Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Haneline, L. S.
Right arrow Articles by Clapp, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Haneline, L. S.
Right arrow Articles by Clapp, D. W.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 91 No. 11 (June 1), 1998: pp. 4092-4098

Multiple Inhibitory Cytokines Induce Deregulated Progenitor Growth and Apoptosis in Hematopoietic Cells From Facminus /minus Mice

By Laura S. Haneline, Hal E. Broxmeyer, Scott Cooper, Giao Hangoc, Madeleine Carreau, Manuel Buchwald, and D. Wade Clapp

From the Department of Pediatrics, Herman B Wells Center for Pediatric Research, Indiana University School of Medicine; the Department of Microbiology/Immunology, Indiana University School of Medicine; Walther Oncology Center, Indiana University School of Medicine, Indianapolis; Walther Cancer Institute, Indianapolis, IN; the Department of Genetics, Hospital for Sick Children, Toronto, Ontario, Canada; and the Department of Molecular and Medical Genetics, University of Toronto, Toronto, Ontario, Canada.


    ABSTRACT
Abstract
Introduction
Methods
Results
Discussion
References

We used a murine model containing a disruption of the murine homologue (Fac) of Fanconi Anemia group C (FAC) to evaluate the role of Fac in the pathogenesis of bone marrow (BM) failure. Methylcellulose cultures of BM cells from Fac-/- and Fac+/+ mice were established to examine the growth of multipotent and lineage-restricted progenitors containing inhibitory cytokines, including interferon-gamma (IFN-gamma ), tumor necrosis factor-alpha (TNF-alpha ), and macrophage inflammatory protein-1alpha (MIP-1alpha ). Clonogenic growth of Fac-/- progenitors was reduced by 50% at 50- to 100-fold lower concentrations of all inhibitory cytokines evaluated. We hypothesized that the aberrant responsiveness to inhibitory cytokines in clonogenic cells may be a result of deregulated apoptosis. To test this hypothesis, we performed the TUNEL assay on purified populations of primary BM cells enriched for hematopoietic progenitors or differentiated myeloid cells. After stimulation with TNF-alpha , accentuated apoptosis was observed in both populations of Fac-/- cells. In addition, deregulated apoptosis was also noted in the most immature phenotypic population of hematopoietic cells after stimulation with MIP-1alpha .Together these data suggest a role of Fac in affecting the signaling of multiple cytokine pathways and support cytokine-mediated apoptosis as a major mechanism responsible for BM failure observed in FA patients.

    INTRODUCTION
Abstract
Introduction
Methods
Results
Discussion
References

FANCONI ANEMIA (FA) is a complex genetic disorder characterized by progressive acquisition of bone marrow (BM) aplasia, chromosomal instability, predisposition to malignancies, and hypersensitivity to bifunctional alkylating agents.1-4 At least eight complementation groups have been identified on the basis of somatic cell fusion studies that result in a generally similar phenotype.5,6 Three of the eight complementation groups (A, C, and D) have been mapped to different chromosomal loci,5,7,8 and the cDNAs of the A and C genes have been identified.9-11 Unfortunately, the cloning of the A and C genes have not provided insight into the function of FA genes in cellular homeostasis.

Maintenance of normal hematopoiesis involves complex interactions between the stem/progenitor cells and multiple stimulatory and inhibitory molecules.12,13 The observation that Fanconi anemia complementation type C (FAC) patients acquire a progressive BM failure suggests that FAC plays a role in proliferation and/or survival of hematopoietic stem and progenitor cells. BM aplasia may occur by multiple mechanisms including alterations in the production or intracellular signaling of stimulatory and inhibitory cytokines. Two murine models containing a disruption of the murine homologue of FAC (Fac) have recently been developed to facilitate functional studies in primary cells in vitro and in vivo.14,15 Chen et al14 created a disruption in exon 8 of Fac, while Whitney et al15 used homologous recombination to create a disruption in exon 9. In both models, spontaneous chromosomal aberrations were observed, as well as an increase in chromosome breaks in splenic lymphocytes in response to bifunctional alkylating agents analogous to lymphocytes in FA patients.14,15

Whitney showed that hematopoietic progenitors from mice containing a disruption of Fac (Fac-/-) were hypersensitive to IFN-gamma and, recently, Rathbun et al, using the model developed by Whitney,15 determined that low doses of IFN-gamma affected programmed cell death in Fac-/- hematopoietic progenitors by inducing Fas expression. Similar results were obtained in studies using primary cells from a patient with Fanconi anemia type C.16

Other inhibitory cytokines, such as tumor necrosis factor-alpha (TNF-alpha ), have also been implicated in the pathogenesis of aplastic anemia.17 In addition, TNF-alpha is frequently elevated in patients with Fanconi anemia.18,19 TNF-alpha is known to induce Fas-mediated apoptosis,17 as well as an alternative apoptosis pathway involving TNF-alpha receptor-associated death domain (TRADD).20 On the basis of these observations, we hypothesized that Fac-deficient cells may be hypersensitive to TNF-alpha and potentially other inhibitory cytokines.

In this report, using a genetically distinct model14 from that previously used by Whitney,15 we confirm that disruption of both alleles of Fac (Fac-/-) results in deregulated colony formation in response to IFN-gamma . We also show that a disruption in exon 8 of Fac results in a hypersensitive reduction in progenitor growth in cultures containing TNF-alpha as well as another inhibitory cytokine macrophage inflammatory protein-1alpha (MIP-1alpha ). Further, we show that Fac is crucial for prevention of TNF-alpha and MIP-1alpha -mediated apoptosis in primary immature myeloid hematopoietic cells. Finally, we observed altered proliferation kinetics in pluripotent and lineage restricted Fac-/- hematopoietic progenitors in vivo. These results implicate deregulated apoptosis in response to inhibitory cytokines in the pathogenesis of BM aplasia in Fanconi anemia type C.

    MATERIALS AND METHODS
Abstract
Introduction
Methods
Results
Discussion
References

Mice.   Heterozygote Fac mice14 were housed in our animal facility. DNA was extracted from mouse tails using a standard phenol-chloroform method. Genotyping was conducted by amplifying sequences unique to exon 8 and neomycin resistance gene by polymerase chain reaction (PCR). The following primers were used: 5'CCTGCCATCTTCAGAATTGT3' (exon 8 primer), 5'GAGCAACACAAATGGTAAGG3' (intron 8 primer), and 5'TTGAATGGAAGGATTGGAGC3' (neomycin resistance gene primer).

Cells.   BM cells were flushed from femurs and tibias of Fac-/- and Fac+/+ littermate controls with Iscove's modified Dulbecco's medium (IMDM) (GIBCO-BRL, Gaithersburg, MD) supplemented with 5% fetal calf serum (FCS) (Hyclone, Logan, UT). Spleen cell suspensions were prepared by flushing cells from spleens and passing cells through a 23-gauge needle. Total nucleated cell number of BM and spleens was determined before manipulation of cells for further experimentation. Low-density mononuclear cells (LDMNC) were prepared by centrifugation on Ficoll-Hypaque (density 1.119; Sigma Chemical Co, St Louis, MO). Unfractionated BM and spleen cells were used in all experiments except for mitomycin C (MMC) dose-response experiments, which used LDMNC.

Clonogenic assays.   Clonogenic methylcellulose assays were plated in triplicate at 1 × 104 to 5 × 104 BM cells/mL and 5 × 105 spleen cells/mL. Cultures were established in 1% IMDM methylcellulose (Stem Cell Technology, Vancouver, BC, Canada), with 30% FCS, 50 ng/mL recombinant murine Steel factor (a generous gift from Immunex, Seattle, WA) or SCF (Peprotech, Rocky Hill, NJ), 4 U/mL recombinant human erythropoietin (Amgen), 5% vol/vol pokeweed mitogen spleen conditioned media (PWMSCM) and 0.1 mmol hemin (Sigma). Cells were incubated at 37°C, 5% CO2, and lowered (5%) O2. BM cells were cultured in methylcellulose progenitor assays with increasing concentrations of MMC (Sigma), recombinant murine IFN-gamma (R&D Systems, Minneapolis, MN), recombinant murine TNF-alpha (R&D Systems), recombinant murine MIP-1alpha (R&D Systems), and thrombopoietin (Genzyme, Cambridge, MA) to generate dose-response curves for Fac-/- and Fac+/+ hematopoietic progenitor cells. Cultures to establish the responsiveness of Fac-/- cells to MMC were conducted exactly as above, except recombinant murine GM-CSF (Peprotech) was substituted for PWMSCM, and cultures were incubated at 21% O2. CFU-GM, BFU-E, and CFU-GEMM colonies were scored on day 7 of culture. Levels of significance were determined using Student's t-distribution.

Progenitor suicide assays.   The proportion of hematopoietic progenitor cells in S phase was estimated by means of suicide assays that used either 3H-thymidine or hydroxyurea as previously described.21-23 BM and spleen cells were pulse-treated for 30 minutes at 37°C with either high specific activity 3H-thymidine (50 mCi/mL, specific activity = 20 Ci/mmol; New England Nuclear, Boston, MA) or control medium. Cells were washed twice with control medium before plating in methylcellulose cultures as described above. The percentage suicide was determined by the following calculation: (progenitors in control - progenitors in 3H-thymidine) divided by progenitors in control. The level of significance was determined using Student's t-test. These results were compared with the percentage suicide determined by treatment of cells with hydroxyurea (HU) as described elsewhere.23

TUNEL assay.   Pooled samples of BM LDMNC from four Fac-/- and four Fac+/+ animals were stained with Sca1-PE, B220-FITC, and CD3-FITC (PharMingen, San Diego, CA) for 15 minutes at 4°C, washed twice, and sorted by a Becton Dickinson fluorescence activated cell sorter for Sca1+B220-CD3- and Sca1-B220-CD3-. Sca1+B220-CD3- cells were incubated at a density of 2 × 105 cells/mL in a 96-well tissue culture plate in IMDM 20% FCS and were cultured in the following combinations of cytokines: (1) GM-CSF (200 ng/mL) and SCF (100 ng/mL) only, (2) GM-CSF and SCF together with 1 ng/mL TNF-alpha or 100 ng/mL MIP-1alpha , and (3) TNF-alpha (1 ng/mL) or MIP-1alpha (100 ng/mL). Cultures containing Sca1-B220-CD3- cells were established at a density of 2 × 106 cells/mL using the same concentrations of GM-CSF, TNF-alpha , and MIP-1alpha as above described for Sca1+B220-CD3-. After 24 hours, cytospins were made for each condition.

Apoptosis was evaluated using the terminal deoxynucleotidyl transferase (tDt)-mediated dUTP nick end-labeling (TUNEL) assay24 as specified by the manufacturer (Boehringer Mannheim, Indianapolis, IN). Briefly, cells were fixed with 4% formaldehyde (Sigma) for 30 minutes at room temperature and permeabilized with 0.1% sodium citrate (Fisher Scientific, Fair Lawn, NJ) 0.1% Triton-X100 (Boehringer Mannheim) for 2 minutes at 4°C. Cells were incubated with tDt and dUTP-FITC in a humidified environment at 37°C, 5% CO2 for 1 hour. After incubation, cytospins were evaluated by fluorescence microscopy. Photographs were obtained of each condition and scoring of apoptotic cells was conducted. As an independent control to verify the function of the assay, BM cells were irradiated (700 rads) and then maintained in liquid culture for 24 hours. The TUNEL assay was performed on these cells with and without the addition of tDt as positive and negative controls respectively. Three or four independent experiments were conducted with each inhibitory cytokine. Statistical significance was determined using the Student's t-test.

    RESULTS
Abstract
Introduction
Methods
Results
Discussion
References

Fac-/- hematopoietic progenitor cells are hypersensitive to MMC.   A characteristic feature of Fanconi anemia is the hypersensitivity of cells to clastogenic agents such as mitomycin C. Because FA patients have defects in hematopoietic progenitor cell function, it was critical to determine whether hematopoietic progenitors from Fac-/- mice were hypersensitive to MMC as observed in FA patients. As shown in Fig 1, a 50% reduction in maximal colony formation was observed at a 10-fold lower concentration of MMC in Fac-/- progenitors as compared with Fac+/+ littermates. We conclude that the MMC hypersensitivity observed in Fac-/- progenitors is remarkably similar to that seen in FA patients.


View larger version (13K):
[in this window]
[in a new window]
 
Fig 1. MMC hypersensitivity of Fac-/- hematopoietic progenitor cells. BM LDMNC from Fac-/- (black-square) and Fac+/+ (bullet ) animals were cultured in clonogenic methylcellulose progenitor assays at 1 × 104 cells/mL with increasing concentrations of MMC. Each condition was plated in triplicate. The total number of colony-forming units (CFU) per 1 × 104 LDMNC was determined on day 7 of culture. Error bars represent standard error of the means (SEM). Fac-/- hematopoietic progenitor cells were significantly more sensitive to MMC at 5-, 10-, 50-, and 100-nmol concentrations. n = 6 for each group. *P < .05.

Fac-/- hematopoietic progenitor cells are hypersensitive to multiple inhibitory cytokines.   IFN-gamma , TNF-alpha , and MIP-1alpha are cytokines known to inhibit hematopoietic cell growth.25-29 We examined the effect of these inhibitory cytokines on growth of multipotential and lineage restricted progenitor cell growth of Fac mice in vitro (Fig 2). Multipotent (CFU-GEMM), erythroid (BFU-E), and granulocyte-macrophage (CFU-GM) progenitors cultured from Fac-/- BM cells showed a 50% reduction in maximal colony formation at a 50- to 100-fold lower concentration of each of the respective cytokines as compared with progenitors cultured from WT mice. No differences in colony formation were observed between Fac-/- and Fac+/+ hematopoietic progenitors when increasing concentrations of a noninhibitory cytokine (thrombopoietin) were added to the cultures (data not shown).


View larger version (23K):
[in this window]
[in a new window]
 
Fig 2. Hypersensitivity of Fac-/- hematopoietic progenitors to inhibitory cytokines. Unfractionated BM cells from -/- (black-square) and +/+ (bullet ) animals were cultured in triplicate in clonogenic methylcellulose progenitor assays at 5 × 104 cells/mL with increasing concentrations of IFN-gamma (0.1, 0.5, 1, 5, and 10 ng/mL), TNF-alpha (0.1, 0.5, 1, 5, 10 ng/mL), or MIP-1alpha (1, 5, 10, 50 ng/mL). After 7 days in culture, CFU-GM, BFU-E, and CFU-GEMM were scored. Percentage maximal colony formation was determined by dividing the number of progenitors scored at a given concentration of cytokine by the number of progenitors scored without the addition of inhibitory cytokine. The range of control numbers upon which the percentage change are based: +/+ CFU-GM 77-141, BFU-E 41-43, CFU-GEMM,11-13 and -/- CFU-GM 80-154, BFU-E 11-43, and CFU-GEMM.5-13 The error bars represent SEM. CFU-GM, BFU-E, and CFU-GEMM from Fac-/- unfractionated BM cells were significantly more sensitive to IFN-gamma , TNF-alpha , and MIP-1alpha at multiple cytokine concentrations. n = 4 for each group. *P < .05.

Increased apoptosis in immature and differentiated myeloid hematopoietic cells from Fac-/- mice after stimulation with TNF-alpha and MIP-1alpha .   To test whether Fac-/- cells are predisposed to TNF-alpha - or MIP-1alpha -mediated apoptosis, two populations of hematopoietic cells were cultured in the presence of TNF-alpha or MIP-1alpha , then analyzed by the TUNEL assay. One population was highly enriched for myeloid hematopoietic progenitors (Sca1+B220-CD3-), and a second population was highly enriched for myeloid differentiated cells (Sca1-B220-CD3-). More than 90% of Sca1-B220-CD3- cells had macrophage (Mac1) or granulocyte (GR-1) surface markers (data not shown). Figure 3 shows representative examples of Sca1+B220-CD3- cells after liquid culture with TNF-alpha and TUNEL assay. The summary of experiments evaluating apoptosis of Fac-/- cells in response to TNF-alpha are shown in Table 1. Low equivalent levels of apoptosis were observed in both Fac-/- and Fac+/+ cells when cultured with GM-CSF and SCF; cytokines that protect hematopoietic cells from apoptosis.30,31 The addition of TNF-alpha to cultures containing GM-CSF and SCF resulted in increased apoptosis in Fac-/- primitive myeloid cells, but not in the Fac+/+ cells. When hematopoietic cells were cultured with TNF-alpha alone, a dramatic increase in apoptosis was observed in immature (Sca1+B220-CD3-) and differentiated (Sca1-B220-CD3-) myeloid cells from Fac-/- mice.


View larger version (52K):
[in this window]
[in a new window]
 
Fig 3. Increased apoptosis of Sca1+B220-CD3- and Sca1-B220-CD3- cells from Fac-/- mice in response to TNF-alpha . BM LDMNC from Fac-/- and Fac+/+ animals were purified by fluorescence cytometry for Sca1+B220-CD3- and Sca1-B220-CD3- cells. These two populations of cells were incubated in liquid culture for 24 hours with growth factors alone, growth factors plus TNF-alpha (1 ng/mL), or TNF-alpha alone. TUNEL assays were conducted on cytospins of each condition. A total of 100 to 200 cells were evaluated to determine the percentage of apoptotic cells in each condition. Sca1+B220-CD3- cells in conditions containing TNF-alpha are depicted. In Fac-/- mice, the percentage of Sca1+B220-CD3- cells that are apoptotic increases significantly when cultured with TNF-alpha .

 
View this table:
[in this window] [in a new window]
 
Table 1. Percentage Apoptotic Scal+B220-CD3- and Scal-B220-CD3- Cells After 24-Hour Liquid Culture

Experiments evaluating apoptosis in Fac-/- cells after culture with MIP-1alpha are summarized in Table 2. Again, low levels of apoptosis were detected in Fac-/- and Fac+/+ primitive and differentiated cells when cultured with GM-CSF and SCF. Similar levels of apoptosis were observed when MIP-1alpha was added to the cultures. However, culture of Sca1+B220-CD3- cells from Fac-/- mice with MIP-1alpha alone resulted in a dramatically increased level of apoptosis as compared with Fac+/+ mice whose level of apoptosis was unchanged from conditions with protective cytokines. A trend (though not statistically significant) toward increased apoptosis was observed in Sca1-B220-CD3- cells from Fac-/- mice. Together these data are consistent with the enhanced growth inhibition of Fac-/- progenitors in response to TNF-alpha and MIP-1alpha observed in the clonogenic assays (Fig 2).

 
View this table:
[in this window] [in a new window]
 
Table 2. Percentage Apoptotic Scal+B220-CD3- and Scal-B220-CD3- Cells After 24-Hour Liquid Culture

Increased suicide in hematopoietic progenitor cells cultured from Fac-/- mice.   The maintenance of normal hematopoietic cell populations results from a complex homeostasis of cell production and apoptosis. To determine whether there were differences in the absolute number of progenitors per organ in mice homozygous for disruption of Fac, methylcellulose cultures of splenic and BM cells were established. The absolute number of progenitors in the BM and spleen as well as total nucleated cells per organ of Fac-/- mice were similar to those of their Fac+/+ littermates (Table 3). Because Fac-/- hematopoietic progenitors are hypersensitive to multiple inhibitory cytokines and both immature and differentiated myeloid cells undergo increased apoptosis in response to TNF-alpha and MIP-1alpha , it is curious that Fac-/- mice have equivalent numbers of myeloid progenitors and differentiated cells as Fac+/+ mice (Table 3). We hypothesized that if deregulated apoptosis were occurring in vivo, Fac-/- progenitors may exhibit abnormal proliferation kinetics. To investigate this hypothesis, BM and spleen cells from Fac-/- and Fac+/+ mice were pulse treated with tritiated thymidine or hydroxyurea and cultured in methylcellulose for growth of progenitors. The percentage suicide of multipotential (CFU-GEMM), erythroid (BFU-E), and granulocyte-macrophage (CFU-GM) progenitors in both the spleen and BM was dramatically higher in Fac-/- mice as compared with Fac+/+ controls (Table 3). The percentage suicide was comparable using either tritiated thymidine or hydroxyurea. These data infer that an increased proportion of clonogenic hematopoietic progenitors from Fac-/- mice are in S phase and that altered proliferation kinetics exist in vivo.

 
View this table:
[in this window] [in a new window]
 
Table 3. Comparative Analysis of Absolute Numbers and Cycling Status of Myeloid Progenitor Cells From Bone Marrow and Spleen of Fac-/- and Wild-Type Littermate Controls

    DISCUSSION
Abstract
Introduction
Methods
Results
Discussion
References

The development of murine models using homologous recombination to delete the murine homologue of a gene known to cause human disease is extremely useful for understanding the normal function of the gene, the pathogenesis of the human disease, and potential treatment strategies. Some murine models replicate the human disease completely, whereas the phenotype of other models is somewhat variant from the human disease.32 A characteristic feature of Fanconi anemia is the hypersensitive reduction in growth of hematopoietic progenitors cultured in methylcellulose in the presence of MMC. Therefore, it was critical to determine whether hematopoietic progenitors cultured from Fac-/- mice used in these studies were hypersensitive to MMC. The observation that hematopoietic progenitors derived from the murine BM are hypersensitive to MMC is particularly significant because it supports using this model to gain insight into the molecular mechanisms involved in the development of the progressive BM failure in FA patients.

BM failure or acquisition of myeloid leukemia, or both, are the most common causes of mortality in patients with FA.33,34 The precise role of FA genes in maintaining normal hematopoietic cellular homeostasis is the current challenge of many laboratories.35 The role of FA proteins in DNA repair,36 redox status of the cell,37-39 and apoptosis38,40,41 are three active areas of investigation. Cumming et al40 provided evidence that FAC may have a role in apoptosis when they demonstrated that overexpression of FAC in a megakaryocytic IL-3-dependent cell line (MO7e cells), resulted in the prevention of growth factor dependent apoptosis. Other studies reported increased spontaneous apoptosis in FA lymphoblasts but decreased apoptosis when stressed with gamma -irradiation as compared with lymphoblasts derived from normal donors.41 Although these studies in immortalized cell lines implicate FAC in the modulation of apoptosis, it is difficult to determine how accurately they reproduce the biochemical defect and cellular physiology of primary hematopoietic progenitor cells.

Rathbun et al16 recently made the first observation that deregulated apoptosis was evident in primary Fac-/- hematopoietic progenitor cells These investigators reported data demonstrating decreased clonogenic growth in human and murine Fac-/- progenitors in response to IFN-gamma and/or anti-Fas activating antibody, which infers an increased sensitivity to Fas-mediated apoptosis.16 We chose to extend those observations by evaluating multiple inhibitory cytokines that modulate hematopoietic cell growth by alternative intracellular signaling pathways.17,20,42-44 IFN-gamma and TNF-alpha have been implicated in the pathogenesis of acquired aplastic anemia by upregulating Fas expression on hematopoietic cells.19,42,43 TNF-alpha has additional signaling mechanisms to regulate apoptosis through TNF receptor associated proteins, such as TRADD and receptor-interacting protein (RIP), and activation of NF-kappa B.20 MIP-1alpha is a chemokine that appears to induce growth inhibition through the Raf-1 kinase pathway.44 A further distinction between MIP-1alpha and both TNF-alpha and IFN-gamma is that TNF-alpha and IFN-gamma induce apoptosis in normal hematopoietic cells at high cytokine concentrations,45 whereas MIP-1alpha had not yet been evaluated for induction of apoptosis.

Our data, using a genetically distinct murine model, confirm previous findings that homozygous disruption of Fac results in hypersensitivity to IFN-gamma .15,16 This hypersensitivity is particularly interesting as few data are available regarding the role of inhibitory cytokines in other genomic instability syndromes.46-49 In addition to hypersensitivity of Fac-/- progenitors to IFN-gamma , we have shown decreased clonogenic growth in response to TNF-alpha and MIP-1alpha which was not observed previously.15 Furthermore, our data also support the concept of Fac directly or indirectly influencing programmed cell death by showing TNF-alpha and MIP-1alpha induced apoptosis using a methodology that permitted direct detection of apoptosis in primary progenitor and differentiated cells. We showed that purified populations of primary cells enriched for either hematopoietic progenitor or myeloid differentiated cells from Fac-/- mice undergo increased cytokine-mediated apoptosis after culture with TNF-alpha alone or in combination with cytokines that protect hematopoietic cells from apoptosis. In addition, we showed that primitive myeloid cells (Sca1+B220-CD3-) undergo enhanced apoptosis when cultured with MIP-1alpha as a single cytokine. This is the first description of a chemokine inducing apoptosis in hematopoietic cells. Together our findings and previous data16 are consistent with the hypothesis that there is a progressive loss of hematopoietic progenitor and stem cells in Fac-/- mice and FA patients resulting directly or indirectly from inhibitory cytokine-mediated apoptosis.

We hypothesized that if apoptosis is involved in the pathogenesis of FA BM failure in vivo in Fac-/- mice, an increase in the number of proliferating hematopoietic progenitors would be required to sustain normal numbers of differentiated cells. To test this hypothesis we evaluated the suicide of hematopoietic progenitors using two independent agents. The markedly increased suicide observed in multipotent and lineage-restricted clonogenic cells from BM and spleen of Fac-/- mice supports the hypothesis that a higher proportion of Fac-/- hematopoietic progenitors in vivo are cycling due to loss of immature and differentiated cells from increased apoptosis. Alternatively, the increased suicide rate observed in Fac-/- progenitors may reflect an increased sensitivity to tritium and hydroxyurea. The rationale for using hydroxyurea as an agent to assess the cycling status of clonogenic progenitors was because of recent data showing that FAC-deficient lymphoblast cell lines exhibit normal cell-cycle kinetics after 24-hour exposure to the drug.50 The lack of hypersensitivity to hydroxyurea and the similar suicide rates between the two agents support the hypothesis that the increased suicide rate in Fac-/- progenitors is due to an accelerated proportion of clonogenic cells in S phase, rather than to hypersensitivity to the agents used to conduct these studies. However, to further delineate and confirm that an increased proportion of Fac-/- progenitor cells are in S phase, future studies evaluating phenotypically defined populations of cells are indicated.

In summary, we have shown that loss of Fac results in deregulated apoptosis in myeloid hematopoietic cells in response to inhibitory cytokines with distinctive intracellular signaling pathways. It will be interesting in future experiments to evaluate how the loss of Fac disturbs the tightly regulated intracellular signaling of IFN-gamma , TNF-alpha , and MIP-1alpha in mediating hematopoietic cell growth. Fac-/- mice provide a valuable model system to evaluate the role of Fac in myeloid growth control.

    FOOTNOTES

   Submitted August 8, 1997; accepted January 23, 1998.
   Supported by US Public Health Services Grants No. PO1 GK53586, P50 DK49218, RO1 HL56416, RO1 HL54037, R29 CA74177-01, and IF32 HL09851-01, and by the National Cancer Institute of Canada, Bayer Red Cross Program, and International Fanconi Anemia Research Foundation.
   Address reprint requests to D. Wade Clapp, MD, Departments of Pediatrics and Microbiology/Immunology, Herman B Wells Research Center, 702 Barnhill Dr, Cancer Center 421, Indianapolis, IN 46202.
   The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.

    ACKNOWLEDGMENT

We thank our colleagues at Indiana University and Dr Kevin Shannon (University of California, San Francisco) for reading the manuscript. We also thank Patricia Fox for secretarial support.

    REFERENCES
Abstract
Introduction
Methods
Results
Discussion
References

1. Auerbach A: Fanconi anemia and leukemia: Tracking the genes. Leukemia 6:1, 1992

2. Auerbach A: Fanconi anemia diagnosis and the diepoxybutane (DEB) test. Exp Hematol 21:731, 1993[Medline] [Order article via Infotrieve]

3. Buchwald M, Ng J, Clarke C, Duckworth-Rysiecki G: Studies of gene transfer and reversion to mitomycin C resistance in Fanconi anemia cells. Mutat Res 184:153, 1987[Medline] [Order article via Infotrieve]

4. Schroeder T, Tilgen D, Kruger D, Vogel F: Formal genetics of Fanconi's anemia. Hum Genet 32:257, 1976[Medline] [Order article via Infotrieve]

5. Strathdee CA, Duncan AMV, Buchwald M: Evidence for at least four Fanconi Anemia genes including FACC on chromosome 9. Nature Genet 1:196, 1992[Medline] [Order article via Infotrieve]

6. Joenje H, Oostra AB, Wijker M, di Summa FM, van Berkel CGM, Rooimans MA, Ebell W, van Weel M, Pronk JC, Buchwald M, Arwert F: Evidence for at least eight Fanconi anemia genes. Am J Hum Genet 61:940, 1997[Medline] [Order article via Infotrieve]

7. Pronk JC, Gibson RA, Savoia A, Wijker M, Morgan NS, Melchionda S, Ford D, Temtamy S, Ortega JJ, Jansen S, Harenga C, Cohn RJ, de Ravel TJ, Roberts I, Westerveld A, Easton DJ, Joenje H, Mathew CG, Arwert F: Localization of the Fanconi anemia complementation group A gene to chromosome 16q24.3. Nature Genet 11:338, 1995[Medline] [Order article via Infotrieve]

8. Whitney M, Thayer M, Reifsteck C, Olson S, Smith L, Jakobs PM, Leach RK, Naylor S, Joenje H, Grompe M: Microcell mediated chromosome transfer maps the Fanconi anemia groups D gene to chromosome 3p. Nature Genet 11:341, 1995[Medline] [Order article via Infotrieve]

9. Strathdee C, Gavish H, Shannon W, Buchwald M: Cloning of cDNAs for Fanconi's anaemia by functional complementation. Nature 356:763, 1992[Medline] [Order article via Infotrieve]

10. Lo Ten Foe JR, Rooimans MA, Bosnoyan-Collins L, Alon N, Wijker M, Parker L, Lightfoot J, Carreau M, Callen DF, Savoia A, Cheng NC van Berkel CG, Strunk MH, Gille JJ, Pals G, Kruyt FA, Pronk JC, Arwert F, Buchwald M, Joenje H: Expression cloning of a cDNA for the major Fanconi anaemia gene, FAA. Nature Genet 14:320, 1996[Medline] [Order article via Infotrieve]

11. The Fanconi anaemia/breast cancer consortium: Positional cloning of the Fanconi anaemia group A gene. Nature Genet 14:324, 1996[Medline] [Order article via Infotrieve]

12. Broxmeyer HE: Suppressor cytokines and regulation of myelopoiesis: Biology and possible clinical uses. Am J Pediatr 14:22, 1992

13. Broxmeyer HE: Myelosuppressive cytokines and peptides , in Whetton T, Gordon T (eds): Hemopoietic Growth Factors. Blood Cell Biochemistry, vol 7. London, UK, Plenum , 1996 , p 121

14. Chen M, Tomkins D, Auerbach W, McKerlie C, Youssoufian H, Liu L, Gan O, Carreau M, Auerbach A, Groves T, Guidos C, Freedman M, Cross J, Percy D, Dick J, Joyner A, Buchwald M: Inactivation of Fac in mice produces inducible chromosomal instability and reduced fertility reminiscent of Fanconi anaemia. Nature Genet 12:448, 1996[Medline] [Order article via Infotrieve]

15. Whitney M, Royle G, Low M, Kelly M, Axthelm M, Reifsteck C, Olson S, Braun R, Heinrich M, Rathbun R, Bagby G, Grompe M: Germ cell defects and hematopoietic hypersensitivity to gamma -interferon in mice with a targeted disruption of the Fanconi anemia C gene. Blood 88:49, 1996[Abstract/Free Full Text]

16. Rathbun RK, Faulkner GR, Ostroski MH, Christianson TA, Hughes G, Jones G, Cahn R, Maziarz R, Royle G, Keeble W, Heinrich MC, Grompe M, Tower PA, Bagby GC: Inactivation of the Fanconi Anemia Group C gene augments interferon-gamma -induced apoptotic responses in hematopoietic cells. Blood 90:974, 1997[Abstract/Free Full Text]

17. Maciejewsk IJ, Selleri C, Anderson S, Young N: Fas antigen expression on CD34+ human marrow cells is induced by interferon gamma  and tumor necrosis factor alpha  and potentiates cytokine-mediated hematopoietic suppression in vitro. Blood 85:3183, 1995[Abstract/Free Full Text]

18. Schultz J, Shahidi N: Tumor necrosis factor-alpha overproduction in Fanconi's anemia. Am J Hematol 42:196, 1993[Medline] [Order article via Infotrieve]

19. Rosselli F, Sanceau J, Gluckman E, Wietzerbin J, Moustacchi E: Abnormal lymphokine production: A novel feature of the genetic disease Fanconi anemia. II. In vitro and in vivo spontaneous overproduction of tumor necrosis factor alpha. Blood 83:1216, 1994[Abstract/Free Full Text]

20. Liu Z, Hsu H, Goeddel DV, Karin M: Dissection of TNF receptor 1 effector functions: JNK activation is not linked to apoptosis while NF-kappa B activation prevents cell death. Cell 87:565, 1996[Medline] [Order article via Infotrieve]

21. Broxmeyer H, Cooper S, Williams D, Hangoc G, Gutterman J, Vadhan-Raj S: Growth characteristics of marrow hematopoietic progenitor/precursor cells from patients on a phase I clinical trial with purified recombinant human granulocyte-macrophage colony-stimulating factor. Exp Hematol 16:594, 1988[Medline] [Order article via Infotrieve]

22. Broxmeyer H, Benninger L, Cooper S, Hague N, Benjamin R, Vadhan-Raj S: Effects of in vivo treatment with PIXY321 (GM-CSF/IL3 fusion protein) on proliferation kinetics of bone marrow and blood myeloid progenitor cells in patients with sarcoma. Exp Hematol 23:335, 1995[Medline] [Order article via Infotrieve]

23. Broxmeyer HE, Baker F, Galbraith: Relationship of colony stimulating activity to apparent kill of human colony forming cells by irradiation and hydroxyurea. Blood 47:403, 1976[Abstract/Free Full Text]

24. Negoescu A, Lorimier P, Labat-Molieur F, Azoti L, Robert C, Guillermet C, Brambilla C, Brambilla E: TUNEL: Improvement and evaluation of the method for in situ apoptotic cell identification. Biochemica 2:12, 1997

25. Broxmeyer HE, Lu L, Platzer E, Feit C, Juliaro L, Rubin BY: Comparative analysis of the influences of human gamma, alpha and beta interferons on human multipotential (CFU-GEMM), erythroid (BFU-E), and granulocyte-macrophage (CFU-GM) progenitor cells. J Immunol 131:1300, 1993[Abstract]

26. Broxmeyer HE, Williams DE, Lu L, Cooper S, Anderson SL, Beyer GS, Hoffman R, Rubin BY: The suppressive influences of human tumor necrosis factor on bone marrow hematopoietic cells from donors and patients with leukemia: Synergism of tumor necrosis factor and gamma interferon. J Immunol 136:4487, 1986[Abstract]

27. Graham GJ, Wright EG, Hewick R, Wolpe SD, Wilkie NM, Donaldson D, Lorimore S, Pragnell IB: Identification and characterization of an inhibitor of haemopoietic stem cell proliferation. Nature 344:442, 1990[Medline] [Order article via Infotrieve]

28. Broxmeyer HE, Sherry B, Lu L, Cooper S, Oh KO, Tekamp-Olson P, Kwon BS, Cerami A: Enhancing and suppressing effects of recombinant murine macrophage inflammatory proteins on colony formation in vitro by bone marrow myeloid progenitor cells. Blood 76:1110, 1990[Abstract/Free Full Text]

29. Cooper S, Mantel C, Broxmeyer HE: Myelosuppressive effects in vivo with very low dosages of monomeric recombinant murine macrophage inflammatory protein-1alpha . Exp Hematol 22:186, 1994[Medline] [Order article via Infotrieve]

30. Sakai I, Kraft AS: The kinase domain of Jak2 mediates induction of bcl-2 and delays cell death in hematopoietic cells. J Biol Chem 272:12350, 1997[Abstract/Free Full Text]

31. Lotem J, Sachs L: Hematopoietic cytokines inhibit apoptosis induced by transforming growth factor beta 1 and cancer chemotherapy compounds in myeloid leukemic cells. Blood 80:1750, 1992[Abstract/Free Full Text]

32. Wynshaw-Boris A: Model mice and human disease. Nature Genet 13:259, 1996[Medline] [Order article via Infotrieve]

33. Young NS: The bone marrow failure syndromes , in Nathan DG, Oski FA (eds): Hematology of Infancy and Childhood, vol 1 Philadelphia, PA, Saunders , 1993 , p 216

34. Butturini A, Gale RP, Verlander PC, Adler-Brecher B, Gillio A, Auerbach AD: Hematologic abnormalities in Fanconi anemia. An International Fanconi Anemia Registry study. Blood 84:1650, 1994[Abstract/Free Full Text]

35. D'Andrea AD, Grompe M: Molecular biology of Fanconi anemia: Implications for diagnosis and therapy. Blood 90:1725, 1997[Free Full Text]

36. Lambert MW, Tsongalis GJ, Lambert WC, Parrish DD: Correction of the FNA repair defect in Fanconi anemia complementation groups A and D cells. Biochem Biophys Res Commun 230:587, 1997[Medline] [Order article via Infotrieve]

37. Joenje H, Oostra AB: Effect of oxygen tension on chromosomal aberrations in Fanconi anaemia. Hum Genet 65:99, 1983[Medline] [Order article via Infotrieve]

38. Clarke AA, Philpott NJ, Gordon-Smith EC, Rutherford TR: The sensitivity of Fanconi anaemia group C cells to apoptosis induced by mitomycin C is due to oxygen radical generation, not DNA crosslinking. Br J Haematol 96:240, 1997[Medline] [Order article via Infotrieve]

39. Ruppitsch W, Meiblitzer C, Weirich-Schwaiger M, Klocker H, Scheidereit C, Schweiger M, Hirsch-Kauffmann M: The role of oxygen metabolism for the pathological phenotype of Fanconi anemia. Hum Genet 99:710, 1997[Medline] [Order article via Infotrieve]

40. Cumming RC, Liu JM, Youssoufian H, Buchwald M: Suppression of apoptosis in hematopoietic factor-dependent progenitor cell lines by expression of the FAC gene. Blood 88:4558, 1996[Abstract/Free Full Text]

41. Ridet A, Guillouf C, Duchaud E, Cundari E, Fiore M, Moustacchi E, Rosselli F: Deregulated apoptosis is a hallmark of the Fanconi anemia syndrome. Cancer Res 57:1722, 1997[Abstract/Free Full Text]

42. Selleri C, Maciejewski JP, Sato T, Young NS: Interferon-gamma constituitively expressed in the stromal microenvironment of human marrow cultures mediates potent hematopoietic inhibition. Blood 87:4149, 1996[Abstract/Free Full Text]

43. Young NS, Maciejewski J: The pathophysiology of acquired aplastic anemia. N Engl J Med 336:1365, 1997[Free Full Text]

44. Aronica SM, Mantel C, Gonin R, Marshall MS, Sarris A, Cooper S, Hague N, Zhang XF, Broxmeyer HE: Interferon-inducible protein 10 and macrophage inflammatory protein 1alpha inhibit growth factor stimulation of Raf-1 kinase activity and protein synthesis in a human growth factor-dependent hematopoietic cell line. J Biol Chem 270:21998, 1995[Abstract/Free Full Text]

45. Selleri C, Sato T, Anderson S, Young NS, Maciejewski JP: Interferon-gamma and tumor necrosis factor-alpha suppress both early and late stages of hematopoiesis and induce programmed cell death. J Cell Physiol 165:538, 1995[Medline] [Order article via Infotrieve]

46. Suzuki N, Suzuki H, Kojima T, Sugita K, Takakubo Y, Okamoto S: Effects of human interferon on cellular response to UV in UV-sensitive human cell strains. Mutat Res 198:207, 1988[Medline] [Order article via Infotrieve]

47. Gaspari AA, Fleisher TA, Kraemer KH: Impaired interferon production and natural killer cell activation in patients with the skin cancer-prone disorder, xeroderma pigmentosum. J Clin Invest 92:1135, 1993

48. Siddoo-Atwal C, Haas AL, Rosin MP: Elevation of interferon beta -inducible proteins in ataxia telangiectasia cells. Cancer Res 56:443, 1996[Abstract/Free Full Text]

49. Auerbach AD, Verlander PC: Disorders of DNA replication and repair. Curr Opin Pediatr 9:599, 1997

50. Heinrich MC, Hoatlin ME, Zigler AJ, Silvey KV, Bakke AC, Keeble WW, Zhi Y, Reifsteck CA, Grompe M, Brown MG, Magenis RE, Olson SB, Bagby GC: DNA cross-linker-induced G2/M arrest in group C Fanconi anemia lymophoblasts reflects normal checkpoint function. Blood 91:275, 1998[Abstract/Free Full Text]


© 1998 by The American Society of Hematology.
 
0006-4971/98/91-0008$3.00/0

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
MutagenesisHome page
J. L. Fischer, M.A. S. Kumar, T. W. Day, T. M. Hardy, S. Hamilton, C. Besch-Williford, A. R. Safa, K. E. Pollok, and M. L. Smith
The Xpc gene markedly affects cell survival in mouse bone marrow
Mutagenesis, July 1, 2009; 24(4): 309 - 316.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. D. Milsom, B. Schiedlmeier, J. Bailey, M.-O. Kim, D. Li, M. Jansen, A. M. Ali, M. Kirby, C. Baum, L. J. Fairbairn, et al.
Ectopic HOXB4 overcomes the inhibitory effect of tumor necrosis factor-{alpha} on Fanconi anemia hematopoietic stem and progenitor cells
Blood, May 21, 2009; 113(21): 5111 - 5120.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. R. Saadatzadeh, K. Bijangi-Vishehsaraei, R. Kapur, and L. S. Haneline
Distinct roles of stress-activated protein kinases in Fanconi anemia type C-deficient hematopoiesis
Blood, March 19, 2009; 113(12): 2655 - 2660.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Li, S. Chen, J. Yuan, Y. Yang, J. Li, J. Ma, X. Wu, M. Freund, K. Pollok, H. Hanenberg, et al.
Mesenchymal stem/progenitor cells promote the reconstitution of exogenous hematopoietic stem cells in Fancg-/- mice in vivo
Blood, March 5, 2009; 113(10): 2342 - 2351.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Si, A. C. Pulliam, Y. Linka, S. Ciccone, C. Leurs, J. Yuan, O. Eckermann, S. Fruehauf, S. Mooney, H. Hanenberg, et al.
Overnight transduction with foamyviral vectors restores the long-term repopulating activity of Fancc-/- stem cells
Blood, December 1, 2008; 112(12): 4458 - 4465.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
X. Zhang, X. Shang, F. Guo, K. Murphy, M. Kirby, P. Kelly, L. Reeves, F. O. Smith, D. A. Williams, Y. Zheng, et al.
Defective homing is associated with altered Cdc42 activity in cells from patients with Fanconi anemia group A
Blood, September 1, 2008; 112(5): 1683 - 1686.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. Briot, G. Mace-Aime, F. Subra, and F. Rosselli
Aberrant activation of stress-response pathways leads to TNF-{alpha} oversecretion in Fanconi anemia
Blood, February 15, 2008; 111(4): 1913 - 1923.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
H. E. Broxmeyer, S. Sehra, S. Cooper, L. M. Toney, S. Kusam, J. J. Aloor, C. C. Marchal, M. C. Dinauer, and A. L. Dent
Aberrant Regulation of Hematopoiesis by T Cells in BAZF-Deficient Mice
Mol. Cell. Biol., August 1, 2007; 27(15): 5275 - 5285.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
X. Zhang, D. P. Sejas, Y. Qiu, D. A. Williams, and Q. Pang
Inflammatory ROS promote and cooperate with the Fanconi anemia mutation for hematopoietic senescence
J. Cell Sci., May 1, 2007; 120(9): 1572 - 1583.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. P. Sejas, R. Rani, Y. Qiu, X. Zhang, S. R. Fagerlie, H. Nakano, D. A. Williams, and Q. Pang
Inflammatory Reactive Oxygen Species-Mediated Hemopoietic Suppression in Fancc-Deficient Mice
J. Immunol., April 15, 2007; 178(8): 5277 - 5287.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
G. C. Bagby and G. Meyers
Bone Marrow Failure as a Risk Factor for Clonal Evolution: Prospects for Leukemia Prevention
Hematology, January 1, 2007; 2007(1): 40 - 46.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Si, S. Ciccone, F.-C. Yang, J. Yuan, D. Zeng, S. Chen, H. J. van de Vrugt, J. Critser, F. Arwert, L. S. Haneline, et al.
Continuous in vivo infusion of interferon-gamma (IFN-{gamma}) enhances engraftment of syngeneic wild-type cells in Fanca-/- and Fancg-/- mice
Blood, December 15, 2006; 108(13): 4283 - 4287.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. M. Liu and S. R. Ellis
Ribosomes and marrow failure: coincidental association or molecular paradigm?
Blood, June 15, 2006; 107(12): 4583 - 4588.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Bijangi-Vishehsaraei, M. R. Saadatzadeh, A. Werne, K. A. W. McKenzie, R. Kapur, H. Ichijo, and L. S. Haneline
Enhanced TNF-{alpha}-induced apoptosis in Fanconi anemia type C-deficient cells is dependent on apoptosis signal-regulating kinase 1
Blood, December 15, 2005; 106(13): 4124 - 4130.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
X. Zhang, J. Li, D. P. Sejas, and Q. Pang
Hypoxia-reoxygenation induces premature senescence in FA bone marrow hematopoietic cells
Blood, July 1, 2005; 106(1): 75 - 85.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
X. Li, M. M. Le Beau, S. Ciccone, F.-C. Yang, B. Freie, S. Chen, J. Yuan, P. Hong, A. Orazi, L. S. Haneline, et al.
Ex vivo culture of Fancc-/- stem/progenitor cells predisposes cells to undergo apoptosis, and surviving stem/progenitor cells display cytogenetic abnormalities and an increased risk of malignancy
Blood, May 1, 2005; 105(9): 3465 - 3471.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
H. E. Broxmeyer, C. M. Orschell, D. W. Clapp, G. Hangoc, S. Cooper, P. A. Plett, W. C. Liles, X. Li, B. Graham-Evans, T. B. Campbell, et al.
Rapid mobilization of murine and human hematopoietic stem and progenitor cells with AMD3100, a CXCR4 antagonist
J. Exp. Med., April 18, 2005; 201(8): 1307 - 1318.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Mi and G. M. Kupfer
The Fanconi anemia core complex associates with chromatin during S phase
Blood, January 15, 2005; 105(2): 759 - 766.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. W. Freie, S. L. M. Ciccone, X. Li, P. A. Plett, C. M. Orschell, E. F. Srour, H. Hanenberg, D. Schindler, S.-H. Lee, and D. W. Clapp
A Role for the Fanconi Anemia C Protein in Maintaining the DNA Damage-induced G2 Checkpoint
J. Biol. Chem., December 3, 2004; 279(49): 50986 - 50993.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Qiao, J. Mi, J. B. Wilson, G. Zhi, N. R. Bucheimer, N. J. Jones, and G. M. Kupfer
Phosphorylation of Fanconi Anemia (FA) Complementation Group G Protein, FANCG, at Serine 7 Is Important for Function of the FA Pathway
J. Biol. Chem., October 29, 2004; 279(44): 46035 - 46045.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Zhang, J. Li, D. P. Sejas, K. R. Rathbun, G. C. Bagby, and Q. Pang
The Fanconi Anemia Proteins Functionally Interact with the Protein Kinase Regulated by RNA (PKR)
J. Biol. Chem., October 15, 2004; 279(42): 43910 - 43919.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
X. Li, Y. Yang, J. Yuan, P. Hong, B. Freie, A. Orazi, L. S. Haneline, and D. W. Clapp
Continuous in vivo infusion of interferon-gamma (IFN-{gamma}) preferentially reduces myeloid progenitor numbers and enhances engraftment of syngeneic wild-type cells in Fancc-/- mice
Blood, August 15, 2004; 104(4): 1204 - 1209.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Thomashevski, A. A. High, M. Drozd, J. Shabanowitz, D. F. Hunt, P. A. Grant, and G. M. Kupfer
The Fanconi Anemia Core Complex Forms Four Complexes of Different Sizes in Different Subcellular Compartments
J. Biol. Chem., June 18, 2004; 279(25): 26201 - 26209.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. R. Saadatzadeh, K. Bijangi-Vishehsaraei, P. Hong, H. Bergmann, and L. S. Haneline
Oxidant Hypersensitivity of Fanconi Anemia Type C-deficient Cells Is Dependent on a Redox-regulated Apoptotic Pathway
J. Biol. Chem., April 16, 2004; 279(16): 16805 - 16812.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
K. Hiatt, D. A. Ingram, H. Huddleston, D. F. Spandau, R. Kapur, and D. W. Clapp
Loss of the Nf1 Tumor Suppressor Gene Decreases Fas Antigen Expression in Myeloid Cells
Am. J. Pathol., April 1, 2004; 164(4): 1471 - 1479.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Brodeur, I. Goulet, C. S. Tremblay, C. Charbonneau, M.-C. Delisle, C. Godin, C. Huard, E. W. Khandjian, M. Buchwald, G. Levesque, et al.
Regulation of the Fanconi Anemia Group C Protein through Proteolytic Modification
J. Biol. Chem., February 6, 2004; 279(6): 4713 - 4720.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. Freie, X. Li, S. L. M. Ciccone, K. Nawa, S. Cooper, C. Vogelweid, L. Schantz, L. S. Haneline, A. Orazi, H. E. Broxmeyer, et al.
Fanconi anemia type C and p53 cooperate in apoptosis and tumorigenesis
Blood, December 1, 2003; 102(12): 4146 - 4152.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Dufour, A. Corcione, J. Svahn, R. Haupt, V. Poggi, A. N. Beka'ssy, R. Scime, A. Pistorio, and V. Pistoia
TNF-{alpha} and IFN-{gamma} are overexpressed in the bone marrow of Fanconi anemia patients and TNF-{alpha} suppresses erythropoiesis in vitro
Blood, September 15, 2003; 102(6): 2053 - 2059.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
X. Li, P. A. Plett, Y. Yang, P. Hong, B. Freie, E. F. Srour, C. M. Orschell, D. W. Clapp, and L. S. Haneline
Fanconi anemia type C-deficient hematopoietic stem/progenitor cells exhibit aberrant cell cycle control
Blood, September 15, 2003; 102(6): 2081 - 2084.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
A. Matsumoto, K. E. Comatas, L. Liu, and J. S. Stamler
Screening for Nitric Oxide-Dependent Protein-Protein Interactions
Science, August 1, 2003; 301(5633): 657 - 661.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. W. Lensch, M. Tischkowitz, T. A. Christianson, C. A. Reifsteck, S. A. Speckhart, P. M. Jakobs, M. E. O'Dwyer, S. B. Olson, M. M. Le Beau, S. V. Hodgson, et al.
Acquired FANCA dysfunction and cytogenetic instability in adult acute myelogenous leukemia
Blood, July 1, 2003; 102(1): 7 - 16.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Hadjur and F. R. Jirik
Increased sensitivity of Fancc-deficient hematopoietic cells to nitric oxide and evidence that this species mediates growth inhibition by cytokines
Blood, May 15, 2003; 101(10): 3877 - 3884.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. S. Haneline, X. Li, S. L. M. Ciccone, P. Hong, Y. Yang, H. E. Broxmeyer, S.-H. Lee, A. Orazi, E. F. Srour, and D. W. Clapp
Retroviral-mediated expression of recombinant Fancc enhances the repopulating ability of Fancc-/- hematopoietic stem cells and decreases the risk of clonal evolution
Blood, February 15, 2003; 101(4): 1299 - 1307.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Q. Pang, T. A. Christianson, W. Keeble, T. Koretsky, and G. C. Bagby
The Anti-apoptotic Function of Hsp70 in the Interferon-inducible Double-stranded RNA-dependent Protein Kinase-mediated Death Signaling Pathway Requires the Fanconi Anemia Protein, FANCC
J. Biol. Chem., December 13, 2002; 277(51): 49638 - 49643.
[Abstract] [Full Text] [PDF]


Home page
MutagenesisHome page
M. Bogliolo, O. Cabre, E. Callen, V. Castillo, A. Creus, R. Marcos, and J. Surralles
The Fanconi anaemia genome stability and tumour suppressor network
Mutagenesis, November 1, 2002; 17(6): 529 - 538.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. Rio, J. C. Segovia, H. Hanenberg, J. A. Casado, J. Martinez, K. Gottsche, N. C. Cheng, H. J. Van de Vrugt, F. Arwert, H. Joenje, et al.
In vitro phenotypic correction of hematopoietic progenitors from Fanconi anemia group A knockout mice
Blood, August 28, 2002; 100(6): 2032 - 2039.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M.-S. Dai, N. Chevallier, S. Stone, M. C. Heinrich, M. McConnell, T. Reuter, H. E. Broxmeyer, J. D. Licht, L. Lu, and M. E. Hoatlin
The Effects of the Fanconi Anemia Zinc Finger (FAZF) on Cell Cycle, Apoptosis, and Proliferation Are Differentiation Stage-specific
J. Biol. Chem., July 12, 2002; 277(29): 26327 - 26334.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Yang, Y. Kuang, R. M. De Oca, T. Hays, L. Moreau, N. Lu, B. Seed, and A. D. D'Andrea
Targeted disruption of the murine Fanconi anemia gene, Fancg/Xrcc9
Blood, December 1, 2001; 98(12): 3435 - 3440.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. Grompe and A. D'Andrea
Fanconi anemia and DNA repair
Hum. Mol. Genet., October 1, 2001; 10(20): 2253 - 2259.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Q. Pang, T. A. Christianson, W. Keeble, J. Diaz, G. R. Faulkner, C. Reifsteck, S. Olson, and G. C. Bagby
The Fanconi anemia complementation group C gene product: structural evidence of multifunctionality
Blood, September 1, 2001; 98(5): 1392 - 1401.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Hadjur, K. Ung, L. Wadsworth, J. Dimmick, E. Rajcan-Separovic, R. W. Scott, M. Buchwald, and F. R. Jirik
Defective hematopoiesis and hepatic steatosis in mice with combined deficiencies of the genes encoding Fancc and Cu/Zn superoxide dismutase
Blood, August 15, 2001; 98(4): 1003 - 1011.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Dror and M. H. Freedman
Shwachman-Diamond syndrome marrow cells show abnormally increased apoptosis mediated through the Fas pathway
Blood, May 15, 2001; 97(10): 3011 - 3016.
[Abstract] [Full Text] [PDF]


Home page
PediatricsHome page
M. P. Wajnrajch, J. M. Gertner, Z. Huma, J. Popovic, K. Lin, P. C. Verlander, S. D. Batish, P. F. Giampietro, J. G. Davis, M. I. New, et al.
Evaluation of Growth and Hormonal Status in Patients Referred to the International Fanconi Anemia Registry
Pediatrics, April 1, 2001; 107(4): 744 - 754.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Q. Pang, W. Keeble, J. Diaz, T. A. Christianson, S. Fagerlie, K. Rathbun, G. R. Faulkner, M. O'Dwyer, and G. C. Bagby Jr
Role of double-stranded RNA-dependent protein kinase in mediating hypersensitivity of Fanconi anemia complementation group C cells to interferon {gamma}, tumor necrosis factor-{alpha}, and double-stranded RNA
Blood, March 15, 2001; 97(6): 1644 - 1652.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. K. Rathbun, T. A. Christianson, G. R. Faulkner, G. Jones, W. Keeble, M. O'Dwyer, and G. C. Bagby
Interferon-gamma -induced apoptotic responses of Fanconi anemia group C hematopoietic progenitor cells involve caspase 8-dependent activation of caspase 3 family members
Blood, December 15, 2000; 96(13): 4204 - 4211.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Q. Pang, S. Fagerlie, T. A. Christianson, W. Keeble, G. Faulkner, J. Diaz, R. K. Rathbun, and G. C. Bagby
The Fanconi Anemia Protein FANCC Binds to and Facilitates the Activation of STAT1 by Gamma Interferon and Hematopoietic Growth Factors
Mol. Cell. Biol., July 1, 2000; 20(13): 4724 - 4735.
[Abstract] [Full Text]


Home page
BloodHome page
K. A. Gush, K.-L. Fu, M. Grompe, and C. E. Walsh
Phenotypic correction of Fanconi anemia group C knockout mice
Blood, January 15, 2000; 95(2): 700 - 704.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. P. Battaile, R. L. Bateman, D. Mortimer, J. Mulcahy, R. K. Rathbun, G. Bagby, W. H. Fleming, and M. Grompe
In Vivo Selection of Wild-Type Hematopoietic Stem Cells in a Murine Model of Fanconi Anemia
Blood, September 15, 1999; 94(6): 2151 - 2158.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. S. Haneline, T. A. Gobbett, R. Ramani, M. Carreau, M. Buchwald, M. C. Yoder, and D. W. Clapp
Loss of FancC Function Results in Decreased Hematopoietic Stem Cell Repopulating Ability
Blood, July 1, 1999; 94(1): 1 - 8.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Haneline, L. S.
Right arrow Articles by Clapp, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Haneline, L. S.
Right arrow Articles by Clapp, D. W.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1998 by American Society of Hematology         Online ISSN: 1528-0020