|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 11 (June 1), 1998:
pp. 4164-4172
Fluid Shear Stress Attenuates Tumor Necrosis Factor- -Induced
Tissue Factor Expression in Cultured Human Endothelial Cells
By
Yutaka Matsumoto,
Yohko Kawai,
Kiyoaki Watanabe,
Kazuo Sakai,
Mitsuru Murata,
Makoto Handa,
Shin Nakamura, and
Yasuo Ikeda
From the Departments of Internal Medicine, Laboratory Medicine, and
Blood Center, Keio University, School of Medicine, Tokyo; and the
Department of Cellular and Molecular Biology, Primate Research
Institute, Kyoto University, Aichi, Japan.
 |
ABSTRACT |
Hemodynamic forces modulate various endothelial cell functions under
gene regulation. Previously, we have shown that fibrinolytic activity
of endothelial cells is enhanced by the synergistic effects of shear
stress and cytokines. In this study, we investigated the effect of
shear stress on tumor necrosis factor (TNF)- -induced tissue factor
(TF) expression in cultured human umbilical vein endothelial cells
(HUVECs), using a modified cone-plate viscometer. Shear stresses at
physiological levels reduced TNF- (100 U/mL)-induced TF expression
at both mRNA and antigen levels, in a shear-intensity and exposure-time
dependent manner, whereas shear stress itself did not induce TF
expression in HUVECs. TF expressed on the cell surfaces measured by
flow cytometry using an anti-TF monoclonal antibody (HTF-K180) was also
decreased to one third by shear force applied at 18 dynes/cm2 for 15 hours before and 6 hours after TNF-
stimulation. Furthermore, functional activity of TF, as assessed by the
activation of factor X in the presence of FVIIa and Ca2+,
was also decreased by shear application. However, the stability of TF
mRNA was not decreased in the presence of shear stress. These results
suggest that shear force acts as an important regulator of TF
expression in endothelium at the transcriptional level.
 |
INTRODUCTION |
BY VIRTUE OF THEIR contact with blood
flow, endothelial cells are continuously exposed to fluid shear stress,
a tangential force generated by the velocity gradient in viscous fluid
flow. Recently, several lines of evidence have identified shear stress as an important regulator of the structure and function of endothelial cells.1-3 In addition, some of these flow-induced changes
in endothelial function were shown to be regulated at the
transcriptional level.1-6 Common promoter elements
interacting with shear stress-induced transcriptional factors, known as
shear stress responsive element (SSRE) have been reported, including
SSRE found in the platelet-derived growth factor (PDGF)-B
gene4 and phorbol ester TPA (phorbol 12-tetradecanoate
13-acetate)-responsive elements (TRE) found in the bovine
monocyte chemotactic protein (MCP)-1 gene.6 Anti- and
prothrombotic properties are also modulated in response to shear
stress; prostacyclin (PGI2) synthesis7 and
nitric oxide (NO) production8 are enhanced in the presence
of shear force, and the expression of NO synthase9 is also
upregulated at the transcriptional level. The thrombomodulin (TM) gene
is downregulated by shear force in bovine aortic endothelial cells
(BAECs),10 whereas shear stress upregulates TM at the mRNA
level in human umbilical vein endothelial cells (HUVECs).11
In addition, the production of fibrinolytic mediators is also under the
control of shear forces. Diamond et al12,13 reported that
shear force increases the production of tissue plasminogen activator
(t-PA) at the mRNA level. We previously reported that physiological
fluid shear stress increased t-PA release and decreased plasminogen activator inhibitor-1 (PAI-1) secretion, and that shear forces further
altered the effects of cytokines such as interleukin-1 (IL-1 ) and
tumor necrosis factor- (TNF- ), enhancing t-PA secretion and
attenuating the PAI-1 response induced by these
cytokines.14 Thus, the interacting effects of shear forces
and cytokines can enhance fibrinolytic activity at the transcriptional
level in endothelial cells to preserve antithrombogenicity.
Tissue factor (TF) is a single-chain integral membrane protein that
binds factor VII, and the complex in the presence of membrane phospholipids cleaves factor X, thus initiating
coagulation.15 Under normal conditions, endothelial cells
do not express TF and present a nonthrombogenic surface. But when
injured or exposed to stimuli such as cytokines, they rapidly become
capable of initiating blood coagulation. In this procoagulant state,
they synthesize TF as a transmembrane glycoprotein, essential for the
initiation of the extrinsic coagulation pathway.16-19
Although cytokines induce TF expression on cultured endothelium
readily, the expression of TF mRNA and proteins in endothelial cells
was reported to be absent in vivo even in the atherosclerotic
plaque.20 Only restricted expression of TF in endothelial
cells in vivo has been detected under unusual conditions, such as
lethal sepsis21 or invasive breast cancer.22
This discrepancy between observations in vitro and in vivo suggests the
existence of endogenous inhibitory factor(s) for TF expression in vivo.
Grabowski et al23 first reported the effect of flow
conditions on the functional expression of TF and showed that flow
directly augments the functional activity of TF by monolayers of
fibroblasts, but not endothelial cells, in which TF activity is
normally limited even after activation by cytokines, in large part
because of TF pathway inhibitors (TFPI). Recently, Lin et
al24 reported that application of shear stress induced a
transient increase of TF procoagulant activity in HUVECs, which was
accompanied by a rapid and transient induction of mRNA. However, TF
expression on cytokine-stimulated endothelium under shear conditions
has been poorly understood. To investigate whether TF expression is
altered by shear forces in cultured HUVECs in the presence of
cytokines, we analyzed the effect of shear stress on TNF- -induced
TF expression in these cells using a modified cone-plate viscometer. We
found that TNF- -induced expression of TF antigen, activity, and
mRNA is suppressed by shear stress, suggesting that shear force acts as
an intrinsic modulator of TF expression in endothelium.
 |
MATERIALS AND METHODS |
Cell culture.
HUVECs were isolated by the method previously described.14
Briefly, cells from two or three umbilical cords were pooled and
cultured in M199 medium (GIBCO BRL, Grand Island, NY) supplemented with
10% fetal bovine serum (FBS; Seromex, Vilshofen, Germany), 30 µg/mL
of endothelial cell growth supplement (ECGS; Collaborative Research
Inc, Bedford, MA) and 6 U/mL of heparin sodium (Shimizu Pharmaceutical,
Inc, Shizuoka, Japan), and penicillin/streptomycin (GIBCO-BRL). Cells were incubated at 37°C in a
humidified atmosphere of 5% CO2/95% air. For all
experiments, confluent monolayers at second passage were grown in 35-mm
culture dishes coated with type IV collagen (200 µg/mL; Iwaki, Inc,
Chiba, Japan). TF expression was induced by treatment with 100 U/mL of
TNF- (Genzyme Inc, Cambridge, MA).
Shear stress apparatus.
A modified cone-plate type viscometer, originally developed for
measurement of shear stress-induced platelet
aggregation,25,26 was used. The cone-plate chamber was
composed of a rotating cone (30 mm in diameter and 1 degree in cone
angle) made of polymethylmethacrylate and a base plate into which a
35-mm culture dish could be fitted. The distance from the cone apex to
the bottom of the culture dish was adjusted to 0.004 cm by a micrometer
screw. Shear rate ( ) was calculated according to the formula = 6N/ , where N was the rotational speed of the cone and was the
cone angle. Shear stress was calculated by multiplying the shear rate
by the viscosity of the fluid, assumed to be 0.01 poise for the culture
media we used. The cone was rotated at 1.67, 3.33, 5.0, and 6.67 revolutions per second to generate shear stresses of 6, 12, 18, and 24 dynes/cm2, respectively. For the experiments where HUVECs
were stimulated with TNF- after preexposure to shear stress, shear
application was briefly stopped for the TNF- addition and then
restarted.
TF mRNA semiquantification.
TF mRNA levels were semiquantified by a reverse
transcriptase-polymerase chain reaction (RT-PCR) Southern blotting
method. The primers used for amplification of TF mRNA were:
5 ATTCAGTGGGGAGTTCTCCTTCCAGCTCTG3 (antisense primer),
corresponding to nucleotides 925 to 954; and 5 ACTACTGTTTCAGTGTTCAAGCAGTGATTC3 (sense primer),
corresponding to nucleotides 722 to 751, according to Scarpati et
al.27 Primers used for amplification of
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA, used as an
internal standard, were: 5 CAAAGTTGTCATGGATGACC3 (antisense primer), corresponding to nucleotides 480 to 499; and 5 CCATGGAGAAGGCTGGGG3 (sense primer), corresponding to
nucleotides 305-322, according to Tso et al.28 After the
HUVECs were washed with ice-cold phosphate-buffered saline without
calcium and magnesium ions (PBS[ ]), total cellular RNA was
extracted by the acid guanidium thiocyanate-phenol-chloroform
method.29 Reverse transcription of mRNA for TF and GAPDH
was performed in a 50-µL reaction mixture containing 1.5 µg of
total RNA, 500 nmol/L antisense primers for TF and GAPDH, four
deoxynucleotide triphosphates (500 µmol/L each), and 500 U of Moloney
murine leukemia virus (MMLV) reverse transcriptase in a
reaction buffer of 50 mmol/L Tris-HCl (pH 8.3), 75 mmol/L KCl, 3 mmol/L
MgCl 2, and 4 mmol/L dithiothreitol, for 1 hour at 37°C. The
resulting cDNAs for TF and GAPDH were coamplified by PCR for 25 cycles
using a DNA thermal cycler (Perkin Elmer Cetus, Norwalk,
CT). PCR was performed in a 100-µL reaction volume containing 500 nmol/L sense primers, 50 µg/mL of bovine serum albumin
(BSA) and 2 U of Taq DNA polymerase. Each cycle consisted of 1.5 minutes of denaturing at 94°C, 1.5 minutes of annealing at
50°C, and 3 minutes of primer extension at 72°C. After
amplification, each reaction mixture was separated by agarose gel
electrophoresis and blotted to nitrocellulose membranes (0.2-µm pore
size). Prehybridization and hybridization were performed at 65°C as
described previously.30 Random-primed
32P-labeled 660-bp NcoI/HindIII fragments
of human TF cDNA and 800-bp XbaI/PstI fragments of
human GAPDH cDNA (provided by the American Type Culture Collection,
Manassas, VA) were used as probes. After hybridization,
blots were washed twice in 15 mmol/L NaCl, 1.5 mmol/L sodium citrate,
and 0.1% sodium dodecyl sulfate (SDS) at 65°C for 30 minutes and
exposed to x-ray film. Autoradiograms were scanned by a densitometer
(DM-303; Advantec Toyo co.ltd., Tokyo, Japan), and the
signal strength of each TF mRNA was normalized to the corresponding
GAPDH mRNA.
TF antigen measurement.
After being washed with ice-cold PBS( ), HUVECs were lysed in lysis
buffer (50 mmol/L Tris-HCl [pH 8.6], 0.5% Triton X-100, 5 mmol/L
EDTA, and 6 mmol/L N-ethylmaleimide). Cell lysates were centrifuged to
remove nuclei and cytoskeletons, and supernatant was used for TF
antigen determination. TF antigen levels were determined by a highly
sensitive sandwich enzyme-linked immunosorbent assay
(ELISA).31,32 First, 96-well plates were coated with a
monoclonal antihuman TF antibody, HTF-K14, and blocked with BSA. After
TF sample incubation, a second monoclonal antihuman TF antibody,
HTF-K180, conjugated with horseradish peroxidase (HRP), was added to
each well. Then, the sensitivity of the assay was amplified by the
addition of biotinyl-tyramide/H2O2 followed by
incubation with HRP-conjugated streptavidin. After washing, 2,2 -azino-bis(3-ethylbenz-thiazoline-6-sulfonic acid;
ABTS)/H2O2 was added as a substrate. The
reaction was stopped with 0.01% NaN3/0.1 mol/L citric acid
and absorbance at 420 nm was measured with the reference absorbance set
at 630 nm.
Flow cytometry.
After being washed with ice-cold washing buffer (PBS[ ] containing
0.1% NaN3, 1 mmol/L EDTA and 0.5% BSA), HUVECs were
incubated with ice-cold PBS( ) containing 10 mmol/L EDTA and 0.5%
BSA, and detached by gentle pipetting on ice. After centrifugation,
cells were resuspended with ice-cold washing buffer and dispersed into single cells using a syringe connected to a 26G needle. Then, cells
were incubated with aggregated human IgG for Fc receptor blocking,
treated with HTF-K180, and washed twice with washing buffer. After
incubation with fluorescein isothiocyanate (FITC)-labeled antimouse IgG
(Tago, Inc, Burlingame, CA), cells were washed twice, fixed with 2%
paraformaldehyde, and washed again. Flow cytometric analysis was
performed by FACscan (Becton Dickinson, San Jose, CA).
Measurement of TF functional activity.
TF activities of the static, sheared, TNF-stimulated, or TNF-stimulated
and sheared HUVECs were assayed by measuring the enzymatic activation
of factor X by the TF/factor VIIa complex. Monolayers of HUVECs were
washed with Hanks' Balanced Salt Solution, followed by addition of a
reaction buffer containing 2 mmol/L Ca2+, 20 nmol/L factor
VIIa, and 200 nmol/L factor X (Enzymatic Research Laboratories, South
Bend, IN). The reaction time was 20 minutes before the addition of a
stopping buffer containing 7.5 mmol/L EDTA. With the addition of the
chromogen, S-2222 (Chromogenix AB, Mölndal, Sweden),
aliquots of samples were assayed for their absorbance at 405 nm with
the reference absorbance set at 492 nm. The formation rates of factor
Xa in various samples were calculated, based on a standard curve, which
had been established by using known amounts of factor Xa (Enzymatic
Research Laboratories). The production of free chromophore in
femtomoles per square centimeter of monolayer per minute was
calculated. To confirm the specificity of the process for TF, HUVECs
were preincubated for 30 minutes with antihuman TF monoclonal antibody
(10 µg/mL of HTF-K14) or goat antihuman TF polyclonal antibody (15 µg/mL; American Diagnostic Inc, Greenwich, CT). In some experiments,
factor Xa generation was measured in a cell-free system, in which the
reaction was performed in 35-mm culture dishes without HUVECs.
Nuclear and cytoplasmic protein extraction.
After being washed with ice-cold PBS( ), HUVECs were incubated in 200 µL of lysis buffer (10 mmol/L Tris-HCl [pH 8.0], 60 mmol/L KCl, 1 mmol/L EDTA, 1 mmol/L dithiothreitol, 0.5% Nonidet P-40
[NP-40], and 1 mmol/L phenylmethylsulfonyl fluoride) on ice for 5 minutes. Then, lysates were scraped and spun at 400g at 4°C
for 4 minutes. The supernatant was removed and respun at
13,000g for 5 minutes. The supernatants were used as
cytoplasmic extracts. The pelleted nuclei from the first spin were
briefly washed in lysis buffer without NP-40. The nuclear pellet was
then resuspended in 50 µL of nuclear extract buffer (20 mmol/L
Tris-HCl [pH 8.0], 420 mmol/L NaCl, 1.5 mmol/L MgCl2, 0.2 mmol/L EDTA, and 25% glycerol). After a 10-minute incubation at
4°C, the nuclei were briefly vortexed and spun at 13,000g
for 5 minutes. The supernatant was used as the nuclear extract.
Western blotting of p65 subunit of NF B and I B .
Aliquots of cytoplasmic and nuclear extracts were separated by
SDS-polyacrylamide gel electrophoresis with 10% running gels. The
separated proteins were transferred to polyvinylidene difluoride (PVDF)
membranes (Clear Blot Membrane-P; Atto, Tokyo, Japan). The membranes
were blocked in 5% bovine albumin for 1 hour, and then incubated with
1 µg/mL detecting antibody for 1 hour. The antibodies used were
rabbit anti-NF B p65 subunit polyclonal antibody and anti-I B
polyclonal antibody (Chemicon International Inc, Temecula, CA) for
nuclear and cytoplasmic extracts, respectively. The membranes were
washed with Tris-buffered saline (TBS; 10 mmol/L Tris-HCl [pH 8.0],
150 mmol/L NaCl) for 1 hour and further incubated with alkaline
phosphatase-conjugated goat antirabbit IgG (1:1000; Dako, Glostrup,
Denmark) for 1 hour. After the membranes were washed with TBS for 1 hour, the substrate nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (GIBCO BRL) was used to develop the color.
Data analysis.
For comparisons between two groups, statistical analysis was performed
using the Student's t-test. For multiple comparisons, analysis
of variance (ANOVA) followed by the Dunnett test was used. Differences
were considered significant at P < .05.
 |
RESULTS |
Effect of shear stress on the TNF- -induced increase in TF
mRNA.
TF mRNA was undetectable in static, nonstimulated HUVECs by RT-PCR
Southern blotting. However, stimulation of HUVECs with TNF- (100 U/mL) under static conditions resulted in a rapid and transient
increase in TF mRNA, with peak levels at 1 to 3 hours after TNF-
addition (Fig 1). Application of shear
stress to HUVECs at 18 dynes/cm2, a physiological level in
arteries,3,12 attenuated TNF- -induced elevation of TF
mRNA in an exposure time-dependent manner. When shear application
started concomitantly with the addition of TNF- , only a marginal
decrease in TF mRNA was noted (Fig 1A). In this case, the normalized
levels of TF mRNA at 1 or 3 hours after TNF- addition under shear
stress were decreased by 9% or 38%, respectively. However, the longer
the length of preexposure time, the greater the decrease in TF mRNA
expression. When shear application was started at 3 hours before
TNF- addition and continued until RNA sampling, the normalized
levels of TF mRNA at 1 or 3 hours after TNF- addition were decreased
by 15% or 46%, respectively (Fig 1B). When shear stress was applied
for 15 hours before TNF- addition and continued until RNA sampling,
the normalized levels of TF mRNA at 1 or 3 hours after TNF-
addition, were decreased by 76% or 69%, respectively (Fig 1C). In
contrast, application of shear stress itself to HUVECs at 18 dynes/cm2 for 0.5, 1, 2, and 3 hours did not induce any
detectable TF mRNA as assessed by RT-PCR Southern blotting.

View larger version (23K):
[in this window]
[in a new window]

View larger version (11K):
[in this window]
[in a new window]
| Fig 1.
Effect of preexposure time of shear stress on
TNF- -induced increase in TF mRNA in HUVECs. (A) HUVECs were exposed
to shear stress (18 dynes/cm2) or left static for 1, 3, 6, 9, 15, and 24 hours after TNF- (100 U/mL) addition, and then lysed
and processed for RT-PCR Southern blot analysis using
32P-labeled TF cDNA. (B) HUVECs were exposed to shear
stress (18 dynes/cm2) or left static for 3 hours before and
1, 3, and 6 hours after TNF- (100 U/mL) addition, and then processed
as in (A). (C) HUVECs were exposed to shear stress (18 dynes/cm2) or left static for 15 hours before and 1, 3, and
6 hours after TNF- (100 U/mL) addition, and then processed as in
(A). (Left) Autoradiograms of TF and GAPDH RT-PCR products; (right)
densitometric analysis of TF RT-PCR products normalized with respect to
corresponding GAPDH RT-PCR product levels.
|
|
Effect of shear stress on stability of TF mRNA.
To investigate whether the attenuation of TF mRNA by shear force is
dependent on changes in the stability of mRNA, we examined the
stability of TF mRNA in the presence or absence of shear stress. After
treatment of HUVECs with TNF- for 3 hours to induce maximum levels
of TF mRNA, the cells were either exposed to shear stress (18 dynes/cm2) or left static, with the addition of actinomycin
D (10 µg/mL) to the culture medium. Then, total RNA was collected at
30-minute intervals and processed for RT-PCR Southern blotting. As
shown in Fig 2A, a slight increase in mRNA
stability was noted in the presence of shear force. Because the
attenuation of TF mRNA by shear stress is dependent on the length of
preexposure time (Fig 1), we also examined TF mRNA stability under
conditions where shear application of 18 dynes/cm2 was
started 3 hours before TNF- stimulation and continued until RNA
sampling. In this measurement, actinomycin D was added 3 hours after
TNF- addition and total RNA was collected at 0, 15, 30, 60, and 120 minutes after actinomycin D addition. As expected from the result of
Fig 1B, the normalized TF mRNA level in sheared cells at time 0 (when
actinomycin D was added to the medium) was nearly half of that in
control cells (Fig 2B). However, the declining pattern of TF mRNA
levels in sheared cells was similar to that of control cells.
Thus, the stability of TF mRNA after TNF- stimulation was not
lowered in the presence of shear stress.

View larger version (33K):
[in this window]
[in a new window]
| Fig 2.
Effect of shear stress on stability of TF mRNA in HUVECs.
(A) After treatment of HUVECs with TNF- (100 U/mL) for 3 hours, cells were exposed to shear stress (18 dynes/cm2) or left
static for 0.5, 1, 1.5, and 2 hours in the presence of actinomycin D
(10 µg/mL), and then processed as in Fig 1. (B) HUVECs were exposed
to shear stress (18 dynes/cm2) or left static for 3 hours
before and 3 hours after TNF- (100 U/mL) addition and further 0, 0.25, 0.5, 1, and 2 hours in the presence of actinomycin D (10 µg/mL), and then processed as in Fig 1. Data represent mean ± standard deviation (SD) of two separate experiments.
(Left) The representative data from autoradiogram of TF and GAPDH
RT-PCR products; (right) densitometric analysis of TF RT-PCR products
normalized with respect to corresponding GAPDH RT-PCR product levels.
|
|
Effect of shear stress on TF antigen levels in cell lysates.
Under static (0 dynes/cm2) conditions, the TF antigen level
in nontreated cells was very low (137.6 ± 34.3 pg/106
cells), TF antigen increased to 236.0 ± 47.1 pg/106
cells at 1 hour after TNF- stimulation, and reached a maximum of
1,660.9 ± 276.2 pg/106 cells after 6 hours of TNF-
stimulation. Thus, stimulation of HUVECs with TNF- resulted in a
drastic increase in the TF antigen level in the cell lysate, which
could be detected as early as 1 hour after TNF- stimulation
(Fig 3A). Application of shear stress, at
18 dynes/cm2 started 15 hours before TNF- addition and
continued until sampling, attenuated the increase in TF antigen level
in a statistically significant manner (236.0 ± 47.1 pg/106 cells v 99.6 ± 41.6 pg/106
cells at 1 hour, 1,660.9 ± 276.2 pg/106 cells v
782.7 ± 122.7 pg/106 cells at 6 hours after TNF-
addition; P < .05 at all the times examined here).
Furthermore, when shear stress was applied to HUVECs with increasing
intensity from 15 hours before to 6 hours after the addition of
TNF- , shear-intensity-dependent attenuation of the TF antigen level
was observed (Fig 3B). This inhibition was also statistically
significant (1,482.5 ± 99.3 pg/106 cells at 0 dynes/cm2 v 350.1 ± 94.1 pg/106
cells at 18 dynes/cm2; P< .01 at all
shear intensities). In contrast, the application of shear stress itself
at 18 dynes/cm2 did not increase TF antigen levels in cell
lysates (data not shown).

View larger version (22K):
[in this window]
[in a new window]
| Fig 3.
Effect of shear stress on TF antigen levels in cell
lysate. (A) HUVECs were exposed to shear stress (18 dynes/cm2) or left static for 15 hours before and 1, 3, 6, and 9 hours after TNF- (100 U/mL) addition, and TF antigen levels in
cell lysate were measured by ELISA methods. Data represent mean ± SD of three separate experiments. *, Significantly different from static
control at the same time points (P < .05, Student's t-test). **, Significantly different from static
control at the same time points (P < .01, Student's
t-test). ( ), 0 dyne/cm2; ( ), 18 dynes/cm2. (B) HUVECs were exposed to shear
stress (6, 12, 18, and 24 dynes/cm2) or left static for 15 hours before and 6 hours after TNF- (100 U/mL) addition, and TF
antigen levels in cell lysate were measured by ELISA methods. Data
represent mean ± SD of three separate experiments. ***, Significantly
different from static control treated with TNF- (P < .01, ANOVA-Dunnett test).
|
|
Effect of shear stress on TF antigen levels on the cell surface.
To investigate whether TF antigen is expressed on the cell surface,
flow cytometric analysis was performed three times, using the
monoclonal antibody, HTF-K180. Representative data is shown in
Fig 4. Under static (0 dynes/cm2) conditions, stimulation of HUVECs with TNF-
(6 hours) resulted in an increase in TF antigen on the cell surface
with a mean fluorescence ratio of 20.03 (Fig 4, profile B), as compared
with 8.28 in nontreated cells (Fig 4, profile A). Application of shear
stress, at 18 dynes/cm2 started 15 hours before TNF-
addition and continued until sampling, attenuated the increase in TF
antigen levels, with a mean fluorescence ratio of 11.73 (Fig 4,
profile C). Application of shear stress at 18 dynes/cm2 itself did not increase TF antigen on the cell
surface, with a mean fluorescence ratio of 8.08, the same as that seen
in nontreated cells.

View larger version (15K):
[in this window]
[in a new window]
| Fig 4.
Effect of shear stress on TF antigen levels on cell
surface of HUVECs. HUVECs were exposed to shear stress (18 dynes/cm2) or left static for 15 hours before and 6 hours
after TNF- (100 U/mL) addition, and TF antigen levels on the cell
surface were analyzed by flow cytometry using antihuman TF
monoclonal antibody, HTF-K180. Representative plots from three separate
experiments with essentially the same results. Profile A, nontreated
cells; profile B, TNF- -treated cells; profile C, presheared and
sheared TNF- -treated cells.
|
|
Effect of shear stress on TF procoagulant activity.
To investigate whether shear stress affects TF functional activity,
HUVECs were loaded with shear stress alone at 18 dynes/cm2,
or treated with TNF- in the presence or absence of steady shear stress for various periods of time, followed by chromogenic assays, in
which we assayed the conversion of factor X to Xa, as a measure of TF
procoagulant activity, on the surface of HUVECs. This factor Xa
generation rate reflects TF activity, as the factor Xa generation was
inhibited by 80% in HUVECs preincubated with 10 µg/mL of HTF-K14 or
15 µg/mL of goat antihuman TF polyclonal antibody. Factor Xa generation in cell-free system without HUVECs was 68.9 ± 22.7 fmoles/cm2minute in the reaction buffer containing
Ca2+, factor VIIa, and factor X, and 27.5 ± 9.2 fmoles/cm2minute in the buffer in which factor VIIa was
omitted. Figure 5 indicates that the
application of shear stress itself did not induce procoagulant activity
on the cell surface (61.4 ± 27.6 fmoles/cm2minute at
static cells v 65.1 ± 14.6 fmoles/cm2minute at
6 hours after shear stress applied). When HUVECs were stimulated with
TNF- , factor Xa generation increased sharply to 157.5 ± 61.2 fmoles/cm2minute at 3 hours, reached a maximum of 350.3 ± 116.3 fmoles/cm2minute at 6 hours, and then declined
to 244.8 ± 71.9 fmoles/cm2minute after 9 hours of TNF- stimulation. In contrast, application of shear stress,
at 18 dynes/cm2, started 15 hours before TNF- addition
and continued until sampling, attenuated the increase in factor Xa
generation in a statistically significant manner (350.3 ± 116.3 fmoles/cm2minute at 0 dynes/cm2 v 122.8 ± 46.5 fmoles/cm2minute at 18 dynes/cm2
after 6 hours of TNF- stimulation; P < .01 at 3, 6, 9 hours).

View larger version (12K):
[in this window]
[in a new window]
| Fig 5.
Effect of shear stress on TF procoagulant activity of
HUVECs. HUVECs were exposed to shear stress (18 dynes/cm2) or left static for 15 hours before and 1, 3, 6, and 9 hours after TNF- (100 U/mL) addition. HUVECs were also exposed
to shear stress itself (18 dynes/cm2) for 1, 3, 6, and 9 hours or left static. In four different conditions, TF procoagulant
activity was measured by chromogenic assay as assessed by factor Xa
generation on monolayers of HUVECs. Data represent mean ± standard
error (SE) of three separate experiments from TNF-
(100 U/mL)-stimulated cells and four separate experiments from
nonstimulated cells. ( ), TNF-stimulated cells; ( ), presheared and
sheared TNF-stimulated cells; ( ), sheared, nonstimulated cells;
( ), static, nonstimulated cells.
|
|
Effects of acetyl salicyclic acid (ASA) and Nw-nitro-L-arginine
methyl ester (L-NAME) on shear-induced TF mRNA attenuation.
It has been shown that shear application increases the production of
PGI27 and NO8 by endothelial cells.
Therefore, it is possible that these autacoids participate indirectly
in the shear-induced reduction of TF expression. To investigate this
issue, we examined the effects of ASA (Sigma, St Louis, MO), an
inhibitor of cyclooxygenase, and L-NAME (Sigma), an inhibitor of nitric
oxide synthase, on shear stress-induced attenuation of TF expression.
When we treated HUVECs with ASA (1 mmol/L) for 30 minutes
before shear application (at 18 dynes/cm2, from 15 hours
before to 6 hours after TNF- addition), the attenuating effect of
shear stress on TF mRNA elevation was not abolished (Fig 6A). Similarly, when HUVECs were
exposed to shear stress in the presence of 100 µmol/L L-NAME, the
attenuating effect of shear stress on TF mRNA elevation was still
observed (Fig 6B).

View larger version (22K):
[in this window]
[in a new window]
| Fig 6.
Effect of treatment with ASA or L-NAME on shear-induced
attenuation in TF mRNA level of HUVECs. (A) After pretreatment with ASA
(1 mmol/L) for 30 minutes, HUVECs were exposed to shear stress (18 dynes/cm2) or left static for 15 hours before and 1 and 3 hours after TNF- (100 U/mL) addition, and then processed as in Fig
1. (B) HUVECs were exposed to shear stress (18 dynes/cm2)
or left static for 15 hours before and 1 and 3 hours after TNF- (100 U/mL) addition in the presence of L-NAME (100 µmol/L), and then
processed as in Fig 1. Results of densitometric analysis of TF RT-PCR
products normalized with respect to corresponding GAPDH RT-PCR product
levels are shown.
|
|
Effect of shear stress on nuclear translocation of NF B.
A transcription factor, NF B, has been shown to play an important
role in the induction of TF expression in many cells. In cytokine-stimulated endothelial cells, c-Rel/p65 heterodimer
translocates into the nucleus after dissociation from its cytoplasmic
inhibitor, I B, and induces TF gene expression. Therefore, we
examined whether shear forces affect this nuclear translocation of
NF B, using Western blotting. TNF- stimulation of HUVECs resulted
in nuclear translocation of p65 subunit in 30 minutes
(Fig 7A, lanes 1 and 2). However, shear
application at 18 dynes/cm2 started 15 hours before TNF-
addition and continued until protein extraction had no effects on this
TNF- -induced translocation of p65 subunits (Fig 7A, lanes 3 and 4).
In addition, short-term (30 minutes) exposure of HUVECs to shear stress
alone did not stimulate translocation of the p65 subunit into the
nucleus of HUVECs (Fig 7A, lane 5). In cytoplasmic extracts, a
corresponding reciprocal degradation pattern of I B was noticed
(Fig 7B).

View larger version (26K):
[in this window]
[in a new window]
| Fig 7.
Effect of shear stress on nuclear translocation of
NF B. (A) Nuclear extract of HUVECs was separated by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred
to PVDF membrane by Western blotting. Then, p65 subunit of NF B was
detected with rabbit anti-p65 polyclonal antibody. (B) Cytoplasmic
extract of HUVECs was separated by SDS-PAGE and transferred to PVDF
membrane by Western blotting. Then, I B was detected with rabbit
anti-I B polyclonal antibody. Lane 1, static control; lane 2, cells stimulated with TNF- (100 U/mL) for 30 minutes; lane 3, cells
exposed to shear stress at 18 dynes/cm2 for 15.5 hours;
lane 4, cells exposed to shear stress at 18 dynes/cm2 for
15 hours and then stimulated with TNF- (100 U/mL) and sheared for a
further 30 minutes; lane 5, cells exposed to shear stress at 18 dynes/cm2 for 30 minutes.
|
|
 |
DISCUSSION |
It has been shown that TF expression can be induced in cultured
endothelial cells with many kinds of agents, such as inflammatory cytokines,17 lipopolysaccharide (LPS),18,19 or
phorbol esters.19 However, Wilcox et al20
reported that TF expression at the mRNA and antigen levels was not
detected in endothelial cells in vivo, even in atherosclerotic plaques,
whereas macrophages/monocytes overtly expressed TF, according to in
situ and in vivo immunohistochemistry studies. The expression of TF in
endothelial cells in vivo has been shown in very restricted vascular
beds under unusual conditions, such as in the splenic microvasculature
of baboon lethal sepsis model21 and in the endothelial
cells of malignant infiltrating intraductal breast cancer in
humans.22 The factor responsible for this discrepancy
between in vitro experimental condition and in vivo observations was
not known. Our results clearly show that shear forces act as an
inhibitory regulator for TNF- -induced TF expression of both protein
and mRNA levels. The longer the preexposure time to constant shear
stress, the greater the decrease in TF mRNA expression, suggesting that
endothelial cells continuously exposed to steady laminar flow in vivo
could be resistant to induction of TF expression by cytokines. In
addition, flow immunocytometric analysis confirmed that cell-surface TF
antigen levels induced by TNF- were attenuated by shear forces and
declined in parallel with TF mRNA levels. Furthermore, the increase in
the procoagulant activity of TF, measured as the conversion rate of
factor X to factor Xa in the presence of factor VIIa and
Ca2+, was also attenuated by shear application, indicating
the physiological significance of the shear-induced suppression of TF
expression. Although the effect of shear force on coagulation activity
of preexisting TF was investigated previously,23 this is
the first study to examine the effect of shear stress on
cytokine-induced TF expression per se in endothelial cells.
The effects of shear stress alone on TF procoagulant activity have been
investigated in vitro. Gemmell et al33 have observed increased production of factor Xa under shear forces in a nonbiologic system that incorporated TF in a lipid bilayer immobilized on the inner
surface of a glass capillary tube. Grabowski et al23 showed
that although flow directly augments the Xa production, as a functional
expression of TF, by monolayers of fibroblasts, it has little effect on
Xa production by HUVECs. They found, however, that Xa generation was
augmented under applied shear stress, in the presence of an antibody
directed against TFPI. Recently, Lin et al24
reported that shear stress at 12 dynes/cm2 induced a
transient increase in TF procoagulant activity in HUVECs, which was
accompanied by a rapid and transient induction of TF mRNA. However, in
our study, shear stress at 18 dynes/cm2 did not induce the
expression of TF mRNA, antigen, or procoagulant activity in HUVECs.
This difference might be attributed to the differences in the
experimental systems, such as culture medium or the shear-loading
apparatus. Further studies are needed to clarify the regulation of TF
procoagulant activities and the role of TFPI under shear forces,
because endothelial cells appear to be the major site of synthesis of
TFPI.34
The relationship between the stability of TF mRNA and TF expression in
monocytes and HUVECs is controversial. Crossmen et al19
showed that the rapid accumulation of TF mRNA in HUVECs stimulated by
LPS is largely a result of an increase in mRNA stability, although
Brand et al35 showed that the LPS-induced accumulation of
TF mRNA levels in monocytic cells is accompanied by both
transcriptional and posttranscriptional control mechanisms. We observed
that the stability of TF mRNA in TNF- -stimulated HUVECs was not
decreased in the presence of shear stress, even when shear exposure was started at 3 hours before TNF stimulation, suggesting that the suppression might occur at the transcriptional level.
It has been reported that shear stress increases the production of
PGI27 and NO8 by endothelial cells,
and Crutchley et al36 reported that the prostacyclin
analogs can inhibit TF expression with no apparent effect on TF mRNA
stability. To investigate the possibility that these autacoids
increased by shear forces could participate in attenuation of TF
expression indirectly, we conducted the experiments using ASA as a
cyclooxygenase inhibitor or L-NAME as an NO synthase inhibitor.
Although the baseline levels of TF mRNA slightly increased in the
presence of ASA (1 mmol/L) or L-NAME (100 µmol/L), the attenuating
effect of shear stress on TF mRNA elevation was maintained. Thus, the
inhibitory effect of shear stress on TF expression appears to be
independent of PGI2 or NO.
Recent studies regarding the regulation of TF gene expression in
cytokine-stimulated endothelial cells have suggested that NF B plays
a central role as a transcriptional factor, in that c-Rel/p65 can
translocate into the nucleus after its dissociation from
I B.37-39 In addition, other transcriptional factors,
AP-1 and Sp1, are also shown to be involved in TF gene expression. Interestingly, these transcriptional factors have been reported to
mediate shear-induced gene expression. NF B is shown to participate in shear stress-induced transcriptional activation of the PDGF-B chain
gene in BAECs, as one of the nuclear proteins binding to the cis-acting
shear stress responsive element within the PDGF-B chain promoter is
NF B.40 Shyy et al6 reported that phorbol ester TPA-responsive elements (TRE), to which AP-1 binds, are responsible for bovine MCP-1 gene expression. Moreover, Lan et al41 showed that shear stress stimulates the DNA binding
activities of NF B and AP-1 in BAECs. In contrast, Ando et
al42 reported that TRE are responsible for shear-induced
decreases in vascular cell adhesion molecule (VCAM)-1 gene expression
in mouse endothelial cells. These observations suggest that one element
could be either a positive or a negative responsive element for gene
expression under different conditions. However, in our study shear
stress neither stimulated translocation of NF B into the nucleus in
HUVECs nor inhibited TNF- -induced translocation of NF B. The
molecular mechanism responsible for shear-induced attenuation of TF
expression in HUVECs needs to be elucidated in further studies.
Previously, we have shown the interacting effects of shear force and
cytokines on fibrinolytic systems; specifically, shear force alters the
effects of cytokines, enhancing t-PA secretion and attenuating PAI-1
response induced by cytokines.14 The present study also
showed that cytokine-induced TF expression can be attenuated by shear
force. Taken together, these observations suggest that hemodynamic
forces can modulate the action of inflammatory cytokines on endothelial
properties. It is interesting that this modulation can be
bidirectional, ie, shear stress attenuates cytokine-induced expression
of PAI-1 and TF, whereas it synergistically enhances t-PA synthesis in
endothelial cells. This suggests the existence of complex mutual
cross-talk between the signaling pathways used by shear forces and
inflammatory cytokines. It is likely that laminar shear stress in the
physiological range acts on endothelial cells to render numerous
functions antithrombotic in a cooperative way. The idea that constant
laminar shear stress is indispensable for antithrombotic status in the
endothelium might be supported by the observation that
thrombosis/atherosclerosis-prone regions in blood vessels are located
exclusively at flow dividers or curvatures, where shear stress is
supposed to be small and irregular.1 Therefore, hemodynamic
forces borne by blood flow might play a pivotal role, via modulation of
endothelial functions, in maintaining antithrombogenicity.
 |
FOOTNOTES |
Submitted March 6, 1997;
accepted January 19, 1998.
Supported in part by Grants-in-Aid for Scientific Research (No.
07672500 to Y.K. and No. 08457641 to K.W.) from the Ministry of
Education, Science, and Culture of Japan, and National Grant-in-Aid for
the Establishment of High-Tech Research Center in a Private University of Japan, and Research Foundation for
Traffic-Preventive Medicine in Japan.
Address reprint requests to Yohko Kawai, MD, Department of Laboratory
Medicine, Keio University School of Medicine, 35 Shinanomachi, Shinjuku-ku, Tokyo 160, Japan.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
 |
REFERENCES |
1.
McIntire LV:
Bioengineering and vascular biology.
Ann Biomed Eng
22:2,
1994[Medline]
[Order article via Infotrieve]
2.
Resnick N,
Gimbrone MA:
Hemodynamic forces are complex regulators of endothelial gene expression.
FASEB J
9:874,
1995[Abstract]
3.
Davies PF:
Flow-mediated endothelial mechanotransduction.
Physiol Rev
75:519,
1995[Abstract/Free Full Text]
4.
Resnick N,
Collins T,
Atkinson W,
Bonthron DT,
Dewey CF,
Gimbrone MA:
Platelet-derived growth factor B chain promoter contains a cis-acting fluid shear-stress-responsive element.
Proc Natl Acad Sci USA
90:4591,
1993[Abstract/Free Full Text]
5.
Ohno M,
Cooke JP,
Dzau VJ,
Gibbons GH:
Fluid shear stress induces endothelial transforming growth factor beta-1 transcription and production. Modulation by potassium channel blockade.
J Clin Invest
95:1363,
1995
6.
Shyy JY,
Lin M,
Han J,
Lu Y,
Petrime M,
Chien S:
The cis-acting phorbol ester "12-O-tetradecanoylphorbol 13-acetate"-responsive element is involved in shear stress-induced monocyte chemotactic protein 1 gene expression.
Proc Natl Acad Sci USA
92:8069,
1995[Abstract/Free Full Text]
7.
Frangos JA,
Eskin SG,
McIntire LV,
Ives CL:
Flow effects on prostacyclin production by cultured human endothelial cells.
Science
227:1477,
1985[Abstract/Free Full Text]
8.
Rubanyi GM,
Romero JC,
Vanhoutte PM:
Flow-induced release of endothelium-derived relaxing factor.
Am J Physiol
250:H1145,
1986[Abstract/Free Full Text]
9.
Nishida K,
Harrison DG,
Navas JP,
Fisher AA,
Dockery SP,
Uematsu M,
Nerem RM,
Alexander RW,
Murphy TJ:
Molecular cloning and characterization of the constitutive bovine aortic endothelial cell nitric oxide synthase.
J Clin Invest
90:2092,
1992
10.
Malek AM,
Jackman R,
Rosenberg RD,
Izumo S:
Endothelial expression of thrombomodulin is reversibly regulated by fluid shear stress.
Circ Res
74:852,
1994[Abstract/Free Full Text]
11.
Takada Y,
Shinkai F,
Kondo S,
Yamamoto S,
Tsuboi H,
Korenaga R,
Ando J:
Fluid shear stress increases the expression of thrombomodulin by cultured human endothelial cells.
Biochem Biophys Res Commun
205:1345,
1994[Medline]
[Order article via Infotrieve]
12.
Diamond SL,
Eskin SG,
McIntire LV:
Fluid flow stimulates tissue plasminogen activator secretion by cultured human endothelial cells.
Science
243:1483,
1989[Abstract/Free Full Text]
13.
Diamond SL,
Sharefkin JB,
Dieffenbach C,
Frasier-Scott K,
McIntire LV,
Eskin SG:
Tissue plasminogen activator messenger RNA levels increase in cultured human endothelial cells exposed to laminar shear stress.
J Cell Physiol
143:364,
1990[Medline]
[Order article via Infotrieve]
14.
Kawai Y,
Matsumoto Y,
Watanabe K,
Yamamoto H,
Satoh K,
Murata M,
Handa M,
Ikeda Y:
Hemodynamic forces modulate the effects of cytokines on fibrinolytic activity of endothelial cells.
Blood
87:2314,
1996[Abstract/Free Full Text]
15.
Edgington TS,
Mackman N,
Bland K,
Ruf W:
The structural biology of expression and function of tissue factor.
Thromb Haemost
66:67,
1991[Medline]
[Order article via Infotrieve]
16.
Grabowski EF,
Lam FP:
Endothelial cell function, including tissue factor expression, under flow conditions.
Thromb Haemost
74:123,
1995[Medline]
[Order article via Infotrieve]
17.
Pober JS,
Bevilacqua MP,
Mendrick DL,
LaPierre LA,
Fiers W,
Gimbrone MA:
Two distinct monokines, interleukin-1 and tissue necrosis factor, each independently induce biosynthesis and transient expression of the same antigen on the surface of cultured human vascular endothelial cells.
J Immunol
136:1680,
1986[Abstract]
18.
Moore KL,
Andreoli SP,
Esmon NL,
Esmon CT,
Bang NU:
Endotoxin enhances tissue factor and suppresses thrombomodulin expression of human vascular endothelium in vitro.
J Clin Invest
79:124,
1987
19.
Crossman DC,
Carr DP,
Tuddenham EGD,
Pearson JD,
McVey JH:
The regulation of tissue factor mRNA in human endothelial cells in response to endotoxin or phorbol ester.
J Biol Chem
265:9782,
1990[Abstract/Free Full Text]
20.
Wilcox JN,
Smith KM,
Schwartz SM,
Gordon D:
Localization of tissue factor in the normal vessel wall and in the atherosclerotic plaque.
Proc Natl Acad Sci USA
86:2839,
1989[Abstract/Free Full Text]
21.
Drake TA,
Cheng J,
Chang A,
Taylor FB:
Expression of tissue factor, thrombomodulin, and E-selectin in baboons with lethal Escherichia coli sepsis.
Am J Pathol
142:1458,
1993[Abstract]
22.
Contrino J,
Hair G,
Kreutzer DL,
Rickles FR:
In situ detection of tissue factor in vascular endothelial cells.
Nature Med
2:209,
1996[Medline]
[Order article via Infotrieve]
23.
Grabowski EF,
Zuckerman DB,
Nemerson Y:
The functional expression of tissue factor by fibroblasts and endothelial cells under flow conditions.
Blood
81:3265,
1993[Abstract/Free Full Text]
24.
Lin M-C,
Almus-Jacobs F,
Chen H-H,
Parry GCN,
Mackman N,
Shyy J Y,
Chien S:
Shear stress induction of the tissue factor gene.
J Clin Invest
99:737,
1997[Medline]
[Order article via Infotrieve]
25.
Ikeda Y,
Handa M,
Kawano K,
Kamata T,
Murata M,
Araki Y,
Anbo H,
Kawai Y,
Watanabe K,
Itagaki I,
Sakai K,
Ruggeri ZM:
The role of von Willebrand Factor and fibrinogen in platelet aggregation under varying shear stress.
J Clin Invest
87:1234,
1991
26.
Ikeda Y,
Handa M,
Kamata T,
Kawano K,
Kawai Y,
Watanabe K,
Sakai K,
Fukuyama M,
Itagaki I,
Yoshioka A,
Ruggeri ZM:
Transmembrane calcium influx associated with von Willebrand factor binding to GP Ib in the initiation of shear-induced platelet aggregation.
Thromb Haemost
69:496,
1993[Medline]
[Order article via Infotrieve]
27.
Scarpati EM,
Wen D,
Broze GT,
Miletich JP,
Flandermeyer RR,
Siegel NR,
Sadler JE:
Human tissue factor: cDNA sequence chromosomal localization of the gene.
Biochemistry
26:5234,
1987[Medline]
[Order article via Infotrieve]
28.
Tso JY,
Sun X,
Kao T,
Reece KS,
Wu R:
Isolation and characterization of rat and human glyceraldehyde-3-phosphate dehydrogenase cDNAs: Genomic complexity and molecular evolution of the gene.
Nucleic Acids Res
13:2485,
1985[Abstract/Free Full Text]
29.
Chomczynski P,
Sacchi N:
Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156,
1987[Medline]
[Order article via Infotrieve]
30.
Meinkoth J,
Wahl G:
Hybridization of nucleic acids immobilized on solid supports.
Anal Biochem
138:267,
1984[Medline]
[Order article via Infotrieve]
31. (abstr)
Nakamura S,
Kamikubo Y,
Okajima K,
Asakura H,
Nakamura K:
Plasma tissue factor: Its sensitive assay and characterization.
Thromb Haemost
69:744,
1993
32.
Bobrow MN,
Harris TD,
Shaughnessy KJ:
Catalyzed reporter deposition, a novel method of signal amplification; application to immunoassays.
J Immunol Methods
125:279,
1989[Medline]
[Order article via Infotrieve]
33.
Gemmell CH,
Turrito VT,
Nemerson Y:
Flow as a regulator of the activation of factor X by tissue factor.
Blood
72:1404,
1988[Abstract/Free Full Text]
34.
Bajaj MS,
Kuppuswamy MN,
Saito H,
Spitzer SG,
Bajaj SP:
Cultured normal human hepatocytes do not synthesize lipoprotein-associated coagulation inhibitor: Evidence that endothelium is the principal site of its synthesis.
Proc Natl Acad Sci USA
87:8869,
1990[Abstract/Free Full Text]
35.
Brand K,
Fowler BJ,
Edgington TS,
Mackman N:
Tissue factor mRNA in THP-1 monocytic cells is regulated at both transcriptional and posttranscriptional levels in response to lipopolysaccharide.
Mol Cell Biol
11:4732,
1991[Abstract/Free Full Text]
36.
Crutchley DJ,
Conanan LB,
Que BG:
Effects of prostacyclin analogs on the synthesis of tissue factor, tumor necrosis factor- and interleukin-1 in human monocytic THP-1 cells.
J Pharmacol Exp Ther
271:446,
1994[Abstract/Free Full Text]
37.
Mackman N:
Regulation of the tissue factor gene.
FASEB J
9:883,
1995[Abstract]
38.
Moll T,
Czyz M,
Holzmuller H,
Hofer-Warbinek R,
Wagner E,
Winkler H,
Bach FH,
Hofer E:
Regulation of the tissue factor promoter in endothelial cells: Binding of NF B-, AP-1-, and Sp1-like transcription factors.
J Biol Chem
270:3849,
1995[Abstract/Free Full Text]
39.
Kolesnick R,
Golde DW:
The sphingomyelin pathway in tumor necrosis factor and interleukin-1 signaling.
Cell
77:325,
1994[Medline]
[Order article via Infotrieve]
40.
Khachigian LM,
Resnick N,
Gimbrone MA,
Collins T:
Nuclear factor- B interacts functionally with the platelet-derived growth factor B-chain shear stress response element in vascular endothelial cells exposed to fluid shear stress.
J Clin Invest
96:1169,
1995
41.
Lan Q,
Mercurius KO,
Davies PF:
Stimulation of transcription factors NF B and AP-1 in endothelial cells subjected to shear stress.
Biochem Biophys Res Commun
201:950,
1994[Medline]
[Order article via Infotrieve]
42. (abstr)
Ando J,
Korenaga R,
Takada Y,
Kamiya A:
Down-regulation of VCAM-1 gene transcription by shear stress in cultured murine endothelial cells.
J Vasc Res
33:4,
1996

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
J.-J. Chiu, P.-L. Lee, C.-N. Chen, C.-I Lee, S.-F. Chang, L.-J. Chen, S.-C. Lien, Y.-C. Ko, S. Usami, and S. Chien
Shear Stress Increases ICAM-1 and Decreases VCAM-1 and E-selectin Expressions Induced by Tumor Necrosis Factor-{alpha} in Endothelial Cells
Arterioscler. Thromb. Vasc. Biol.,
January 1, 2004;
24(1):
73 - 79.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-W. Ni, H.-J. Hsieh, Y.-J. Chao, and D. L. Wang
Shear Flow Attenuates Serum-induced STAT3 Activation in Endothelial Cells
J. Biol. Chem.,
May 23, 2003;
278(22):
19702 - 19708.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. J. Salacinski, S. Goldner, A. Giudiceandrea, G. Hamilton, A. M. Seifalian, A. Edwards, and R. J. Carson
The Mechanical Behavior of Vascular Grafts: A Review
J Biomater Appl,
January 1, 2001;
15(3):
241 - 278.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
E. F. Grabowski, A. J. Reininger, P. G. Petteruti, O. Tsukurov, and R. W. Orkin
Shear Stress Decreases Endothelial Cell Tissue Factor Activity by Augmenting Secretion of Tissue Factor Pathway Inhibitor
Arterioscler. Thromb. Vasc. Biol.,
January 1, 2001;
21(1):
157 - 162.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Erlich, C. Fearns, J. Mathison, R. J. Ulevitch, and N. Mackman
Lipopolysaccharide Induction of Tissue Factor Expression in Rabbits
Infect. Immun.,
May 1, 1999;
67(5):
2540 - 2546.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|