|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 11 (June 1), 1998:
pp. 4255-4264
Differential Regulation of Interleukin-10 (IL-10) and IL-12 by
Glucocorticoids In Vitro
By
Jeroen Visser,
Anette van Boxel-Dezaire,
Dion Methorst,
Tibor Brunt,
E. Ronald de Kloet, and
Lex Nagelkerken
From the Division of Immunological and Infectious Diseases, TNO
Prevention and Health, Leiden; and the Division of Medical
Pharmacology, Leiden Amsterdam Center for Drug Research, Leiden, The
Netherlands.
 |
ABSTRACT |
Antigen-presenting cells are thought to modulate the development of
Th1 and Th2 cells by the secretion of interleukin-10 (IL-10) and IL-12.
Because glucocorticoids (GC) favor the development of Th2 responses, we
determined whether dexamethasone (DEX) and hydrocortisone (HC) have
differential effects on lipopolysaccharide-induced IL-10 and IL-12
production in whole-blood cultures. Significant inhibition of
IL-12(p40) and IL-12(p70) was found with 10 8 mol/L and
109 mol/L DEX respectively, whereas IL-10 was relatively
insensitive or even stimulated. Accordingly, the expression of
IL-12(p40) and IL-12(p35) mRNA was more sensitive to DEX than IL-10
mRNA. The glucocorticoid receptor (GR) antagonist RU486 enhanced IL-12 production and largely abrogated the inhibition of IL-12 by GC, indicating that this suppression was mainly GR-mediated. High concentrations of RU486 were inhibitory for IL-10, suggesting that GC
may exert a positive effect on IL-10. In the presence of neutralizing
anti-IL-10 antibodies, DEX was still capable of IL-12 suppression
whereas RU486 still enhanced IL-12 production, indicating that GC do
not modulate IL-12 via IL-10 exclusively. Taken together these results
indicate that GC may favor Th2 development by differential regulation
of IL-10 and IL-12.
| |
INTRODUCTION |
IT IS WELL-ESTABLISHED that at least two
types of T-helper cells are involved in immunoregulation. Th1 cells are
supposed to dominate in the regulation of cellular immunity, whereas
Th2 cells regulate humoral immunity.1 During a normal
immune response both Th1 and Th2 cell types are involved in a
crossregulatory fashion. It is suggested that an imbalance between
these subsets contributes to the development of disease: a strong Th2
response is thought to play a role in allergic diseases and
antibody-mediated autoimmune diseases, whereas a dominating Th1
response might contribute to the development of cell-mediated
autoimmune diseases.2,3 The development of Th precursor
cells into either Th1 or Th2 cells is dependent on a variety of
cytokines. The presence of IL-4 during a developing immune response has
been shown to favor Th2 responses.4 On the other hand,
IL-12 has been shown to be a crucial factor in the development of Th1
responses.5,6 Therefore, the type of antigen-presenting
cell (APC) may be one of the major determinants in the differentiation
of naive CD4+ T cells toward Th1 or Th2 cells. Recently it
has been shown that human monocytes may be heterogeneous, evidenced by
the fact that CD14+/CD16+ cells do not express
mRNA for IL-10 in response to lipopolysaccharide (LPS) compared with
CD14+/CD16 cells.7 This
observation is of importance in view of the fact that IL-10 suppresses
IL-12.8 The development of Th1 and Th2 cells may also
depend on the activation state of APC, eg, the ability to secrete
prostaglandin E2, which was found to suppress IL-12
production and inhibit Th1 cells.9,10
Most likely, glucocorticoids (GC) also play an important role in
directing CD4+ T-cell responses. In the mouse it has been
shown that dexamethasone (DEX) preferentially suppressed IL-2 and not
IL-4, products of Th1 and Th2 cells, respectively.11 Using
rat CD4+ T cells, it was found that GC favor Th2
development.12 Also, in humans GC have selective effects on
CD4+ T-cell subsets13 which appear to depend on
the activation pathway.14 Addition of GC during
restimulation of primed human naive CD4+ T cells stimulates
IL-4 and IL-10 production and suppresses IL-5 and interferon-
(IFN-) production.15 Accordingly, the synthesis of
polyclonal IgE is increased in the presence of GC in
vitro.16-18
The selective effect of GC on the Th1-Th2 balance is supported by the
in vivo observation that GC play an important role in the development
of experimental allergic encephalomyelitis (EAE).19 Lewis
rats, which are susceptible for EAE, show an impaired production of GC
upon stressful events.20 Moreover, because the relatively resistant PVG rat becomes sensitive to EAE induction after
adrenalectomy,21 it is likely that the development of
autoimmunity may be related to the integrity of the
hypothalamus-pituitary-adrenal (HPA)-axis. This possibility is
supported by the observation that patients suffering from reumatoid
arthritis display decreased levels of GC as a result of an impaired
functioning of the HPA-axis.22
Because the functional characteristics of APC may determine the nature
of a developing immune response and since GC seem to favor the
development of Th2 responses, the aim of our study was to determine
whether GC would have a differential effect on the production of IL-10
and IL-12. Our studies show that IL-10 and IL-12 display a different
sensitivity to GC and that different mechanisms are involved in the
regulation of these cytokines by GC.
| |
MATERIALS AND METHODS |
Antibodies and Reagents
Anti-IL-12 monoclonal antibodies (MoAbs) C11.79, C8.6, and 20C2 were
kindly provided by Dr T van der Pouw Kraan (Central Laboratory of the
Netherlands Red Cross Blood Transfusion Service, Amsterdam, The
Netherlands), J. Wormmeester (Laboratory of Cell Biology and Histology,
Academic Medical Center, University of Amsterdam, The Netherlands), and
Dr D.H. Presky (Hoffmann-La Roche, Nutley, NJ). These antibodies
recognize both IL-12(p40) and the bioactive heterodimer p70, consisting
of p40 and p35, as described previously.23
Anti-IL-10 MoAbs (JES3-9D7 and biotinylated JES3-12G8), anti-human
tumor necrosis factor- (TNF-) MoAbs (MoAb1 and biotinylated MoAb11), and neutralizing anti-human IL-10 MoAb (JES3-9D7) were purchased from Pharmingen (San Diego, CA).
Recombinant human IL-12 was purchased from R&D systems (Abington, UK),
recombinant human IL-10 was kindly provided by Dr S. Narula (Schering
Plough Research Institute, Kenilworth, NJ), and recombinant human
TNF- was obtained from Pharmingen. Escherichia coli
(serotype 0127:B8)-derived LPS was obtained from Sigma (St Louis, MO).
The glucocorticoid-receptor (GR) antagonist RU486 (Roussel-UCLAF,
Romaineville, France) and the mineralocorticoid-receptor (MR)
antagonist spironolactone (Roussel-UCLAF) were a kind gift of Dr Win
Sutanto (Division of Medical Pharmacology, LACDR, Leiden, The
Netherlands). Recombinant IFN- was a kind gift of Peter van der
Meide (BPRC, Rijswijk, The Netherlands). Dexamethasone, hydrocortisone, and aldosterone were purchased from Sigma. The following antibodies were used for cell sorting and assessment of cell purity: anti-CD3-FITC (Becton Dickinson, Mountain View, CA), anti-CD19-FITC (Becton Dickinson), and anti-CD14-PE (CLB, Amsterdam, The Netherlands).
Cell Cultures
Whole-blood cultures.
Whole blood was obtained from healthy volunteers by venapuncture and
collected in heparinized blood collecting tubes (Becton Dickinson). The
blood was 1:5 diluted in Iscoves Modified Dulbecco's Medium (IMDM)
supplemented with glutamax (GIBCO, Paisley, UK), 10% fetal calf serum
(FCS; Sebak, Gmbh, Aidenbach, Germany), 50 µmol/L
 -mercaptoethanol, 100 U/mL penicillin, and 100 µg/mL streptomycin. Fifty microliters of the diluted blood was cultured in 96-well flat-bottomed microtiterplates (Costar, Cambridge, MA) in a final volume of 200 µL per well. Cells were stimulated with 250 ng/mL LPS
to induce cytokine production; IL-12(p70) was induced by stimulation with 250 ng/mL LPS in the presence of 1,000 U/mL IFN-.
A dose-related response to DEX or HC was studied by the addition of
these hormones to the culture wells in a final concentration ranging
from 1010 mol/L to 105 mol/L. Stock
solutions of 10 mmol/L HC, 20 mmol/L DEX, 0.1 mol/L RU486, and 0.1 mol/L spironolactone were prepared in dimethylsulfoxide (DMSO; Merck,
Darmstadt, Germany) and stored at  20°C in 0.2-mL aliquots. Stock
solution of aldosterone (2.86 × 104 mol/L) was
prepared in culture medium and stored at 20°C in 0.5-mL aliquots.
In some experiments endogenous IL-10 was neutralized by the addition of
5 µg/mL anti-IL-10 antibodies. The binding of DEX and HC to the GR
was blocked by simultaneous addition of 50 µmol/L or 1 µmol/L RU486
to the culture wells. The binding of HC to the MR was blocked by
simultaneous addition of 1 µmol/L spironolactone to the culture
wells. The whole blood was put into culture within 2 hours after
venapuncture. For assessment of cytokine levels the supernatants of the
cultures were obtained after 24 and 48 hours of culture and stored at
20°C.
Cultures of peripheral blood mononuclear cells (PBMC) and purified
subsets.
PBMC were isolated by density centrifugation in Histopaque 1.077 (Sigma). For the isolation of subsets two experiments were performed
using buffycoats from healthy donors, in which B cells and monocytes
were simultaneously labeled with anti-CD19-FITC and anti-CD14-PE, and
T cells were labeled with anti-CD3-FITC. Cells of interest were sorted
with the use of a FACS Vantage (Becton Dickinson).
Cells were cultured in 24-well flat-bottom tissue culture plates
(Costar) at a density of 1 × 106 PBMC/well, 1 × 105 B cells/well, 2 × 105 T cells/well, or 1 × 105 monocytes/well under conditions as described for
whole-blood cultures.
Cytokine Assays
For the IL-12(p40) enzyme-linked immunosorbent assay (ELISA), MoAb
C11.79 (2 µg/mL in 50 mmol/L NaHCO3, pH 9.5, 50 µL/well) was coated overnight at 4°C on round-bottom
microtiterplates with high-binding capacity (Greiner,
Nürtingen, Germany). For the IL-12(p70) ELISA plates were
coated with MoAb 20C2 (2 µg/mL in 50 mmol/L NaHCO3, pH
9.5, 50 µL/well). As for all subsequent washing steps, the plates
were washed six times with phosphate-buffered saline (PBS) containing
0.05% Tween-20. Subsequently the plates were blocked for 1.5 hours
with 200 µL PBS containing 0.2% gelatin and 0.05% Tween-20 (PTG).
After washing, 50 µL diluted biotinylated MoAb C8.6 in PTG (final
concentration, 0.25 µg/mL) was added per well together with 50 µL
of the undiluted samples and simultaneously incubated for 2 hours.
After washing, the plates were incubated for 1 hour with 75 µL/well
poly-streptavidin-horseradish peroxidase (CLB) 1:10,000 diluted in PTG.
Finally, after washing, the plates were developed with 100 µL/well
0.1 mol/L 3,5,3 ,5-tetramethyl-benzidine (TMB; Merck) in 0.11 mol/L
sodium acetate pH 5.5 containing 0.003% H2O2.
The reactions were terminated by the addition of 50 µL of 2 mol/L
H2SO4 to each well. The plates were read at 450 nm in a Biorad 3500 platereader (Biorad, Richmond, CA). Recombinant human IL-12 diluted in culture medium was used as a standard, and the
standard curves ranged from 4,000 pg/mL to 15 pg/mL.
The IL-10 ELISA was performed in an identical fashion. The plates were
coated with JES3-9D7 MoAb (0.5 µg/mL) and biotinylated JES3-12G8 MoAb
was used in a concentration of 2 µg/mL. Recombinant human IL-10
diluted in culture medium was used as a standard. The standard curves
ranged from 2,500 pg/mL to 10 pg/mL.
For the TNF- ELISA the plates were coated with 1 µg/mL MoAb1;
biotinylated MoAb11 was used in a concentration of 1 µg/mL for
detection. The supernatants were tested in a fivefold dilution in
culture medium. Recombinant TNF- diluted in culture medium was used
as a standard. The standard curves ranged from 5,000 pg/mL to 19 pg/mL.
Cortisol Measurement
Blood from several individual donors was collected, immediately put on
ice and allowed to coagulate. The tubes were spun down for 30 minutes
(3,000 rpm, 4°C); serum was collected and immediately stored at
20°C. Cortisol was measured using the fluorescent polarization immunoassay on the TDx from Abbott (Amstelveen, The Netherlands).
RNA Quantitation Using Semi-quantitative Polymerase Chain
Reaction (PCR)
Whole blood was stimulated with 250 ng/mL LPS, in the absence or
presence of 106 mol/L DEX as described above. After 4 or
20 hours of culture conditions that were found to be optimal for
IL-12(p35/p40) and IL-10, respectivelyerythrocytes were lysed and
mRNA was extracted from the white blood cells using RNAzol B, according
to the instructions of the manufacturer (Biotecx Laboratories, Houston,
TX). Two micrograms of total mRNA was reverse transcribed using a
Reverse Transcription System kit (Promega, Madison, WI) using
conditions ensuring optimal cDNA synthesis. cDNA as a readout of the
mRNA was quantitated in a PCR using the PQB-3 vector24 as
an external standard, which contains primer sequences for IL-10 and
-actin. This vector as well as the PQA-1 vector were kindly provided
by Dr D. Shire (Sanofi, Labège, France). To enable quantitation
of IL-12(p40) and IL-12(p35) cDNA, two complementary
40-mer sequences each encompassing a 20-mer sequence of IL-12(p40) and
of IL-12(p35) were cloned into the HindIII [for IL-12(p40) and
(p35) sense primers] and BamHI sites [for IL-12(p40) and
(p35) antisense primers] of the PQA-1 vector.24 By means of a parallelism test, PQB-3 and PQA-1/IL-12 were verified to be
amplified equally efficient as cDNA from mRNA encoding cytokines or
-actin, when amplified with IL-10, -actin, IL-12(p40), or (p35)
specific primers. cDNA was quantitated in a semi-quantitative fashion
by simultaneously amplifying the cDNA in triplicate and the stepfold
diluted vector as an external standard in duplicate. Amplification was
performed in 50-µL reactions containing 12.5 pmol sense and antisense
primer, 0.25 mmol/L dNTPs (GIBCO-BRL, Gaithersburg, MD), 1 U of Taq DNA polymerase (GIBCO-BRL), and PCR buffer II with 2.5 mmol/L
MgCl2 (Perkin Elmer, Branchbury, NJ) for IL-12(p40) or
(p35) primers and PCR buffer containing 50 mmol/L KCl, 10 mmol/L
TRIS/HCl pH 8.3, 2 mmol/L MgCl2, and 60 ng/mL bovine serum
albumin (BSA) for IL-10 and -actin primers. For the amplification
the following sense and anti-sense primers (Isogen Bioscience,
Maarssen, The Netherlands) were used (given from 5  3): IL-10
sense: ATGCTTCGAGATCTCCGAGA; IL-10 antisense: AAATCGATGACAGCGCCGTA; IL-12(p40) sense: GGAGTACTCCACATTCCTAC; IL-12(p40) antisense: CCATGGCAACTTGAGAGCTG; IL-12(p35) sense: CAGCAACATGCTCCAGAAGG; IL-12(p35) antisense: CCTAGTTCTTAATCCACATC; -actin sense: GGGTCAGAAGGATTCCTATG; and -actin antisense:
GGTCTCAAACATGATCTGGG. Cycling conditions were 30 seconds of
denaturation at 96°C, 1 minute of annealing at 55°C, and 1 minute
of elongation at 72°C during 30 cycles for -actin and 35 cycles
for the cytokines.
PCR products were stained on 1% agarose gels with ethidium bromide or
SYBR Green I (Biozym, Landgraaf, The Netherlands). Densities of the
amplified vector (known amount in femtograms) and of the amplified cDNA
(unknown amount) were analyzed using the Bio-1D digital imaging system
version 6 (Vilber Lourmat, Marne La Vallée, France). The
comparison of these densities enabled the subsequent calculation of
amplified -actin or cytokine cDNA in femtograms. Results are
expressed as a ratio of quantified cytokine product (in femtograms)
over -actin product (in femtograms).
Data Processing and Statistics
The curvefitting option in the Biorad microplatemanager software was
applied to calculate the cytokine concentrations in the supernatants.
Statistical analysis was performed using the Student's t-test
for matched pairs. Differences with a confidence level of 95% or
higher were considered to be statistically significant (P < .05).
| |
RESULTS |
IL-12 and TNF- Production Are More Sensitive for
DEX Than IL-10 Production
Because GC favor Th2 type of immune responses, we were interested in
their effects on IL-10 and IL-12 as cytokines that play a pivotal role
in the development of Th1 and Th2 cells. TNF- was studied as a
positive control for inhibition by GC. We used whole-blood cultures
because these are more representative for in vivo conditions than
cultures of PBMC and because the induction of both IL-10 and IL-12 by
LPS is much more efficient in whole blood cultures.9 Figure
1 shows the results obtained after 24 hours
of stimulation with LPS for IL-10 and IL-12(p40) production (mean of 13 different donors each) and TNF- production (mean of 9 donors). DEX
turned out to have differential suppressive effects on these cytokines.
DEX dose-dependently inhibited the LPS-induced IL-12(p40) production to
26% of the initial response at a concentration of 106
mol/L DEX (P < .01). As shown in Table
1, on average 9.1 × 108
mol/L DEX was needed to achieve 50% inhibition of IL-12(p40). TNF-
was slightly more sensitive in that 50% inhibition was found with 2.6 × 108 mol/L DEX (Fig 1 and Table 1).
View larger version (19K):
[in this window]
[in a new window]
| Fig 1.
Dose-dependent effect of DEX on LPS-induced cytokine
production in whole-blood cultures. IL-10, IL-12(p40), and TNF- were induced in whole-blood cultures with 250 ng/mL LPS and in the presence
of various concentrations DEX. For the induction of IL-12(p70), 1,000 U/mL IFN- was added to the cultures. Supernatants were obtained
after 24 hours. The mean cytokine production is expressed as a
percentage of the initial response in the absence of DEX. The results
of IL-10 ( , n = 13), IL-12(p40) ( , n = 13), IL-12(p70) ( , n = 4), and TNF- ( , n = 9) are expressed as the
mean of the percentage (±SEM) of the initial cytokine response. The
mean absolute values (±SD) in the absence of DEX for IL-12(p70),
IL-12(p40), IL-10, and TNF- were 127 ± 35 pg/mL, 623 ± 419 pg/mL, 411 ± 611 pg/mL, and 2,318 ± 1,499 pg/mL,
respectively.
|
|
In contrast, IL-10 production was relatively insensitive to DEX: a
significant (P < .01) inhibition of IL-10 production to 61% of the initial response was only found with 106
mol/L DEX. As shown in Fig 2A-C for three
individual donors, DEX might not have an effect at all or even
stimulate IL-10 production. In 7 of 13 donors it was possible to
estimate (partly by extrapolation) that 1.04 × 106
mol/L DEX would be needed to achieve 50% inhibition of IL-10 production in these donors (Table 1). In 3 donors we found no inhibition at all, whereas in 3 additional donors the inhibition by
106 mol/L DEX did not exceed 25%, which made
extrapolation impossible. For these donors an IC50 value
>100 is given (Table 1). Similar differences in DEX sensitivity
between IL-10 and the other cytokines were found after 48 hours of
culture (data not shown). Since in several donors IL-10 production was
insensitive to DEX, we performed additional experiments to assess if
endogenous cortisol determined the sensitivity to DEX in vitro. High
endogenous cortisol did not correlate with less suppression of IL-10 or
of IL-12(p40) by DEX in vitro (N = 16, data not shown).
View larger version (27K):
[in this window]
[in a new window]
| Fig 2.
Differential regulation of IL-12(p40) and IL-10 in
individual donors and monocytes. IL-12(p40) () and IL-10 () were
induced in whole-blood cultures with 250 ng/mL LPS and in the presence of various concentrations DEX. The results of three individual donors
are shown (A, B, and C). Monocytes stained with PE-conjugated anti-CD14
antibodies were sorted with a flow cytometer to a purity of more than
98% and cultured as described in Materials and Methods (D). The
results obtained with two individual donors are shown. Cells were
stimulated with LPS in the absence ( ) or presence () of
106 mol/L DEX or in the presence of 106
mol/L DEX and 106 mol/L RU486 ( ). The results are
expressed as a percentage of the initial response with LPS.
|
|
In two subsequent experiments we studied B cells, T cells, and
monocytes that were positively selected by flow cytometry using FITC-conjugated anti-CD19, PE-conjugated anti-CD14, or FITC-conjugated anti-CD3. The obtained cell populations were more than 98% pure. When
stimulated with LPS for 24 hours, production of IL-10 and IL-12(p40)
was only detectable in monocyte cultures. These cytokines were not
detected in LPS-stimulated cultures of T cells or B cells (data not
shown), which is in agreement with recent observations by Guery et
al,25 who showed that normal B cells are not capable of
IL-12 production. As shown in Fig 2D, IL-12(p40) production by
monocytes as opposed to IL-10 production was sensitive to DEX and this
effect was antagonized by 1 µmol/L RU486. Effects of this
glucocorticoid receptor antagonist will be discussed in more detail
below. For the detection of the functional IL-12(p70) protein in our
whole-blood culture system it was necessary to add exogenous IFN-,
which upregulates IL-12(p35) mRNA.26 The mean of results (obtained with whole blood from four different donors) of the effect of
DEX on this protein are shown in Fig 1. On average, 50% inhibition was
found with 6.4 × 108 mol/L DEX. As will be pointed out
below it cannot be excluded that IFN- altered the sensitivity to
DEX. However, additional studies performed in seven donors showed that
in the presence of exogenous IFN-, 106 mol/L DEX
caused on average 80% inhibition of IL-12(p70) and on average 25%
inhibition of IL-10 (data not shown).
To obtain more insight into the effects of DEX in the absence of
IFN-, we studied the expression of the p40 and p35 subunits at the
mRNA level in whole-blood cultures, using a semi-quantitative PCR. In
unstimulated whole blood IL-12(p40) mRNA was below the detection limit
whereas a more than 1,000-fold upregulation was found in response to
LPS; in contrast, a constitutive expression of IL-12(p35) mRNA was
observed which was enhanced threefold in response to LPS (data not
shown). As illustrated in Fig 3 for six
different donors, DEX consistently suppressed (P < .05) the expression of both IL-12(p40) and IL-12(p35) mRNA. As was already found
at the protein level DEX had variable effects on IL-10 mRNA, ranging
from inhibition to stimulation, but on average no inhibition was found.
View larger version (21K):
[in this window]
[in a new window]
| Fig 3.
Sensitivity of IL-12(p40), IL-12(p35) mRNA, and IL-10
mRNA to DEX. mRNA was isolated from whole-blood cultures stimulated with 250 ng/mL LPS with ( ) or without () 106 mol/L
DEX and used to perform semiquantitative RT-PCR assays for IL-12(p40),
IL-12(p35), and IL-10 as described in Materials and Methods. mRNA for
IL-12(p40) and IL-12(p35) were measured after 4 hours of culture,
whereas IL-10 mRNA was measured after 20 hours of culture; these time
points were previously established to be optimal for the expression of
these particular mRNAs. Results shown are density scans of one typical
donor (top) as well as the mean ± SEM of six different healthy
donors, expressed as a percentage of the mRNA expression in the absence
of DEX (bottom). *P < .05.
|
|
On the basis of the donors in which inhibition of IL-10 by DEX could be
detected (Table 1), we conclude thatas far as DEX has suppressive
effectsIL-12 is at least 12-fold more sensitive than IL-10. As will
be discussed below, lack of inhibition in the other donors and the
potential to even stimulate IL-10 production further support the
hypothesis that GC may favor Th2 type of response by differential
effects on IL-10 and IL-12.
Suppression of IL-12 by GC Is Mainly Mediated Via GC Receptors
The differences in DEX sensitivity of IL-12 and IL-10 suggested that
different receptors may be involved in the regulation of these
cytokines. It is known that DEX binds with high affinity to the GC
receptor (GR) and with low affinity to the mineralocorticoid receptor
(MR).27-29 Because the reverse is true for the physiologic glucocorticoid HC,29 we first compared the efficacy of DEX
and HC. As shown in Fig 4 (lower panel)
both HC and DEX were relatively ineffective in the inhibition of IL-10.
As far as the suppression of IL-12(p40) and IL-12(p70) is concerned, HC
was less effective than DEX. On average, a fivefold higher HC
concentration was needed for 50% inhibition of IL-12(p40) (Fig 4,
upper panel) whereas an eightfold higher concentration was needed for
the inhibition of IL-12(p70) (Fig 4, middle panel). These results are
in line with the fact that HC has an eightfold lower affinity for the GR as compared with DEX.
View larger version (15K):
[in this window]
[in a new window]
| Fig 4.
Sensitivity of cytokines to DEX and HC. Cytokines were
induced in whole-blood cultures with 250 ng/mL LPS in the presence of
DEX ( ) or HC (). For the induction of IL-12(p70), 1,000 U/mL IFN- was added to the cultures. The data are expressed as a
percentage ± SEM of the cytokine production in the absence of GC. The
results are the means of the production of IL-12(p40) and IL-10 in
whole-blood cultures of 13 different healthy donors. IL-12(p70)
production is the mean of the results obtained with four different
healthy donors. Cytokines were determined by ELISA in supernatants
harvested after 24 hours of culture.
|
|
The role of the GR in the modulation of cytokines by DEX and HC was
further addressed by using RU486 as an antagonist. Addition of 1 µmol/L of RU486 antagonized the suppressive actions of both DEX and
HC on LPS-induced IL-12(p40), although this antagonizing effect was not
complete (Fig 5, upper panel). A concentration of 50 µmol/L RU486, which increased the IL-12(p40) production more than
twofold (P < .05), completely abrogated the inhibitory effect of DEX, but not of HC (Fig 5, upper panel). This appeared to be
significant on the basis of results obtained in eight different donors
(P < .05). Because HC has an eightfold lower affinity for the GR than DEX we had expected a complete antagonizing effect of RU486
on HC suppression. Because this appears not to be the case, HC may also
mediate suppressive effects via the MR. Therefore, we studied the
effect of the MR agonist aldosterone. The addition of
108 mol/L aldosterone caused 17% suppression of
IL-12(p40) (n = 15, P < .05; data not shown). This shows
that occupation of the MR may indeed contribute to inhibition of
IL-12(p40). However, because the MR antagonist spironolactone did not
antagonize suppression of IL-12(p40) by HC (data not shown), part of
its effect might be mediated by a mechanism different from the GR and
MR. RU486 enhanced IL-12(p70) production, probably by antagonizing the
inhibitory effects of endogenous cortisol.
View larger version (17K):
[in this window]
[in a new window]
| Fig 5.
The GR antagonist RU486 stimulates IL-12 and inhibits
IL-10. Cytokines were induced in whole-blood cultures with 250 ng/mL LPS [for induction of IL-12(p70), 1,000 U/mL IFN- was added to the
cultures] in the absence () or presence of 106 mol/L
DEX () or 106 mol/L HC ( ). The influence of these
GC on IL-12(p40) (upper panel), IL-12(p70) (middle panel), and IL-10
(lower panel) was studied in the absence or presence of 1 or 50 µmol/L RU486. The means of the results ± SEM obtained with eight
different donors are shown. IL-12(p70) production is the mean of the
results ± SEM obtained with four different healthy donors. The data
are expressed as a percentage of the cytokine production in the absence of GC or antagonist. Cytokines were determined by ELISA in supernatants obtained after 24 hours of culture. ND, not done.
|
|
Compared with the effects on IL-12(p40), RU486 was less efficient in
antagonizing the suppressive effect of DEX on the induction of
IL-12(p70) (Fig 5, middle panel). This may have been due to the
presence of exogenous IFN-, which has previously been suggested to
increase the sensitivity to GC.30
Stimulation of IL-10 by GC
Whereas RU486 significantly enhanced the IL-12 production and
antagonized the suppression by GC, different effects were observed with
regard to IL-10. Although the slight inhibitory effect of high GC
concentrations was antagonized by 1 µmol/L RU486, 50 µmol/L RU486
surprisingly caused a significant inhibition (P < .05) of IL-10 production (Fig 5, lower panel), suggesting that complete inactivation of the GR was inhibitory for this cytokine. Because RU486
has been found to act as an agonist on the progesteron receptor when
cyclic adenosine monophosphate (cAMP) levels are
increased,31 we first performed additional studies to
establish whether the effects of RU486 could be mimicked by equimolar
concentrations of progesterone. However, although we could show in
whole-blood cultures of four different donors that RU486 stimulated
IL-12(p40) and inhibited IL-10, we observed that 50 µmol/L
progesterone did not have an effect in these cultures (data not shown).
This suggested that the stimulatory effects of high concentrations of
RU486 on IL-12, but also the inhibition of IL-10, are caused by
inhibition of endogenous cortisol. Indeed, additional experiments with
11 individual donors showed a positive correlation between the
stimulatory effects of RU486 on IL-12(p40) production and cortisol
levels in serum, whereas for IL-10 such a correlation was not found
(Fig 6).
View larger version (14K):
[in this window]
[in a new window]
| Fig 6.
Correlation between antagonizing effects of RU486 and
endogenous cortisol. The levels of cortisol were measured in the serum of 11 healthy donors. In these donors whole-blood cultures were performed as described in Fig 1. The effect of 50 µmol/L RU486 was
studied on IL-10 and IL-12(p40) production. The level of cortisol in
the serum of each donor is plotted against the effect of RU486 on the
IL-10 (bottom) and IL-12(p40) (top) production. The effect of RU486 is
expressed as the percentage of the initial response with LPS in each
donor. Each symbol represents one individual donor. The blood was
collected between 8 and 10 AM and put into culture
immediately after collection.
|
|
IL-10 Is Not an Intermediate in DEX-Mediated Suppression of IL-12
and TNF-
It is well-established that IL-10 can suppress IL-12(p40), IL-12(p70),
and TNF- production.8,9,32 In view of the potential of
GC to stimulate IL-10, we investigated whether IL-10 acted as an
intermediate in the suppression of IL-12(p40), IL-12(p70), and TNF-
by DEX. As shown in Fig 7 (top), the
addition of 5 µg/mL anti-IL-10 to the whole-blood cultures
significantly enhanced the LPS-induced IL-12(p40), IL-12(p70), and
TNF- production (P < .05). Using the increased cytokine
levels as reference values, 1 µmol/L DEX caused 80% inhibition of
TNF-, 86% inhibition of IL-12(p70), and 68% inhibition of
IL-12(p40) in the presence of anti-IL-10. These values did not differ
from the extent of inhibition by DEX found in the absence of
anti-IL-10. Thus, in the presence of anti-IL-10, DEX was still able
to suppress IL-12(p40), IL-12(p70), and TNF- production. Likewise,
we established whether RU486 would stimulate IL-12 under conditions
where IL-10 was already neutralized. As shown in Fig 7 (bottom), RU486
enhanced IL-12(p70) production even in the presence of anti-IL-10.
Moreover, because RU486 and anti-IL-10 synergistically enhanced the
IL-12(p70) it is likely that IL-10 and cortisol suppress IL-12 by
separate mechanisms.
View larger version (29K):
[in this window]
[in a new window]
| Fig 7.
IL-10 is not an intermediate in the suppression of IL-12
by GC. Cytokines were induced in whole-blood cultures as described in
the legend of Fig 1. Cultures were performed in the absence or presence
of 5 µg/mL anti-IL-10 with or without 106 mol/L DEX
(top panel). Results are expressed as a percentage ± SEM of the
cytokine production found in the presence of LPS and in the absence of
anti-IL-10. The results are the means of the IL-12(p40) () and
TNF- () production obtained with nine different healthy donors;
IL-12(p70) production () is based on results obtained with four
different healthy donors. In additional experiments, the effect of 50 µmol/L RU486 (), 5 µg/mL anti-IL-10 (), or both ( ) on
LPS- and IFN--induced IL-12(p70) was studied in nine separate
donors (bottom panel). The results are expressed as a percentage ± SEM of the cytokine production in the presence of LPS and IFN- alone
().
|
|
These results indicate that GC may suppress IL-12 by two complementary
mechanisms: direct inhibition and possibly by upregulation of IL-10.
| |
DISCUSSION |
GC are generally regarded as immunosuppressive and are therefore widely
used for clinical applications ranging from preventing rejection in
transplantation to the treatment of allergic asthma. Recent studies
have pointed to the possibility that GC may have a selective effect in
immune regulation by suppressing IFN- production and promoting IL-4
production by CD4+ T cells.12,15 Our data are
in support of this hypothesis because they showon the basis of
whole-blood cultures stimulated with LPSthat IL-12 is 10 to 100 times
more sensitive to suppression by GC than IL-10, dependent on the
presence of IFN-.
A comparison between DEX and HC showed that the relative suppressive
effects of these GC were consistent with the fact that DEX has a
eightfold higher affinity for the GR than HC.27-29
Antagonism of the suppressive effects by the GR antagonist RU486 and
not by the MR antagonist spironolactone support the conclusion that suppression was largely mediated by the GR. However, because
aldosterone showed a modest suppression of IL-12(p40), a minor
contribution of MR to the effects of HC cannot be excluded completely.
The addition of IFN- to the culturesas a condition required for detectable IL-12(p70) induction in our systemmay have affected the
sensitivity of this cytokine to GC. As has been shown previously, IL-4
and IL-2 decrease the sensitivity to GC by decreasing the affinity of
the GR30; in this system the effect of IL-4 and IL-2 was
abolished by IFN-. Therefore, IFN- may have affected the
sensitivity of IL-12 for GC by increasing the affinity of the GR.
However, in the absence of exogenous IFN-as illustrated with the
use of a semi-quantitative reverse transcriptase-PCRDEX
also suppressed the LPS-induced expression of IL-12(p40) and IL-12(p35)
mRNA but had on average no effect on the expression of IL-10 mRNA. T
cells may express IL-12(p35) mRNA in the absence of IL-12(p40) mRNA,
consistent with the inability of these cells to secrete bioactive
IL-12.23,26 Although our data show that expression of mRNA
for both subunits can be suppressed by DEX, this does not prove that
both mRNAs are equally suppressed in one and the same cell type.
Additional studies using isolated monocytes are needed to establish
whether suppression of the bioactive IL-12 by DEX is accounted for by an effect on one of the subunits in particular or on both.
With regard to IL-10 we observed in various donors stimulation by GC
rather than an inhibitory effect. That this was not a consistent
finding in all donors may be due to the fact that in most of the donors
occupancy of the GR has already occurred by endogenous cortisol and,
consequently, that positive regulation of IL-10 has already been
achieved; such a condition will probably be present in the majority of
the donors because the whole-blood cultures were performed in the
presence of autologous plasma. Preliminary data indicate that
stimulation of IL-10 by low concentrations of cortisol is found more
frequently using cultures of isolated PBMC. A stimulatory role for GC
was in particular evident from the fact that the GR antagonist RU486
inhibited IL-10. This appeared not to be a nonspecific effect because
IL-12(p40) and IL-12(p70) were stimulated. Because RU486 may act as an
agonist for the progesterone receptor,31 we ruled out that
progesterone had inhibitory effects on IL-10 or stimulatory effects on
IL-12 (data not shown).
Additional experiments showed that the stimulatory effects of RU486 on
IL-12(p40) production correlated with endogenous cortisol, suggesting
that this effect of RU486 can be explained by blocking the effects of
endogenous cortisol. The fact that we made this observation despite the absence of a direct negative correlation between the IL-12(p40) production capacity and cortisol (data not
shown) may be explained by assuming that only part of the hormone is
not bound to cortisol-binding protein and available for suppression. In
the case of IL-10 any correlation may be difficult to find if occupancy
of the GR with low levels of cortisol would lead to stimulation and
high concentrations of cortisol with slight suppression of this
cytokine.
Our observations are in line with studies showing that
hypercortisolemia results in increased plasma IL-10 concentrations in
vivo.33,34 However, the mechanism by which these effects may occur are so far unknown. The presence of a GRE in the IL-10 promoter35 points to a potential mechanism of GC in the
stimulation of IL-10, although it is unknown thus far whether this GRE
is functional.
Apart from having stimulatory effects, high concentrations of GC were
inhibitory for IL-10, which has also been shown for DEX on IL-10
production by PBMC and monocytes.36 Mechanisms to be taken
into account in these effects are interference at the level of
transcription factors. Because IL-12(p40) production is regulated by
NF-kB37 this transcription factor may be one of the main
targets of GC, for instance via the induction of IkB.38,39 The relative resistance of IL-10 to GC would be in agreement with the
absence of NF-kB binding sites in the promoter region of the IL-10
gene.35 However, because binding sites for AP-1 and cAMP responsive element binding protein (CREB) are present in the promoter region of IL-10,35 interference with these factors might be one of the mechanisms of IL-10 suppression at pharmacological concentrations of GC. That we did not always observe suppressive effects on IL-10 may be due to the lack of induction of such
transcription factors in individual donors. Interestingly, suppression
of IL-10 by high concentrations of GC appeared to correlate with the
efficiency of LPS to induce IL-10 (data not shown).
Taken together our results indicate that physiological concentrations
of GC inhibit IL-12, but do not affect or even stimulate IL-10. The
overall outcome of increased levels of GC in vivo may thus be that
antigen-presenting cells are modulated to display a functional
phenotype that favors the development of a Th2 response. Indeed,
recently GC have been found to modulate adherent cells in such a way
that they promote Th2 development.40 This bias toward Th2
may be amplified by the direct effects of GC on T
cells.11-13,15 The effects of GC on the level of
antigen-presenting cells and the development of Th cells might explain
why during pregnancy and diseases which are accompanied by excessive
release of GC the cellular immunity is suppressed and the humoral
immunity is enhanced.41,42 Therefore, GR agonists and
antagonists might be of use in selective modulation of Th activity.
| |
FOOTNOTES |
Submitted April 28, 1997;
accepted January 23, 1998.
Address reprint requests to Lex Nagelkerken, PhD, Division
of Immunological and Infectious Diseases, TNO Prevention and Health, PO
Box 2215, 2301 CE, Leiden, The Netherlands.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
We are grateful to Dr Kees Lucas for critically reviewing the
manuscript and to Bep Blauw and Ellen Siemssen for technical assistance. The assistance of Guus Westra (Department of Hematology, Free University Academical Hospital, Amsterdam, The Netherlands) with
the FACS-sorting is highly appreciated. Furthermore, we thank Dr Eef
Lentjes (Department of Clinical Chemistry, University Hospital Leiden,
Leiden, The Netherlands) for performing the cortisol measurements. We
are also grateful to Prof G. Trinchieri (Wistar Institute, Philadelphia, PA) for providing us with the hybridomas C11.79 and C8.6.
| |
REFERENCES |
1.
Mosmann TR,
Coffman RL:
Th1 and Th2 cells: Different patterns of lymphokine secretion lead to different functional properties.
Annu Rev Immunol
7:145,
1989[Medline]
[Order article via Infotrieve]
2.
Romagnani S:
Lymphokine production by human T cells in disease states.
Annu Rev Immunol
7:145,
1994
3.
O'Garra A,
Murphy K:
T-cell subsets in autoimmunity.
Curr Opin Immunol
5:880,
1993[Medline]
[Order article via Infotrieve]
4.
Paul WE,
Seder RA:
Lymphocyte responses and cytokines.
Cell
76:241,
1994[Medline]
[Order article via Infotrieve]
5.
Hsieh CS,
Macatonia SE,
Tripp CS,
Wolf SF,
O'Garra A,
Murphy KM:
Development of Th1 CD4+ T cells through IL-12 produced by Listeria-induced macrophages.
Science
260:547,
1993[Abstract/Free Full Text]
6.
Trinchieri G:
Interleukin-12: A proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen specific adaptive immunity.
Annu Rev Immunol
13:251,
1995[Medline]
[Order article via Infotrieve]
7.
Frankenberger M,
Sternsdorf T,
Pechumer H,
Pforte A,
Loms Ziegler-Heitbrock HW:
Differential cytokine expression in human blood monocyte subpopulations.
Blood
87:373,
1996[Abstract/Free Full Text]
8.
D'Andrea A,
Aste-Amezaga M,
Valiante NM,
Ma X,
Kubin M,
Trinchieri G:
Interleukin 10 inhibits human lymphocyte interferon- production by suppressing natural killer cell stimulatory factor/IL-12 synthesis in accessory cells.
J Exp Med
178:1041,
1993[Abstract/Free Full Text]
9.
van der Pouw Kraan T,
Boeije L,
Smeenk R,
Wijdenes J,
Aarden L:
Prostaglandin-E2 is a potent inhibitor of human interleukin-12 production.
J Exp Med
181:775,
1995[Abstract/Free Full Text]
10.
Hilkens CM,
Snijders A,
Vermeulen H,
van der Meide PH,
Wierenga EA,
Kapsenberg ML:
Accessory cell derived IL-12 and prostaglandin-E2 determine the IFN- level of activated human CD4+ T cells.
J Immunol
156:1722,
1996[Abstract]
11.
Daynes RA,
Araneo BA:
Contrasting effects of glucocorticoids on the capacity of T cells to produce growth factors interleukin-2 and interleukin-4.
Eur J Immunol
19:2319,
1989[Medline]
[Order article via Infotrieve]
12.
Ramirez F,
Fowell DJ,
Puklavec M,
Simmonds S,
Mason D:
Glucocorticoids promote a Th2 cytokine response by CD4+ T cells in vitro.
J Immunol
156:2406,
1996[Abstract]
13.
Nijhuis EWP,
Hinloopen B,
van Lier RAW,
Nagelkerken L:
Differential sensitivity of human naive and memory CD4+ T cells for dexamethasone.
Int Immunol
7:591,
1995[Abstract/Free Full Text]
14.
Nijhuis EWP,
Hinloopen B,
Odding J,
Nagelkerken L:
Abrogation of the suppressive effects of dexamethasone by PKC activation or CD28.
Cell Immunol
156:438,
1994[Medline]
[Order article via Infotrieve]
15.
Brinkman V,
Kristofic C:
Regulation by corticosteroids of Th1 and Th2 cytokine production in human CD4+ effector T cells generated from CD45RO and CD45RO+ subsets.
J Immunol
155:3322,
1995[Abstract]
16.
Bohle B,
Willheim M,
Baier K,
Stadler B,
Spitzauer S,
Scheiner O,
Ebner C:
Hydrocortisone enhances total IgE levelsbut not the synthesis of allergen specific IgEin a monocyte-dependent manner.
Clin Exp Immunol
101:474,
1994
17.
Wu CY,
Sarfati M,
Heusser C,
Fournier S,
Rubio-Trujillo M,
Peleman R,
Delespesse G:
Glucocorticoids increase the synthesis of immunoglobulin E by interleukin-4 stimulated human lymphocytes.
J Clin Invest
87:870,
1991
18.
Nüsslein HG,
Weber G,
Kalden JR:
Synthetic glucocorticoids potentiate IgE synthesis.
Allergy
49:365,
1994[Medline]
[Order article via Infotrieve]
19.
MacPhee I,
Antoni F,
Mason D:
Spontaneous recovery of rats from experimental allergic encephalomyelitis is dependent on regulation of the immune system by endogenous adrenal corticosteroids.
J Exp Med
169:431,
1989[Abstract/Free Full Text]
20.
Mason D:
Genetic variation in the stress response: Susceptibility to experimental allergic encephalomyelitis and implications for human inflammatory disease.
Immunol Today
12:57,
1991[Medline]
[Order article via Infotrieve]
21.
Mason D,
MacPhee I,
Antoni F:
The role of the neuroendocrine system in determining genetic susceptibility to experimental allergic encephalomyelitis in the rat.
Immunology
70:1,
1990[Medline]
[Order article via Infotrieve]
22.
Chikanza IC,
Petrou P,
Kingsley G,
Chrousos G,
Panayi GS:
Defective hypothalamic response to immune and inflammatory stimuli in patients with rheumatoid arthritis.
Arthritis Rheum
35:1281,
1992[Medline]
[Order article via Infotrieve]
23.
D'Andrea A,
Rengaraju M,
Valiante NM,
Chehimi J,
Kubin M,
Aste M,
Chan SH,
Kobayashi M,
Young D,
Nickbarg E,
Chizzonite R,
Wolf SF,
Trinchieri G:
Production of natural killer cell stimulatory factor (interleukin-12) by peripheral blood mononuclear cells.
J Exp Med
176:1387,
1992[Abstract/Free Full Text]
24.
Shire D:
An invitation to an open exchange of reagents and information useful for the measurement of cytokine mRNA levels by PCR.
Eur Cytokine Network
4:161,
1993
25.
Guery JC,
Ria F,
Galbiati F,
Adorini L:
Normal B cells fail to secrete interleukin 12.
Eur J Immunol
7:1632,
1997
26.
Snijders A,
Hilkens CM,
van der Pauw Kraan TC,
Engel M,
Aarden LA,
Kapsenberg ML:
Regulation of bioactive IL-12 production in lipopolysaccharide-stimulated human monocytes is determined by the expression of the p35 subunit.
J Immunol
156:1207,
1996[Abstract]
27.
Evans RM,
Arriza JL:
A molecular framework for the actions of glucocorticoid hormones in the nervous system.
Neuron
2:1105,
1989[Medline]
[Order article via Infotrieve]
28.
de Kloet ER:
Brain corticosteroid receptor balance and homeostatic control.
Front Neuroendocrinol
12:95,
1991
29.
Munck A,
Guyre PM,
Holbrook NJ:
Physiological functions of glucocorticoids in stress and their relation to pharmacological actions.
Endocrine Rev
5:25,
1984[Abstract/Free Full Text]
30.
Kam JC,
Szefler SJ,
Surs W,
Sher ER,
Leung DY:
Combination IL-2 and IL-4 reduces glucocorticoid receptor-binding affinity and T cells response to glucocorticoids.
J Immunol
151:3460,
1993[Abstract]
31.
Beck CA,
Weigel NL,
Moyer ML,
Nordeen SK,
Edwards DP:
The progesterone antagonist RU 486 acquires agonist activity upon stimulation of cAMP signaling pathways.
Proc Natl Acad Sci USA
90:4441,
1993[Abstract/Free Full Text]
32.
de Waal Malefyt R,
Abrams J,
Bennet B,
Figdor CG,
de Vries JR:
Interleukin-10 (IL-10) inhibits cytokine synthesis by human monocytes: an autoregulatory role of IL-10 produced by monocytes.
J Exp Med
174:1209,
1991[Abstract/Free Full Text]
33.
van der Poll T,
Barber AE,
Coyle SM,
Lowry SF:
Hypercortisolemia increases plasma interleukin-10 concentrations during human endotoxemiaa clinical research center study.
J Clin Endocrinol Metab
81:3604,
1996[Abstract]
34.
Tabardel Y,
Duchateau J,
Schmartz D,
Marecaux G,
Shahla M,
Barvais L,
Leclerc JL,
Vincent JL:
Corticosteroids increase blood interleukin 10 levels during cardiopulmonary bypass in men.
Surgery
119:76,
1996[Medline]
[Order article via Infotrieve]
35.
Platzer C,
Meisel Ch,
Vogt K,
Platzer M,
Volk HD:
Upregulation of monocytic IL-10 by tumor necrosis factor-alpha and cAMP elevating drugs.
Int Immunol
4:517,
1995
36.
Fushimi T,
Okayama H,
Seki T,
Shimura S,
Shirato K:
Dexamethasone suppressed gene expression and production of interleukin-10 by human peripheral mononuclear cells and monocytes.
Int Arch Allergy Immunol
112:13,
1997[Medline]
[Order article via Infotrieve]
37.
Murphy TL,
Cleveland MC,
Kulesza P,
Magram J,
Murphy KM:
Regulation of Interleukin 12(p40) expression through an NF-kB half-site.
Mol Cell Biol
10:5258,
1995
38.
Scheinman RI,
Cogswell PC,
Lofquist AK,
Baldwin AS Jr:
Role of transcriptional activation of IkB in mediation of immunosuppression by glucocorticoids.
Science
270:283,
1995[Abstract/Free Full Text]
39.
Auphan N,
Di Donato JA,
Rosette C,
Helmberg A,
Karin M:
Immunosuppression by glucocorticoids: Inhibition of NF-kB activity through induction of IkB synthesis.
Science
270:286,
1995[Abstract/Free Full Text]
40.
Blotta MH,
de Kruyff RH,
Umetsu DT:
Corticosteroids inhibit IL-12 production in human monocytes and enhance their capacity to induce IL-4 synthesis in CD4+ lymphocytes.
J Immunol
158:5589,
1997[Abstract]
41.
Rook GA,
Hernandez-Pando R,
Lightman SL:
Hormones, peripherally activated prohormones and regulation of the Th1/Th2 balance.
Immunol Today
7:301,
1994
42.
Wilder RL:
Neuroendocrine-immune system interactions and autoimmunity.
Annu Rev Immunol
13:307,
1995[Medline]
[Order article via Infotrieve]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
H. Flaster, J. Bernhagen, T. Calandra, and R. Bucala
The Macrophage Migration Inhibitory Factor-Glucocorticoid Dyad: Regulation of Inflammation and Immunity
Mol. Endocrinol.,
June 1, 2007;
21(6):
1267 - 1280.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. C. Liberman, D. Refojo, J. Druker, M. Toscano, T. Rein, F. Holsboer, and E. Arzt
The activated glucocorticoid receptor inhibits the transcription factor T-bet by direct protein-protein interaction
FASEB J,
April 1, 2007;
21(4):
1177 - 1188.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. L. Salak-Johnson and J. J. McGlone
Making sense of apparently conflicting data: Stress and immunity in swine and cattle
J Anim Sci,
March 1, 2007;
85(13_suppl):
E81 - E88.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Lange, S. Dimitrov, H.-L. Fehm, J. Westermann, and J. Born
Shift of monocyte function toward cellular immunity during sleep.
Arch Intern Med,
September 18, 2006;
166(16):
1695 - 1700.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Cannarile, F. Fallarino, M. Agostini, S. Cuzzocrea, E. Mazzon, C. Vacca, T. Genovese, G. Migliorati, E. Ayroldi, and C. Riccardi
Increased GILZ expression in transgenic mice up-regulates Th-2 lymphokines
Blood,
February 1, 2006;
107(3):
1039 - 1047.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Stock, O. Akbari, R. H. DeKruyff, and D. T. Umetsu
Respiratory Tolerance Is Inhibited by the Administration of Corticosteroids
J. Immunol.,
December 1, 2005;
175(11):
7380 - 7387.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Lowenberg, J. Tuynman, J. Bilderbeek, T. Gaber, F. Buttgereit, S. van Deventer, M. Peppelenbosch, and D. Hommes
Rapid immunosuppressive effects of glucocorticoids mediated through Lck and Fyn
Blood,
September 1, 2005;
106(5):
1703 - 1710.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. A. Newton, T. Lu, S. J. Nazian, I. Perkins, H. Friedman, and T. W. Klein
The THC-induced suppression of Th1 polarization in response to Legionella pneumophila infection is not mediated by increases in corticosterone and PGE2
J. Leukoc. Biol.,
October 1, 2004;
76(4):
854 - 861.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. E. Wiley, M. Cwiartka, D. Alvarez, D. C. Mackenzie, J. R. Johnson, S. Goncharova, L. Lundblad, and M. Jordana
Transient Corticosteroid Treatment Permanently Amplifies the Th2 Response in a Murine Model of Asthma
J. Immunol.,
April 15, 2004;
172(8):
4995 - 5005.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Edwards, F. Hucklebridge, A. Clow, and P. Evans
Components of the Diurnal Cortisol Cycle in Relation to Upper Respiratory Symptoms and Perceived Stress
Psychosom Med,
March 1, 2003;
65(2):
320 - 327.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Creery, J. B. Angel, S. Aucoin, W. Weiss, W. D. Cameron, F. Diaz-Mitoma, and A. Kumar
Nef Protein of Human Immunodeficiency Virus and Lipopolysaccharide Induce Expression of CD14 on Human Monocytes through Differential Utilization of Interleukin-10
Clin. Vaccine Immunol.,
November 1, 2002;
9(6):
1212 - 1221.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. J. Barrat, D. J. Cua, A. Boonstra, D. F. Richards, C. Crain, H. F. Savelkoul, R. de Waal-Malefyt, R. L. Coffman, C. M. Hawrylowicz, and A. O'Garra
In Vitro Generation of Interleukin 10-producing Regulatory CD4+ T Cells Is Induced by Immunosuppressive Drugs and Inhibited by T Helper Type 1 (Th1)- and Th2-inducing Cytokines
J. Exp. Med.,
March 4, 2002;
195(5):
603 - 616.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. J. Haddad, S. C. Land, W. O. Tarnow-Mordi, M. Zembala, D. Kowalczyk, and R. Lauterbach
Immunopharmacological Potential of Selective Phosphodiesterase Inhibition. I. Differential Regulation of Lipopolysaccharide-Mediated Proinflammatory Cytokine (Interleukin-6 and Tumor Necrosis Factor-alpha ) Biosynthesis in Alveolar Epithelial Cells
J. Pharmacol. Exp. Ther.,
February 1, 2002;
300(2):
559 - 566.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. J. Haddad and S. C. Land
Amiloride Blockades Lipopolysaccharide-Induced Proinflammatory Cytokine Biosynthesis in an Ikappa B-alpha /NF-kappa B-Dependent Mechanism . Evidence for the Amplification of an Antiinflammatory Pathway in the Alveolar Epithelium
Am. J. Respir. Cell Mol. Biol.,
January 1, 2002;
26(1):
114 - 126.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. S. SALVI, K. SURESH BABU, and S. T. HOLGATE
Is Asthma Really Due to a Polarized T Cell Response Toward a Helper T Cell Type 2 Phenotype?
Am. J. Respir. Crit. Care Med.,
October 15, 2001;
164(8):
1343 - 1346.
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Crawley, S. Kon, and P. Woo
Hereditary predisposition to low interleukin-10 production in children with extended oligoarticular juvenile idiopathic arthritis
Rheumatology,
May 1, 2001;
40(5):
574 - 578.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G.A.W. Rook, G. Seah, and A. Ustianowski
M. tuberculosis: immunology and vaccination
Eur. Respir. J.,
March 1, 2001;
17(3):
537 - 557.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
W W Chatham and R P Kimberly
Treatment of lupus with corticosteroids
Lupus,
March 1, 2001;
10(3):
140 - 147.
[Abstract]
[PDF]
|
|
|
|
|
|
|
J. M. Bakker, A. Kavelaars, P. J. G. H. Kamphuis, P. M. Cobelens, H. H. van Vugt, F. van Bel, and C. J. Heijnen
Neonatal Dexamethasone Treatment Increases Susceptibility to Experimental Autoimmune Disease in Adult Rats
J. Immunol.,
November 15, 2000;
165(10):
5932 - 5937.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. W. BAKER, B. R. WALKER, R. J. SHAW, J. W. HONOUR, D. S. JESSOP, S. L. LIGHTMAN, A. ZUMLA, and G. A. W. ROOK
Increased Cortisol . Cortisone Ratio in Acute Pulmonary Tuberculosis
Am. J. Respir. Crit. Care Med.,
November 1, 2000;
162(5):
1641 - 1647.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
T. W. Klein, B. Lane, C. A. Newton, and H. Friedman
The Cannabinoid System and Cytokine Network
Experimental Biology and Medicine,
October 1, 2000;
225(1):
1 - 8.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
T. W. Klein, C. A. Newton, N. Nakachi, and H. Friedman
{Delta}9-Tetrahydrocannabinol Treatment Suppresses Immunity and Early IFN-{gamma}, IL-12, and IL-12 Receptor {beta}2 Responses to Legionella pneumophila Infection
J. Immunol.,
June 15, 2000;
164(12):
6461 - 6466.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Rea, C. van Kooten, K. E. van Meijgaarden, T. H. M. Ottenhoff, C. J. M. Melief, and R. Offringa
Glucocorticoids transform CD40-triggering of dendritic cells into an alternative activation pathway resulting in antigen-presenting cells that secrete IL-10
Blood,
May 15, 2000;
95(10):
3162 - 3167.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
X. Ma, J. Sun, E. Papasavvas, H. Riemann, S. Robertson, J. Marshall, R. T. Bailer, A. Moore, R. P. Donnelly, G. Trinchieri, et al.
Inhibition of IL-12 Production in Human Monocyte-Derived Macrophages by TNF
J. Immunol.,
February 15, 2000;
164(4):
1722 - 1729.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Franchimont, H. Martens, M.-T. Hagelstein, E. Louis, W. Dewe, G. P. Chrousos, J. Belaiche, and V. Geenen
Tumor Necrosis Factor {alpha} Decreases, and Interleukin-10 Increases, the Sensitivity of Human Monocytes to Dexamethasone: Potential Regulation of the Glucocorticoid Receptor
J. Clin. Endocrinol. Metab.,
August 1, 1999;
84(8):
2834 - 2839.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
P. L. Vieira, P. Kalinski, E. A. Wierenga, M. L. Kapsenberg, and E. C. de Jong
Glucocorticoids Inhibit Bioactive IL-12p70 Production by In Vitro-Generated Human Dendritic Cells Without Affecting Their T Cell Stimulatory Potential
J. Immunol.,
November 15, 1998;
161(10):
5245 - 5251.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract