|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 11 (June 1), 1998:
pp. 4092-4098
Multiple Inhibitory Cytokines Induce Deregulated Progenitor
Growth and Apoptosis in Hematopoietic Cells From
Fac / Mice
By
Laura S. Haneline,
Hal E. Broxmeyer,
Scott Cooper,
Giao Hangoc,
Madeleine Carreau,
Manuel Buchwald, and
D. Wade Clapp
From the Department of Pediatrics, Herman B Wells Center for
Pediatric Research, Indiana University School of Medicine; the
Department of Microbiology/Immunology, Indiana University School of
Medicine; Walther Oncology Center, Indiana University School of
Medicine, Indianapolis; Walther Cancer Institute, Indianapolis, IN; the
Department of Genetics, Hospital for Sick Children, Toronto, Ontario,
Canada; and the Department of Molecular and Medical Genetics,
University of Toronto, Toronto, Ontario, Canada.
 |
ABSTRACT |
We used a murine model containing a disruption of the murine
homologue (Fac) of Fanconi Anemia group C (FAC)
to evaluate the role of Fac in the pathogenesis of bone marrow
(BM) failure. Methylcellulose cultures of BM cells from
Fac / and Fac+/+ mice
were established to examine the growth of multipotent and lineage-restricted progenitors containing inhibitory cytokines, including interferon- (IFN-), tumor necrosis factor-
(TNF-), and macrophage inflammatory protein-1 (MIP-1).
Clonogenic growth of Fac/ progenitors was
reduced by 50% at 50- to 100-fold lower concentrations of all
inhibitory cytokines evaluated. We hypothesized that the aberrant
responsiveness to inhibitory cytokines in clonogenic cells may be a
result of deregulated apoptosis. To test this hypothesis, we performed
the TUNEL assay on purified populations of primary BM cells enriched
for hematopoietic progenitors or differentiated myeloid cells. After
stimulation with TNF-, accentuated apoptosis was observed in both
populations of Fac/ cells. In addition,
deregulated apoptosis was also noted in the most immature phenotypic
population of hematopoietic cells after stimulation with
MIP-1.Together these data suggest a role of Fac in affecting
the signaling of multiple cytokine pathways and support
cytokine-mediated apoptosis as a major mechanism responsible for BM
failure observed in FA patients.
| |
INTRODUCTION |
FANCONI ANEMIA (FA) is a complex genetic
disorder characterized by progressive acquisition of bone marrow (BM)
aplasia, chromosomal instability, predisposition to malignancies, and
hypersensitivity to bifunctional alkylating agents.1-4 At
least eight complementation groups have been identified on the basis of
somatic cell fusion studies that result in a generally similar
phenotype.5,6 Three of the eight complementation groups (A,
C, and D) have been mapped to different chromosomal
loci,5,7,8 and the cDNAs of the A and C genes have been
identified.9-11 Unfortunately, the cloning of the A and C
genes have not provided insight into the function of FA genes in
cellular homeostasis.
Maintenance of normal hematopoiesis involves complex interactions
between the stem/progenitor cells and multiple stimulatory and
inhibitory molecules.12,13 The observation that Fanconi anemia complementation type C (FAC) patients acquire a progressive BM
failure suggests that FAC plays a role in proliferation and/or survival of hematopoietic stem and progenitor cells. BM aplasia may
occur by multiple mechanisms including alterations in the production or
intracellular signaling of stimulatory and inhibitory cytokines. Two
murine models containing a disruption of the murine homologue of FAC
(Fac) have recently been developed to facilitate functional
studies in primary cells in vitro and in vivo.14,15 Chen et
al14 created a disruption in exon 8 of Fac, while
Whitney et al15 used homologous recombination to create a
disruption in exon 9. In both models, spontaneous chromosomal
aberrations were observed, as well as an increase in chromosome breaks
in splenic lymphocytes in response to bifunctional alkylating agents analogous to lymphocytes in FA patients.14,15
Whitney showed that hematopoietic progenitors from mice containing a
disruption of Fac (Fac/) were
hypersensitive to IFN- and, recently, Rathbun et al, using the model
developed by Whitney,15 determined that low doses of
IFN- affected programmed cell death in
Fac/ hematopoietic progenitors by
inducing Fas expression. Similar results were obtained in studies
using primary cells from a patient with Fanconi anemia type
C.16
Other inhibitory cytokines, such as tumor necrosis factor-
(TNF-), have also been implicated in the pathogenesis of aplastic anemia.17 In addition, TNF- is frequently elevated in
patients with Fanconi anemia.18,19 TNF- is known to
induce Fas-mediated apoptosis,17 as well as an alternative
apoptosis pathway involving TNF- receptor-associated death domain
(TRADD).20 On the basis of these observations, we
hypothesized that Fac-deficient cells may be hypersensitive to
TNF- and potentially other inhibitory cytokines.
In this report, using a genetically distinct model14 from
that previously used by Whitney,15 we confirm that
disruption of both alleles of Fac
(Fac/) results in deregulated
colony formation in response to IFN-. We also show that a disruption
in exon 8 of Fac results in a hypersensitive reduction in
progenitor growth in cultures containing TNF- as well as another
inhibitory cytokine macrophage inflammatory protein-1 (MIP-1). Further, we show that Fac is crucial for prevention of TNF- and MIP-1-mediated apoptosis in primary immature
myeloid hematopoietic cells. Finally, we observed altered proliferation kinetics in pluripotent and lineage restricted
Fac/ hematopoietic progenitors in
vivo. These results implicate deregulated apoptosis in response to
inhibitory cytokines in the pathogenesis of BM aplasia in Fanconi
anemia type C.
| |
MATERIALS AND METHODS |
Mice.
Heterozygote Fac mice14 were housed in our animal
facility. DNA was extracted from mouse tails using a standard
phenol-chloroform method. Genotyping was conducted by amplifying
sequences unique to exon 8 and neomycin resistance gene by polymerase
chain reaction (PCR). The following primers were used:
5 CCTGCCATCTTCAGAATTGT3 (exon 8 primer),
5GAGCAACACAAATGGTAAGG3 (intron 8 primer), and 5TTGAATGGAAGGATTGGAGC3 (neomycin resistance gene
primer).
Cells.
BM cells were flushed from femurs and tibias of
Fac/ and Fac+/+
littermate controls with Iscove's modified Dulbecco's medium (IMDM) (GIBCO-BRL, Gaithersburg, MD) supplemented with 5% fetal calf serum
(FCS) (Hyclone, Logan, UT). Spleen cell suspensions were prepared by
flushing cells from spleens and passing cells through a 23-gauge
needle. Total nucleated cell number of BM and spleens was determined
before manipulation of cells for further experimentation. Low-density
mononuclear cells (LDMNC) were prepared by centrifugation on
Ficoll-Hypaque (density 1.119; Sigma Chemical Co, St Louis, MO).
Unfractionated BM and spleen cells were used in all experiments except
for mitomycin C (MMC) dose-response experiments, which used LDMNC.
Clonogenic assays.
Clonogenic methylcellulose assays were plated in triplicate at 1 × 104 to 5 × 104 BM cells/mL and 5 × 105 spleen cells/mL. Cultures were established in
1% IMDM methylcellulose (Stem Cell Technology, Vancouver, BC, Canada),
with 30% FCS, 50 ng/mL recombinant murine Steel factor (a generous
gift from Immunex, Seattle, WA) or SCF (Peprotech, Rocky Hill, NJ), 4 U/mL recombinant human erythropoietin (Amgen), 5% vol/vol pokeweed
mitogen spleen conditioned media (PWMSCM) and 0.1 mmol hemin (Sigma).
Cells were incubated at 37°C, 5% CO2, and lowered
(5%) O2. BM cells were cultured in methylcellulose
progenitor assays with increasing concentrations of MMC (Sigma),
recombinant murine IFN- (R&D Systems, Minneapolis, MN), recombinant
murine TNF- (R&D Systems), recombinant murine MIP-1 (R&D
Systems), and thrombopoietin (Genzyme, Cambridge, MA) to generate
dose-response curves for Fac/ and
Fac+/+ hematopoietic progenitor cells. Cultures to
establish the responsiveness of Fac/
cells to MMC were conducted exactly as above, except recombinant murine
GM-CSF (Peprotech) was substituted for PWMSCM, and cultures were
incubated at 21% O2. CFU-GM, BFU-E, and CFU-GEMM colonies were scored on day 7 of culture. Levels of significance were determined using Student's t-distribution.
Progenitor suicide assays.
The proportion of hematopoietic progenitor cells in S phase was
estimated by means of suicide assays that used either
3H-thymidine or hydroxyurea as previously
described.21-23 BM and spleen cells were pulse-treated for
30 minutes at 37°C with either high specific activity
3H-thymidine (50 mCi/mL, specific activity = 20 Ci/mmol;
New England Nuclear, Boston, MA) or control medium. Cells were washed
twice with control medium before plating in methylcellulose cultures as
described above. The percentage suicide was determined by the following
calculation: (progenitors in control  progenitors in 3H-thymidine) divided by progenitors in control. The level
of significance was determined using Student's t-test. These
results were compared with the percentage suicide determined by
treatment of cells with hydroxyurea (HU) as described
elsewhere.23
TUNEL assay.
Pooled samples of BM LDMNC from four
Fac/ and four
Fac+/+ animals were stained with Sca1-PE,
B220-FITC, and CD3-FITC (PharMingen, San Diego, CA) for 15 minutes at
4°C, washed twice, and sorted by a Becton Dickinson fluorescence
activated cell sorter for
Sca1+B220CD3 and
Sca1B220CD3.
Sca1+B220CD3 cells
were incubated at a density of 2 × 105 cells/mL in a
96-well tissue culture plate in IMDM 20% FCS and were cultured in the
following combinations of cytokines: (1) GM-CSF (200 ng/mL) and SCF
(100 ng/mL) only, (2) GM-CSF and SCF together with 1 ng/mL TNF- or
100 ng/mL MIP-1, and (3) TNF- (1 ng/mL) or MIP-1 (100 ng/mL).
Cultures containing
Sca1B220CD3
cells were established at a density of 2 × 106
cells/mL using the same concentrations of GM-CSF, TNF-, and MIP-1
as above described for
Sca1+B220CD3. After
24 hours, cytospins were made for each condition.
Apoptosis was evaluated using the terminal deoxynucleotidyl transferase
(tDt)-mediated dUTP nick end-labeling (TUNEL) assay24 as
specified by the manufacturer (Boehringer Mannheim, Indianapolis, IN).
Briefly, cells were fixed with 4% formaldehyde (Sigma) for 30 minutes
at room temperature and permeabilized with 0.1% sodium citrate (Fisher
Scientific, Fair Lawn, NJ) 0.1% Triton-X100 (Boehringer Mannheim) for
2 minutes at 4°C. Cells were incubated with tDt and dUTP-FITC in a
humidified environment at 37°C, 5% CO2 for 1 hour.
After incubation, cytospins were evaluated by fluorescence microscopy.
Photographs were obtained of each condition and scoring of apoptotic
cells was conducted. As an independent control to verify the function
of the assay, BM cells were irradiated (700 rads) and then maintained
in liquid culture for 24 hours. The TUNEL assay was performed on these
cells with and without the addition of tDt as positive and negative
controls respectively. Three or four independent experiments were
conducted with each inhibitory cytokine. Statistical significance was
determined using the Student's t-test.
| |
RESULTS |
Fac/ hematopoietic progenitor cells
are hypersensitive to MMC.
A characteristic feature of Fanconi anemia is the hypersensitivity of
cells to clastogenic agents such as mitomycin C. Because FA patients
have defects in hematopoietic progenitor cell function, it was critical
to determine whether hematopoietic progenitors from
Fac/ mice were hypersensitive to MMC
as observed in FA patients. As shown in Fig
1, a 50% reduction in maximal colony formation was observed at a
10-fold lower concentration of MMC in
Fac/ progenitors as compared with
Fac+/+ littermates. We conclude that the MMC
hypersensitivity observed in Fac/
progenitors is remarkably similar to that seen in FA patients.
View larger version (13K):
[in this window]
[in a new window]
| Fig 1.
MMC hypersensitivity of Fac/
hematopoietic progenitor cells. BM LDMNC from
Fac/ ( ) and Fac+/+
( ) animals were cultured in clonogenic methylcellulose progenitor assays at 1 × 104 cells/mL with increasing concentrations
of MMC. Each condition was plated in triplicate. The total number of
colony-forming units (CFU) per 1 × 104 LDMNC was
determined on day 7 of culture. Error bars represent standard error of
the means (SEM). Fac/ hematopoietic
progenitor cells were significantly more sensitive to MMC at 5-, 10-, 50-, and 100-nmol concentrations. n = 6 for each group. *P < .05.
|
|
Fac/ hematopoietic progenitor cells
are hypersensitive to multiple inhibitory cytokines.
IFN-, TNF-, and MIP-1 are cytokines known to inhibit
hematopoietic cell growth.25-29 We examined the effect of
these inhibitory cytokines on growth of multipotential and lineage
restricted progenitor cell growth of Fac mice in vitro
(Fig 2). Multipotent (CFU-GEMM), erythroid
(BFU-E), and granulocyte-macrophage (CFU-GM) progenitors cultured from
Fac/ BM cells showed a 50% reduction
in maximal colony formation at a 50- to 100-fold lower concentration of
each of the respective cytokines as compared with progenitors cultured
from WT mice. No differences in colony formation were observed between
Fac/ and Fac+/+
hematopoietic progenitors when increasing concentrations of a noninhibitory cytokine (thrombopoietin) were added to the cultures (data not shown).
View larger version (23K):
[in this window]
[in a new window]
| Fig 2.
Hypersensitivity of Fac/
hematopoietic progenitors to inhibitory cytokines. Unfractionated BM
cells from / () and +/+ ()
animals were cultured in triplicate in clonogenic methylcellulose progenitor assays at 5 × 104 cells/mL with increasing
concentrations of IFN- (0.1, 0.5, 1, 5, and 10 ng/mL), TNF- (0.1, 0.5, 1, 5, 10 ng/mL), or MIP-1 (1, 5, 10, 50 ng/mL). After 7 days in
culture, CFU-GM, BFU-E, and CFU-GEMM were scored. Percentage maximal
colony formation was determined by dividing the number of progenitors
scored at a given concentration of cytokine by the number of
progenitors scored without the addition of inhibitory cytokine. The
range of control numbers upon which the percentage change are based: +/+ CFU-GM 77-141, BFU-E 41-43, CFU-GEMM,11-13 and / CFU-GM 80-154, BFU-E
11-43, and CFU-GEMM.5-13 The error bars represent SEM.
CFU-GM, BFU-E, and CFU-GEMM from Fac/
unfractionated BM cells were significantly more sensitive to IFN-,
TNF-, and MIP-1 at multiple cytokine concentrations. n = 4 for
each group. *P < .05.
|
|
Increased apoptosis in immature and differentiated myeloid
hematopoietic cells from Fac/ mice
after stimulation with TNF- and MIP-1.
To test whether Fac/ cells are
predisposed to TNF-- or MIP-1-mediated apoptosis, two
populations of hematopoietic cells were cultured in the presence of
TNF- or MIP-1, then analyzed by the TUNEL assay. One population
was highly enriched for myeloid hematopoietic progenitors
(Sca1+B220CD3), and a
second population was highly enriched for myeloid differentiated cells
(Sca1B220CD3).
More than 90% of
Sca1B220CD3
cells had macrophage (Mac1) or granulocyte (GR-1) surface markers (data
not shown). Figure 3 shows representative
examples of
Sca1+B220CD3 cells
after liquid culture with TNF- and TUNEL assay. The summary of
experiments evaluating apoptosis of
Fac/ cells in response to TNF- are
shown in Table 1. Low equivalent levels of
apoptosis were observed in both Fac/
and Fac+/+ cells when cultured with GM-CSF and SCF;
cytokines that protect hematopoietic cells from
apoptosis.30,31 The addition of TNF- to cultures
containing GM-CSF and SCF resulted in increased apoptosis in
Fac/ primitive myeloid cells, but not
in the Fac+/+ cells. When hematopoietic cells were
cultured with TNF- alone, a dramatic increase in apoptosis was
observed in immature
(Sca1+B220CD3) and
differentiated
(Sca1B220CD3)
myeloid cells from Fac/ mice.
View larger version (52K):
[in this window]
[in a new window]
| Fig 3.
Increased apoptosis of
Sca1+B220CD3 and
Sca1B220CD3 cells from
Fac/ mice in response to TNF-. BM LDMNC
from Fac/ and Fac+/+
animals were purified by fluorescence cytometry for
Sca1+B220CD3 and
Sca1B220CD3 cells. These
two populations of cells were incubated in liquid culture for 24 hours
with growth factors alone, growth factors plus TNF- (1 ng/mL), or
TNF- alone. TUNEL assays were conducted on cytospins of each
condition. A total of 100 to 200 cells were evaluated to determine the
percentage of apoptotic cells in each condition.
Sca1+B220CD3 cells in
conditions containing TNF- are depicted. In
Fac/ mice, the percentage of
Sca1+B220CD3 cells that are
apoptotic increases significantly when cultured with TNF-.
|
|
Experiments evaluating apoptosis in
Fac/ cells after culture with
MIP-1 are summarized in Table 2. Again,
low levels of apoptosis were detected in
Fac/ and Fac+/+
primitive and differentiated cells when cultured with GM-CSF and SCF.
Similar levels of apoptosis were observed when MIP-1 was added to
the cultures. However, culture of
Sca1+B220CD3 cells
from Fac/ mice with MIP-1 alone
resulted in a dramatically increased level of apoptosis as compared
with Fac+/+ mice whose level of apoptosis was
unchanged from conditions with protective cytokines. A trend (though
not statistically significant) toward increased apoptosis was observed
in Sca1B220CD3
cells from Fac/ mice. Together these
data are consistent with the enhanced growth inhibition of
Fac/ progenitors in response to
TNF- and MIP-1 observed in the clonogenic assays (Fig 2).
Increased suicide in hematopoietic progenitor cells cultured from
Fac/ mice.
The maintenance of normal hematopoietic cell populations results from a
complex homeostasis of cell production and apoptosis. To determine
whether there were differences in the absolute number of progenitors
per organ in mice homozygous for disruption of Fac,
methylcellulose cultures of splenic and BM cells were established. The
absolute number of progenitors in the BM and spleen as well as total
nucleated cells per organ of Fac/
mice were similar to those of their Fac+/+
littermates (Table 3). Because
Fac/ hematopoietic progenitors are
hypersensitive to multiple inhibitory cytokines and both immature and
differentiated myeloid cells undergo increased apoptosis in response to
TNF- and MIP-1, it is curious that
Fac/ mice have equivalent numbers of
myeloid progenitors and differentiated cells as
Fac+/+ mice (Table 3). We hypothesized that if
deregulated apoptosis were occurring in vivo,
Fac/ progenitors may exhibit abnormal
proliferation kinetics. To investigate this hypothesis, BM and spleen
cells from Fac/ and
Fac+/+ mice were pulse treated with tritiated
thymidine or hydroxyurea and cultured in methylcellulose for growth of
progenitors. The percentage suicide of multipotential (CFU-GEMM),
erythroid (BFU-E), and granulocyte-macrophage (CFU-GM) progenitors in
both the spleen and BM was dramatically higher in
Fac/ mice as compared with
Fac+/+ controls (Table 3). The percentage suicide
was comparable using either tritiated thymidine or hydroxyurea. These
data infer that an increased proportion of clonogenic hematopoietic
progenitors from Fac/ mice are in S
phase and that altered proliferation kinetics exist in vivo.
View this table:
[in this window]
[in a new window]
|
Table 3.
Comparative Analysis of Absolute Numbers and Cycling
Status of Myeloid Progenitor Cells From Bone Marrow and Spleen of
Fac/ and Wild-Type Littermate
Controls
|
|
| |
DISCUSSION |
The development of murine models using homologous recombination to
delete the murine homologue of a gene known to cause human disease is
extremely useful for understanding the normal function of the gene, the
pathogenesis of the human disease, and potential treatment strategies.
Some murine models replicate the human disease completely, whereas the
phenotype of other models is somewhat variant from the human
disease.32 A characteristic feature of Fanconi anemia is
the hypersensitive reduction in growth of hematopoietic progenitors
cultured in methylcellulose in the presence of MMC. Therefore, it was
critical to determine whether hematopoietic progenitors cultured from
Fac/ mice used in these studies were
hypersensitive to MMC. The observation that hematopoietic progenitors
derived from the murine BM are hypersensitive to MMC is particularly
significant because it supports using this model to gain insight into
the molecular mechanisms involved in the development of the progressive
BM failure in FA patients.
BM failure or acquisition of myeloid leukemia, or both, are the most
common causes of mortality in patients with FA.33,34 The
precise role of FA genes in maintaining normal hematopoietic cellular
homeostasis is the current challenge of many
laboratories.35 The role of FA proteins in DNA
repair,36 redox status of the cell,37-39 and
apoptosis38,40,41 are three active areas of investigation.
Cumming et al40 provided evidence that FAC may have a role
in apoptosis when they demonstrated that overexpression of FAC
in a megakaryocytic IL-3-dependent cell line (MO7e cells), resulted in
the prevention of growth factor dependent apoptosis. Other studies
reported increased spontaneous apoptosis in FA lymphoblasts but
decreased apoptosis when stressed with -irradiation as compared with
lymphoblasts derived from normal donors.41 Although these studies in immortalized cell lines implicate FAC in the modulation of
apoptosis, it is difficult to determine how accurately they reproduce
the biochemical defect and cellular physiology of primary hematopoietic
progenitor cells.
Rathbun et al16 recently made the first observation that
deregulated apoptosis was evident in primary
Fac/ hematopoietic progenitor cells
These investigators reported data demonstrating decreased clonogenic
growth in human and murine Fac/
progenitors in response to IFN- and/or anti-Fas activating
antibody, which infers an increased sensitivity to Fas-mediated
apoptosis.16 We chose to extend those observations by
evaluating multiple inhibitory cytokines that modulate hematopoietic
cell growth by alternative intracellular signaling
pathways.17,20,42-44 IFN- and TNF- have been
implicated in the pathogenesis of acquired aplastic anemia by
upregulating Fas expression on hematopoietic cells.19,42,43 TNF- has additional signaling mechanisms to regulate apoptosis through TNF receptor associated proteins, such as TRADD and
receptor-interacting protein (RIP), and activation of
NF- B.20 MIP-1 is a chemokine that appears to induce
growth inhibition through the Raf-1 kinase pathway.44 A
further distinction between MIP-1 and both TNF- and IFN- is
that TNF- and IFN- induce apoptosis in normal hematopoietic cells
at high cytokine concentrations,45 whereas MIP-1 had not
yet been evaluated for induction of apoptosis.
Our data, using a genetically distinct murine model, confirm previous
findings that homozygous disruption of Fac results in hypersensitivity to IFN-.15,16 This hypersensitivity is
particularly interesting as few data are available regarding the role
of inhibitory cytokines in other genomic instability
syndromes.46-49 In addition to hypersensitivity of
Fac/ progenitors to IFN-, we have
shown decreased clonogenic growth in response to TNF- and MIP-1
which was not observed previously.15 Furthermore, our data
also support the concept of Fac directly or indirectly
influencing programmed cell death by showing TNF- and MIP-1
induced apoptosis using a methodology that permitted direct detection
of apoptosis in primary progenitor and differentiated cells. We showed
that purified populations of primary cells enriched for either
hematopoietic progenitor or myeloid differentiated cells from
Fac/ mice undergo increased
cytokine-mediated apoptosis after culture with TNF- alone or in
combination with cytokines that protect hematopoietic cells from
apoptosis. In addition, we showed that primitive myeloid cells
(Sca1+B220CD3)
undergo enhanced apoptosis when cultured with MIP-1 as a single cytokine. This is the first description of a chemokine inducing apoptosis in hematopoietic cells. Together our findings and previous data16 are consistent with the hypothesis that there is a
progressive loss of hematopoietic progenitor and stem cells in
Fac/ mice and FA patients resulting
directly or indirectly from inhibitory cytokine-mediated apoptosis.
We hypothesized that if apoptosis is involved in the pathogenesis of FA
BM failure in vivo in Fac/ mice, an
increase in the number of proliferating hematopoietic progenitors would
be required to sustain normal numbers of differentiated cells. To test
this hypothesis we evaluated the suicide of hematopoietic progenitors
using two independent agents. The markedly increased suicide observed
in multipotent and lineage-restricted clonogenic cells from BM and
spleen of Fac/ mice supports the
hypothesis that a higher proportion of
Fac/ hematopoietic progenitors in
vivo are cycling due to loss of immature and differentiated cells from
increased apoptosis. Alternatively, the increased suicide rate observed
in Fac/ progenitors may reflect an
increased sensitivity to tritium and hydroxyurea. The rationale for
using hydroxyurea as an agent to assess the cycling status of
clonogenic progenitors was because of recent data showing that
FAC-deficient lymphoblast cell lines exhibit normal cell-cycle kinetics
after 24-hour exposure to the drug.50 The lack of
hypersensitivity to hydroxyurea and the similar suicide rates between
the two agents support the hypothesis that the increased suicide rate
in Fac/ progenitors is due to an
accelerated proportion of clonogenic cells in S phase, rather than to
hypersensitivity to the agents used to conduct these studies. However,
to further delineate and confirm that an increased proportion of
Fac/ progenitor cells are in S phase,
future studies evaluating phenotypically defined populations of cells
are indicated.
In summary, we have shown that loss of Fac results in
deregulated apoptosis in myeloid hematopoietic cells in response to inhibitory cytokines with distinctive intracellular signaling pathways.
It will be interesting in future experiments to evaluate how the loss
of Fac disturbs the tightly regulated intracellular signaling
of IFN-, TNF-, and MIP-1 in mediating hematopoietic cell
growth. Fac/ mice provide a valuable
model system to evaluate the role of Fac in myeloid growth
control.
| |
FOOTNOTES |
Submitted August 8, 1997;
accepted January 23, 1998.
Supported by US Public Health Services Grants No. PO1 GK53586, P50
DK49218, RO1 HL56416, RO1 HL54037, R29 CA74177-01, and IF32 HL09851-01,
and by the National Cancer Institute of Canada, Bayer Red Cross
Program, and International Fanconi Anemia Research Foundation.
Address reprint requests to D. Wade Clapp, MD, Departments of
Pediatrics and Microbiology/Immunology, Herman B Wells Research Center,
702 Barnhill Dr, Cancer Center 421, Indianapolis, IN 46202.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
We thank our colleagues at Indiana University and Dr Kevin Shannon
(University of California, San Francisco) for reading the manuscript. We also thank Patricia Fox for secretarial support.
| |
REFERENCES |
1.
Auerbach A:
Fanconi anemia and leukemia: Tracking the genes.
Leukemia
6:1,
1992
2.
Auerbach A:
Fanconi anemia diagnosis and the diepoxybutane (DEB) test.
Exp Hematol
21:731,
1993[Medline]
[Order article via Infotrieve]
3.
Buchwald M,
Ng J,
Clarke C,
Duckworth-Rysiecki G:
Studies of gene transfer and reversion to mitomycin C resistance in Fanconi anemia cells.
Mutat Res
184:153,
1987[Medline]
[Order article via Infotrieve]
4.
Schroeder T,
Tilgen D,
Kruger D,
Vogel F:
Formal genetics of Fanconi's anemia.
Hum Genet
32:257,
1976[Medline]
[Order article via Infotrieve]
5.
Strathdee CA,
Duncan AMV,
Buchwald M:
Evidence for at least four Fanconi Anemia genes including FACC on chromosome 9.
Nature Genet
1:196,
1992[Medline]
[Order article via Infotrieve]
6.
Joenje H,
Oostra AB,
Wijker M,
di Summa FM,
van Berkel CGM,
Rooimans MA,
Ebell W,
van Weel M,
Pronk JC,
Buchwald M,
Arwert F:
Evidence for at least eight Fanconi anemia genes.
Am J Hum Genet
61:940,
1997[Medline]
[Order article via Infotrieve]
7.
Pronk JC,
Gibson RA,
Savoia A,
Wijker M,
Morgan NS,
Melchionda S,
Ford D,
Temtamy S,
Ortega JJ,
Jansen S,
Harenga C,
Cohn RJ,
de Ravel TJ,
Roberts I,
Westerveld A,
Easton DJ,
Joenje H,
Mathew CG,
Arwert F:
Localization of the Fanconi anemia complementation group A gene to chromosome 16q24.3.
Nature Genet
11:338,
1995[Medline]
[Order article via Infotrieve]
8.
Whitney M,
Thayer M,
Reifsteck C,
Olson S,
Smith L,
Jakobs PM,
Leach RK,
Naylor S,
Joenje H,
Grompe M:
Microcell mediated chromosome transfer maps the Fanconi anemia groups D gene to chromosome 3p.
Nature Genet
11:341,
1995[Medline]
[Order article via Infotrieve]
9.
Strathdee C,
Gavish H,
Shannon W,
Buchwald M:
Cloning of cDNAs for Fanconi's anaemia by functional complementation.
Nature
356:763,
1992[Medline]
[Order article via Infotrieve]
10.
Lo Ten Foe JR,
Rooimans MA,
Bosnoyan-Collins L,
Alon N,
Wijker M,
Parker L,
Lightfoot J,
Carreau M,
Callen DF,
Savoia A,
Cheng NC van Berkel CG,
Strunk MH,
Gille JJ,
Pals G,
Kruyt FA,
Pronk JC,
Arwert F,
Buchwald M,
Joenje H:
Expression cloning of a cDNA for the major Fanconi anaemia gene, FAA.
Nature Genet
14:320,
1996[Medline]
[Order article via Infotrieve]
11.
The Fanconi anaemia/breast cancer consortium:
Positional cloning of the Fanconi anaemia group A gene.
Nature Genet
14:324,
1996[Medline]
[Order article via Infotrieve]
12.
Broxmeyer HE:
Suppressor cytokines and regulation of myelopoiesis: Biology and possible clinical uses.
Am J Pediatr
14:22,
1992
13.
Broxmeyer HE:
Myelosuppressive cytokines and peptides
, in Whetton T,
Gordon T
(eds):
Hemopoietic Growth Factors. Blood Cell Biochemistry, vol 7.
London, UK, Plenum
, 1996
, p 121
14.
Chen M,
Tomkins D,
Auerbach W,
McKerlie C,
Youssoufian H,
Liu L,
Gan O,
Carreau M,
Auerbach A,
Groves T,
Guidos C,
Freedman M,
Cross J,
Percy D,
Dick J,
Joyner A,
Buchwald M:
Inactivation of Fac in mice produces inducible chromosomal instability and reduced fertility reminiscent of Fanconi anaemia.
Nature Genet
12:448,
1996[Medline]
[Order article via Infotrieve]
15.
Whitney M,
Royle G,
Low M,
Kelly M,
Axthelm M,
Reifsteck C,
Olson S,
Braun R,
Heinrich M,
Rathbun R,
Bagby G,
Grompe M:
Germ cell defects and hematopoietic hypersensitivity to -interferon in mice with a targeted disruption of the Fanconi anemia C gene.
Blood
88:49,
1996[Abstract/Free Full Text]
16.
Rathbun RK,
Faulkner GR,
Ostroski MH,
Christianson TA,
Hughes G,
Jones G,
Cahn R,
Maziarz R,
Royle G,
Keeble W,
Heinrich MC,
Grompe M,
Tower PA,
Bagby GC:
Inactivation of the Fanconi Anemia Group C gene augments interferon--induced apoptotic responses in hematopoietic cells.
Blood
90:974,
1997[Abstract/Free Full Text]
17.
Maciejewsk IJ,
Selleri C,
Anderson S,
Young N:
Fas antigen expression on CD34+ human marrow cells is induced by interferon and tumor necrosis factor and potentiates cytokine-mediated hematopoietic suppression in vitro.
Blood
85:3183,
1995[Abstract/Free Full Text]
18.
Schultz J,
Shahidi N:
Tumor necrosis factor-alpha overproduction in Fanconi's anemia.
Am J Hematol
42:196,
1993[Medline]
[Order article via Infotrieve]
19.
Rosselli F,
Sanceau J,
Gluckman E,
Wietzerbin J,
Moustacchi E:
Abnormal lymphokine production: A novel feature of the genetic disease Fanconi anemia. II. In vitro and in vivo spontaneous overproduction of tumor necrosis factor alpha.
Blood
83:1216,
1994[Abstract/Free Full Text]
20.
Liu Z,
Hsu H,
Goeddel DV,
Karin M:
Dissection of TNF receptor 1 effector functions: JNK activation is not linked to apoptosis while NF-B activation prevents cell death.
Cell
87:565,
1996[Medline]
[Order article via Infotrieve]
21.
Broxmeyer H,
Cooper S,
Williams D,
Hangoc G,
Gutterman J,
Vadhan-Raj S:
Growth characteristics of marrow hematopoietic progenitor/precursor cells from patients on a phase I clinical trial with purified recombinant human granulocyte-macrophage colony-stimulating factor.
Exp Hematol
16:594,
1988[Medline]
[Order article via Infotrieve]
22.
Broxmeyer H,
Benninger L,
Cooper S,
Hague N,
Benjamin R,
Vadhan-Raj S:
Effects of in vivo treatment with PIXY321 (GM-CSF/IL3 fusion protein) on proliferation kinetics of bone marrow and blood myeloid progenitor cells in patients with sarcoma.
Exp Hematol
23:335,
1995[Medline]
[Order article via Infotrieve]
23.
Broxmeyer HE,
Baker F,
Galbraith:
Relationship of colony stimulating activity to apparent kill of human colony forming cells by irradiation and hydroxyurea.
Blood
47:403,
1976[Abstract/Free Full Text]
24.
Negoescu A,
Lorimier P,
Labat-Molieur F,
Azoti L,
Robert C,
Guillermet C,
Brambilla C,
Brambilla E:
TUNEL: Improvement and evaluation of the method for in situ apoptotic cell identification.
Biochemica
2:12,
1997
25.
Broxmeyer HE,
Lu L,
Platzer E,
Feit C,
Juliaro L,
Rubin BY:
Comparative analysis of the influences of human gamma, alpha and beta interferons on human multipotential (CFU-GEMM), erythroid (BFU-E), and granulocyte-macrophage (CFU-GM) progenitor cells.
J Immunol
131:1300,
1993 |
Abstract
Introduction
Abstract