Genomic organization of MTG16 gene.
The genomic clones P24H2 and P122F9 were isolated from a human genomic
P1 library using the PCR primers specific to the 3
Expression of the AML1-MTG16 fusion gene in t(16;21) AML
patients.
The expression of AML1, MTG16, AML1-MTG16, and MTG16-AML1 was examined
by RT-PCR method using total RNA isolated from the peripheral blood of
t(16;21) patients and a normal control. AML1 and MTG16
were detected with the expected product size in both the t(16;21)
patients and normal individuals (Fig 5C and
D). On the other hand, AML1-MTG16 chimera was detected as a
product of 545 bp in three t(16;21) AML patients (no. 1, 2, and 3) and
as a product of 773 bp in patient no. 4 using AMLex5f1 and MTG16r2 primers (Fig 5A). Sequence analysis of the PCR-amplified chimeric AML1-MTG16 fragments indicated that three of the four patients (no. 1, 2, and 3) had breaks between exon 3 and exon 4 (type 1), and
that one patient (no. 4) had a break between exon 1 and exon 2 of
MTG16 (type 2) (Fig 6). The
predicted products of AML1-MTG16 would be 704 amino acids (type
1) and 780 amino acids (type 2) in length.
FISH analysis and detection of genomic rearrangements.
To confirm the rearrangements of the MTG16 gene in t(16;21)
patients, FISH analysis and Southern blot analysis were performed using
the genomic P1 clone, P122F9 and P24H2, or DNA fragments derived from
P122F9. The location of P122F9 on chromosome 16q24 of a
normal human individual was confirmed by metaphase FISH (Fig 7B). On
the other hand, P122F9 signals were detected as triple signals in the
t(16;21)(q24;q22) patient (no. 3) (Fig 7A).
P24H2 containing the 3
In this study, we analyzed the translocation breakpoint in
t(16;21)(q24;q22) and identified a novel fusion gene consisting of a
partial sequence from AML1 on chromosome 21 and MTG16
on chromosome 16. The t(16;21)(q24;q22) translocation is a rare but recurrent chromosomal abnormality associated with therapy-related AML
or MDS.18,19,29 Sequence analysis of MTG16 cDNA
revealed two alternative splicing iso-forms, termed MTG16a and
MTG16b, which contain different 5 Submitted February 17, 1998;
accepted March 12, 1998.
We are grateful to Dr T. Matsumoto and Dr K. Matsushita of Imamura
Hospital, and Dr T. Shimizu of Isehara Kyodo Hospital for providing
patient samples. We thank Kazusa DNA Research Institute Foundation for
support to a cDNA Research Program.
1.
Rabbitts TH:
Chromosomal translocations in human cancer.
Nature
372:143,
1994[Medline]
[Order article via Infotrieve]
2.
Barr Fg:
The malevolence of matchmaking.
Nat Genet
12:113,
1996[Medline]
[Order article via Infotrieve]
3.
Pedersen-Bjergaad J,
Rowley JD:
The balanced and the unbalanced chromosome aberrations of acute myeloid leukemia may develop in different ways and may contribute differently to malignant transformation.
Blood
83:2780,
1994
4.
Miyoshi H,
Shimizu K,
Kozu T,
Maseki N,
Kaneko Y,
Ohki M:
t(8;21) breakpoints on chromosome 21 in acute myeloid leukemia are clustered within a limited region of a single gene, AML1.
Proc Natl Acad Sci USA
88:10431,
1991
5.
Mitelman F,
Heim S:
Quantitative acute leukemia cytogenetics.
Genes Chromosomes Cancer
5:57,
1992[Medline]
[Order article via Infotrieve]
6.
Nucifora G,
Rowley JD:
AML1 and the 8;21 and 3;21 translocations in acute and chronic myeloid leukemia.
Blood
86:1,
1995
7.
Miyoshi H,
Kozu T,
Shimizu K,
Enomoto K,
Maseki N,
Kaneko Y,
Kamada N,
Ohki M:
The t(8;21) translocation in acute myeloid leukemia results in production of an AML1-MTG8 fusion transcript.
EMBO J
12:2715,
1993[Medline]
[Order article via Infotrieve]
8.
Kozu T,
Miyoshi H,
Shimizu K,
Maseki N,
Kaneko Y,
Asou H,
Kamada N,
Ohki M:
Junction of the AML1/MTG8(ETO) fusion are constant in t(8;21) acute myeloid leukemia detected by reverse transcription polymerase chain reaction.
Blood
82:1270,
1993
9.
Erickson P,
Gao J,
Chang KS,
Look T,
Whisenant E,
Raimondi S,
Lasher R,
Trujillo J,
Rowley J,
Drabkin H:
Identification of breakpoints in t(8;21) acute myelogenous leukemia and isolation of a fusion transcript, AML1/ETO, with similarity to Drosophila segmentation gene, runt.
Blood
80:1825,
1992
10.
Nisson PE,
Watkins PC,
Sacchi N:
Transcriptionally active chimeric gene derived from the fusion of the AML1 gene and a novel gene on chromosome 8 in t(8;21) leukemic cells.
Cancer Genet Cytogenet
63:81,
1992[Medline]
[Order article via Infotrieve]
11.
Golub TR,
Barker GF,
Bohlander SK,
Hiebert SW,
Ward DC,
Bray-Ward P,
Morgan E,
Raimondi SC,
Rowley JD,
Gilliland DG:
Fusion of the TEL gene on 12p13 to the AML1 gene on 21q22 in acute lymphoblastic leukemia.
Proc Natl Acad Sci USA
92:4917,
1995
12.
Romana SP,
Mauchauffe M,
Le Coniet M,
Chumakov I,
Le Paslier D,
Berger R,
Bernard OA:
The t(12;21) of acute lymphoblastic leukemia results in a TEL-AML1 gene fusion.
Blood
85:3662,
1995
13.
Rubin CM,
Larson RA,
Anastasi J,
Winter JN,
Thangavelu M,
Vardiman J,
Rowley JD,
LeBeau MM:
t(3;21)(q26;q22): A recurring chromosomal abnormality in therapy-related myelodysplastic syndrome and acute myeloid leukemia.
Blood
76:2594,
1990
14.
Nucifora G,
Birn DJ,
Espinosa R III,
Erickson P,
LeBeau MM,
Roulston D,
McKeithan TW,
Drabkin H,
Rowley JD:
Involvement of the AML1 gene in the t(3;21) in therapy-related leukemia and in chronic myeloid leukemia in blast crisis.
Blood
81:2728,
1993
15.
Nucifora G,
Begy CR,
Erickson P,
Drabkin HA,
Rowley JD:
The 3;21 translocation in myelodysplasia results in a fusion transcript between the AML1 gene and the gene for EAP, a highly conserved protein associated with the Epstein-Barr virus small RNA EBER 1.
Proc Natl Acad Sci USA
90:7784,
1993
16.
Mitani K,
Ogawa S,
Tanaka T,
Miyoshi H,
Kurokawa M,
Mano H,
Yazaki Y,
Ohki M,
Hirai H:
Generation of the AML1-EVI-1 fusion gene in the t(3;21)(q26;q22) causes blastic crisis in chronic myelocytic leukemia.
EMBO J
13:504,
1994[Medline]
[Order article via Infotrieve]
17.
Nucifora G,
Begy CR,
Kobayashi H,
Roulston D,
Claxton D,
Pedersen-Bjergaad J,
Parganas E,
Ihle JN,
Rowley JD:
Consistent intergenic splicing and production of multiple transcripts between AML1 at 21q22 and unrelated genes at 3q26 in (3;21)(q26;q22) translocations.
Proc Natl Acad Sci USA
91:4004,
1994
18.
Shimada M,
Ohtsuka E,
Shimizu T,
Matsumoto T,
Matsushita K,
Tanimoto F,
Kajii T:
A recurrent translocation, t(16;21)(q24;q22), associated with acute myelogenous Leukemia: Identification by fluorescence in situ hybridization.
Cancer Genet Cytogenet
96:102,
1997[Medline]
[Order article via Infotrieve]
19. Takeda K, Shinohara K, Kameda N, Ariyoshi K: A case of
therapy-related acute myeloblastic leukemia with t(16;21)(q24;q22) after chemotherapy with DNA topoisomerase II inhibitors, etoposide and
mitoxantrone, and the alkylating agent, cyclophosphamide. Int J Hematol
(in press)
20.
Chomczynski P,
Sacchi N:
Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chroloform extraction.
Anal Biochem
162:156,
1987[Medline]
[Order article via Infotrieve]
21.
Ohara O,
Nagase T,
Ishikawa K,
Nakajima D,
Ohira M,
Seki N,
Nomura N:
Construction and characterization of human brain cDNA libraries suitable for analysis of cDNA clones encoding relatively large proteins.
DNA Res
4:53,
1997[Abstract]
22.
Nomura N,
Miyajima N,
Sazuka T,
Tanaka A,
Kawarabayashi Y,
Sato S,
Nagase T,
Seki N,
Ishikawa K,
Tabata S:
Prediction of the coding sequences of unidentified human genes. I. The coding sequences of 40 new genes (KIAA0001-KIAA0040) deduced by analysis of randomly sampled cDNA clones from human immature myeloid cell line KG-1.
DNA Res
1:27,
1994
23.
Ohira M,
Ichikawa H,
Suzuki E,
Iwaki M,
Suzuki K,
Saito-Ohara F,
Ikeuchi T,
Chumakov I,
Tanahashi H,
Tashiro K,
Sakaki Y,
Ohki M:
A 1.6-Mb P1-based physical map of the down syndrome region on chromosome 21.
Genomics
33:65,
1996[Medline]
[Order article via Infotrieve]
24.
Kallioniemi A,
Kallioniemi O-P,
Sudar D,
Rutovitz D,
Gray JW,
Waldman F,
Pinkel D:
Comparative genomic hybridization for molecular cytogenetic analysis of solid tumors.
Science
258:818,
1992
25.
Miyoshi H,
Ohira M,
Shimizu K,
Mitani K,
Hirai H,
Imai T,
Yokoyama K,
Soeda E,
Ohki M:
Alternative splicing and genomic structure of the AML1 gene involved in acute myeloid leukemia.
Nucleic Acids Res
23:2762,
1995
26.
Kitabayashi I,
Ida K,
Morohoshi F,
Yokoyama A,
Mitsuhashi N,
Shimizu K,
Nomura N,
Hayashi Y,
Ohki M:
The AML1-MTG8 leukemic fusion protein forms a complex with a novel member of the MTG(ETO/CDR) family, MTGR1.
Mol Cell Biol
18:846,
1998
27.
Feinstein PG,
Kornfeld K,
Hogness DS,
Mann RS:
Identification of homeotic target genes in Drosophila melanogaster including nervy, a proto-oncogene homologue.
Genetics
140:573,
1995[Abstract]
28.
Shapiro MB,
Senapathy P:
RNA splice junctions of different classes of eukaryotes: Sequence statistics and functional implications in gene expression.
Nucleic Acids Res
15:7155,
1987
29.
Berger R,
Coniat ML,
Romana SP,
Jonveaux P:
Secondary acute myeloblastic leukemia with t(16;21)(q24;q22) involving the AML1 gene.
Hematol Cell Ther
38:183,
1996 [Medline]
[Order article via Infotrieve]
30.
Ogawa E,
Maruyama M,
Kagoshima H,
Inuzuka M,
Lu J,
Satake M,
Shigesada K,
Ito Y:
PEBP2/PEA2 represents a family of transcription factors homologous to the products of the Drosophila runt gene and the human AML1 gene.
Proc Natl Acad Sci USA
90:6859,
1993
31.
Ogawa E,
Inuzuka M,
Maruyama M,
Satake M,
NAito-Fujimoto M,
Ito Y,
Shigesada K:
Molecular cloning and characterization of PEBP2
32.
Wang S,
Wang Q,
Crute BE,
Melnikova IN,
Keller SR,
Speck NA:
Cloning and characterization of subunits of the T-cell receptor and murine leukemia virus enhancer core-binding factor.
Mol Cell Biol
13:3324,
1993
33.
Mayers S,
Dowing JR,
Hiebert SW:
Identification of AML-1 and the (8;21) translocation protein (AML1-1/ETO) as sequence-specific DNA-binding proteins: The runt homology domain is required for DNA binding and protein-protein interactions.
Mol Cell Biol
13:6336,
1993
34.
Prosser HM,
Wotton D,
Gegonne A,
Ghysdael J,
Wang S,
Speck NA,
Owen MJ:
A phorbol ester response element within the human T-cell receptor
35.
Redondo JM,
Pfohl JL,
Hernandez-Munain C,
Wang S,
Speck NA,
Krangel MS:
Indistinguishable nuclear factor binding to functional core sites of the T-cell receptor
36.
Zhang DE,
Fujioka K,
Hetherington CJ,
Shapiro LH,
Chen HM,
Look AT,
Tenen DG:
Identification of a region which directs the monocytic activity of the colony-stimulating factor 1 (macrophage colony-stimulating factor) receptor promoter and binds PEBP2/CBF (AML1).
Mol Cell Biol
14:8085,
1994
37.
Nuchprayoon I,
Meyers S,
Scott LM,
Suzow J,
Hiebert S,
Friedman AD:
PEBP2/CBF, the murine homolog of the human myeloid AML1 and PEBP2
38.
Takahashi A,
Satake M,
Yamaguchi-Iwai Y,
Bae SC,
Lu J,
Maruyama M,
Zhang YM,
Oka H,
Arai N,
Arai K,
Ito Y:
Positive and negative regulation of granulocyte macrophage colony-stimulating factor promoter activity by AML1-related transcription factor, PEBP2.
Blood
86:607,
1995
39.
Frank R,
Zhang J,
Meyers S,
Hiebert SW,
Nimer SD:
The AML1/ETO fusion protein blocks transactivation of the GM-CSF promoter by AML1B.
Oncogene
11:2667,
1995[Medline]
[Order article via Infotrieve]
40.
Wargnier A,
Legros-Maida S,
Bosselut R,
Bourge JF,
Lafaurie C,
Ghysdael J,
Sasportes M,
Paul P:
Identification of human granzyme B promoter regulatory elements interacting with activated T-cell-specific proteins: Implication of Ikaros and CBF binding sites in promoter activation.
Proc Natl Acad Sci USA
92:6930,
1995
41.
Okuda T,
van Deusen J,
Hiebert SW,
Grosveld G,
Downing JR:
AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis.
Cell
84:321,
1996[Medline]
[Order article via Infotrieve]
42.
Sasaki K,
Yagi H,
Bronson RT,
Tominaga K,
Matsunashi T,
Deguchi K,
Tani Y,
Kishimoto T,
Komori T:
Absence of fetal liver hematopoiesis in mice deficient in transcriptional coactivator core binding factor |