|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 11 (June 1), 1998:
pp. 4265-4272
Interleukin-15 (IL-15) Can Replace the IL-2 Signal in IL-2-Dependent
Adult T-Cell Leukemia (ATL) Cell Lines: Expression of IL-15 Receptor
 on ATL Cells
By
Yasuaki Yamada,
Kazuyuki Sugawara,
Tomoko Hata,
Kazuto Tsuruta,
Ryozo Moriuchi,
Takahiro Maeda,
Sunao Atogami,
Ken Murata,
Kenshi Fujimoto,
Tomoko Kohno,
Kunihiro Tsukasaki,
Masao Tomonaga,
Yo-ichi Hirakata, and
Shimeru Kamihira
From the Departments of Laboratory Medicine, Bacteriology, and
Oncology, Nagasaki University School of Medicine; and the Department of
Hematology, Atomic Disease Institute, Nagasaki University School of
Medicine, Nagasaki, Japan.
 |
ABSTRACT |
Interleukin-15 receptor (IL-15R) and IL-2R have the same  and  chains, but IL-15R has a specific  chain distinct from
that of IL-2R, which is indispensable for the high affinity binding of IL-15. In the present study, we examined four IL-2-dependent adult
T-cell leukemia (ATL) cell lines for their IL-15R expression. All cell
lines bound IL-15, which was not inhibited by a 100-fold excess amount
of IL-2, proliferated in response to IL-15 to the same degree as to the
stimulation with IL-2, and were maintained without IL-2. The responses
to 1L-15 were inhibited by the antibodies against IL-2R or chains but was not by the IL-2R chain antibody. [125I]-IL-15 exhibited a single high-affinity binding
with an apparent kd of 0.17 nmol/L. Reverse
transcription-coupled polymerase chain reaction (RT-PCR) showed that
the cell lines had the mRNA of IL-15R . The cell lines also had
IL-15 mRNA. Despite the presence of IL-15 mRNA, the cell lines did not
secrete IL-15, and the culture supernatants of fresh ATL cells and
plasma from the patients did not contain a detectable amount of IL-15
with a few exceptional cases, although fresh ATL cells also responded
to IL-15. These results suggest that ATL cells have the complete form
of IL-15R and respond to IL-15. Such an IL-15-dependent cell
proliferation mechanism might be used in the development of ATL and for
the invasion and proliferation of ATL cells in the visceral organs.
| |
INTRODUCTION |
INTERLEUKIN-15 (IL-15) has been observed
in a culture supernatant of a simian kidney cell line (CV/EBNA) as a
factor that activates T cells similarly to IL-2, which is now known to
be identical to the IL-T found in the culture supernatant of the cell
line HuT-102 described below.1,2 Although IL-15 mRNA is
present in a wide variety of cells and tissues including monocytes, placenta, skeletal muscle, kidney, lung, and heart, the IL-15 protein
product has rarely been shown in their culture supernatants, except for
monocytes.1 It has been reported that T cells do not have
IL-15 mRNA.1 IL-15 receptor (IL-15R) and IL-2R have and
chains in common,3 but IL-15R has an chain
different from that of IL-2R , which is essential for the
high-affinity binding of IL-15.4 The IL-15R gene was
recently cloned, and it was shown that a variety of cells, including T
cells and T-cell lines and many tissues, have the mRNA of IL-15R ,
and the expression is enhanced by activation with anti-CD3 antibody or
phorbol myristate acetate (PMA) in T cells.4 Interestingly,
IL-2R binds IL-2 with low affinity,5 whereas IL-15R binds IL-15 with high affinity.6 A high expression of
IL-15R on activated T cells is favorable for their proliferation.
Adult T-cell leukemia (ATL) is a neoplasm of mature helper/inducer
T-cell origin7,8 caused by human T-cell leukemia virus type-I (HTLV-I).9-11 Although T cells usually do not
produce IL-15, the unique HTLV-I+ T-cell line HuT-102
synthesizes and secretes IL-15 due to the production of a chimeric mRNA
joining a segment of the R region of the long terminal repeat (LTR) of
HTLV-I and the 5 -untranslated region (UTR) of
IL-15.12,13 ATL cells constitutively express IL-2R due
to the transactivation by the p40tax of
HTLV-I14 and respond to IL-2 in vitro. In the present study we examined whether four IL-2-dependent ATL cells lines established in
our laboratory15-17 bind IL-15 and respond to IL-15. These
cell lines are totally dependent on exogenous IL-2 and stop
proliferating without IL-2, except for one cell line (OMT), which tends
to proliferate autonomously. These cell lines responded to IL-15 to the
same degree as to IL-2, and IL-15 could be replaced with IL-2 signal. Because IL-2R transduces the IL-15 signal,18 there was
a possibility that IL-15 bound IL-2R instead of IL-15R and transduced
the signal. The results of our inhibition study excluded this
possibility. One-hundred-fold excess amount of IL-2 did not inhibit
the binding of IL-15. Although anti-IL-2R and chain antibodies
inhibited the proliferation induced by IL-15, anti-IL-2R chain
antibody did not. Moreover, the cell line bound
[125I]-IL-15 with a single high-affinity binding and had
the mRNA of IL-15R . To our knowledge, this is the first report
showing that ATL cells have the complete form of IL-15R and that the
IL-2 signal can be replaced with IL-15. We also examined the production of IL-15 from the cell lines and fresh ATL cells, the response of fresh
ATL cells to IL-15, and the concentration of IL-15 in plasma from ATL
patients. We discussed the pathological role of IL-15 in ATL.
| |
MATERIALS AND METHODS |
Cell preparation and IL-15 assay.
Cell lines SO4, ST1, and KK1 are of true ATL cell origin, as confirmed
by the concordance of the integration site(s) of the HTLV-I proviral
genome and/or the T-cell receptor chain gene rearrangement
profiles with respective original leukemia cells. These cell lines have
been maintained in our laboratory with 0.25 Takeda units/mL (100 Japan
reference units/mL, 10 ng/mL) of recombinant IL-2 (rIL-2) (kindly
provided by Takeda Chemical Industries, Osaka, Japan) for several
years. OMT is a recently established cell line and shows helper/inducer
T-cell phenotype, but it has not yet been established whether OMT is of
true ATL cell origin or HTLV-I-infected normal T-cell origin. SO4,
ST1, and KK1 are totally dependent on exogenous IL-2 and stop
proliferating without IL-2 and die. OMT tends to proliferate
autonomously and is able to survive without IL-2 for several weeks.
Heparinized peripheral blood was drawn from acute or chronic ATL
patients, and their mononuclear cells were used as fresh ATL cells.
Morphological and marker analyses indicated that the extents of ATL
cells in these samples were always more than 80%. Plasma was collected
from the same patients. All materials from the patients were obtained
after informed consent. The cell lines and fresh ATL cells were
cultured with or without rIL-2 at a cell density of 2 × 106/mL for 24 hours, and the culture supernatants were
collected. The supernatants and plasma from ATL patients were examined
for the concentration of IL-15 protein. The concentration of IL-15 was
estimated by an enzyme-linked immunosorbent assay using a IL-15
detection Kit (Quantikine; R&D Systems, Minneapolis, MN). The limit of
the detection kit is 1 pg/mL. The culture supernatant of the HuT-102
cell line (which is known to produce IL-15 protein12) was
used as a positive control.
Cell proliferation assay.
The cell lines were washed extensively with fresh medium before
culturing to remove contaminated IL-2. Then, 1 × 104
cells/100 µL were cultured with rIL-2 (0.25 U/mL) or rIL-15 (10 ng/mL; Pharmingen, San Diego, CA) in 96-well tissue culture plates for
48 hours, and the proliferation status of each cell line was estimated
by measuring the conversion of
3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) into water-soluble formazan (CellTiter 96TMAQueous; Promega, Madison, WI). The effects of monoclonal antibodies (MoAbs) against IL-15 (Genzyme Diagnostics, Cambridge, MA), IL-2R chain (Pharmingen), IL-2R chain (Pharmingen), or IL-2R chain
(Sumitomo Electric Industry, Yokohama, Japan) on the proliferation of
these cell lines were also examined by the same method. In the case of
IL-2R antibody, sodium azide added as a preservative was removed by
extensive dialysis of the antibody with phosphate-buffered saline
(PBS). MoAbs were used at 10 µg/mL of concentration. In the case of
fresh ATL cells, the cells were cultured at a cell density of 1 × 105 cells/100 µL with IL-2 or IL-15 for up
to 4 days and their proliferation status was compared with the cells
cultured without these cytokines. All experiments were performed in
triplicate.
Cytofluorometric analysis of the expressions of IL-2R and IL-15R.
The binding of IL-15 on the surface of the ATL cell lines was examined
by an indirect immunofluorescence assay. Cells incubated with rIL-15
(50 ng/mL) or PBS as a negative control for 30 minutes at 4°C were
examined. Anti-IL-15 antibody (mouse IgG) was used as the first
antibody and FITC-conjugated goat anti-mouse IgG antibody (Ortho
Diagnostic Systems, Raritan, NJ) as a second antibody. The labeled
cells were processed by flow cytometry. To study the inhibition of IL-2
on IL-15 binding, the same assay was done in the presence of 100-fold
excess amount of IL-2 (5 µg/mL). The surface expressions of IL-2R
, , and chains were also examined likewise using the
antibodies used for the inhibition study.
IL-15 binding assay.
IL-15 was radio-iodinated by the Bolton-Hunter method according to the
manufacturer's instructions. In brief, 5 µg of rIL-15 was labeled
with 100 µCi of Bolton-Hunter reagent (BHR: NEN; Life Science
Products, Boston, MA) in 20 mmol/L K-phosphate buffer (pH
8.0) for 60 minutes on ice. Then, 1 mmol/L of glycine was added to
terminate the reaction. The labeled IL-15 was separated from the
unreacted BHR and glycine by an ultrafiltration membrane UFC3LCC
(Millipore, Bedford, MA). The radiospecific activity of the
[125I]-IL-15 was 432 cpm/fmol. ST1 cells, 5 × 105, were incubated for 60 minutes on ice with various
concentrations of [125I]-IL-15 (10 pmol/L to 1.25 nmol/L)
in the absence (total binding) or presence of a 200-fold excess amount
of unlabeled IL-15 (nonspecific binding) in a total volume of 150 µL.
Specific binding was calculated by subtracting nonspecifically bound
counts per minute from total bound counts per minute. All experiments
were performed in triplicate. Dissociation constants (kd) were
calculated from the binding data by Scatchard plot analysis.
Reverse transcription-coupled polymerase chain reaction (RT-PCR).
Total RNA was extracted from the four cell lines, fresh ATL cells, the
HL-60 myeloid leukemia cell line as a control, and the resting or
activated peripheral blood mononuclear cells (PBMC) of healthy adults
by the ISOGEN kit (Nippon Gene, Toyama, Japan) and treated with DNase
(Message CleanTM Kit; GenHunter, Nashville, TN) to remove contaminated
DNA. PBMC were activated by Concanavalin A (Con A; Sigma Chemical Co,
St Louis, MO) at a concentration of 10 µg/mL for 48 hours. RT-PCR was
performed according to the manufacturer's directions (GeneAmp RNA PCR
Kit; Perkin-Elmer, Foster, CA). cDNA was synthesized from 1 µg of RNA
by incubation with Moloney murine leukemia virus RT (2.5 U/µL) and
2.5 µmol/L oligo d(T)16 primer for 20 minutes at
42°C. The reaction was stopped by heating the sample to 99°C
for 5 minutes. Two microliters of the cDNA obtained was amplified by 35 cycles (for IL-15) or 30 cycles (for IL-15R) with AmpliTaq DNA
polymerase. The reaction conditions were 94°C for 30 seconds, 55°C (for IL-15) or 60°C (for IL-15R ) for 30 seconds, and 72°C for 60 seconds. The oligonucleotide primers used
were as follows: for IL-15: TAAAACAGAAGCCAACTG (615-632) and
CAAGAAGTGTTGATGAACAT (952-971); for IL-15R : GTCAAGAGCTACAGCTTGTAC (218-238) and GGTGAGCTTTCTCCTGGAG (977-995).19 The expected amplification product sizes of IL-15 and IL-15R are 357 and 778 bp,
respectively. -Actin was used as a control for the RT-PCR product.
Southern blot.
Because the RT-PCR of IL-15R yielded a few products of unexpected sizes
(besides 778 bp), Southern blotting was performed for confirmation of
their IL-15R origin. The PCR products were separated on 2% agarose
gels, denatured, and transferred onto a positively charged nylon
membrane (Boehringer Mannheim, Mannheim, Germany), and probed with a
digoxigenin-labeled internal oligonucleotide, GCTGTGTTGTTTGAGCTGG.19 The membrane was treated with an
anti-digoxigenin antibody conjugated with alkaline phosphatase
(AP)(Boehringer Mannheim), and the AP was changed to a light signal by
CDP-StarTM (Boehringer Mannheim) and exposed to film.
| |
RESULTS |
Response of ATL cell lines to IL-2 and IL-15.
The cell proliferation status of each cell line cultured with or
without IL-2 (0.25 U/mL) or IL-15 (10 ng/mL) for 48 hours was
estimated. All cell lines except OMT, which tends to proliferate autonomously, stopped proliferation and almost died at 48 hours without
IL-2 or IL-15 (Table 1). All cell lines
including OMT responded to IL-15 stimulation, proliferated, and were
maintained for months with IL-15 alone (data not shown). The extent of
the responses to IL-15 were somewhat less than those to IL-2,
especially in the SO4 cell line (Table 1). The dose-response curves for IL-15 indicated that the maximum response was obtained at around 10 to
20 ng/mL concentrations in all cell lines
(Fig 1). The KK1 cell line responded the
most strongly to IL-15 and proliferated at a concentration as little as
0.6 ng/mL.
View larger version (19K):
[in this window]
[in a new window]
| Fig 1.
Dose-response curves of IL-15-induced proliferation of
ATL cell lines. Cells were cultured with different concentrations of IL-15. All cells responded to IL-15, with the maximum responses at
around 10 to 20 ng/mL. KK1 responded at a concentration as little as
0.6 ng/mL and proliferated the most strongly.
|
|
Cytofluorometric analysis of the IL-15 binding on ATL cell lines.
To observe the binding of IL-15 on the cell surface, cells were
incubated with IL-15 and the cell-surface-bound IL-15 was detected by
the anti-IL-15 antibody. All four ATL cell lines bound enough IL-15 to
be visualized by flow cytometry, and the binding was not inhibited by a
100-fold excess amount of IL-2 (Fig 2). The
anti-IL-15 antibody inhibited the IL-15-induced cell proliferation but did not inhibit the IL-2-induced cell proliferation
(Fig 3), suggesting that the antibody
blocks the binding site of IL-15 to the IL-15R. The inhibition of the
proliferation was minimal on the OMT cell line because of its
autonomous proliferative ability.
View larger version (11K):
[in this window]
[in a new window]
View larger version (11K):
[in this window]
[in a new window]
View larger version (11K):
[in this window]
[in a new window]
View larger version (11K):
[in this window]
[in a new window]
| Fig 2.
Cytofluorometric analysis of the binding of IL-15 on ATL
cell lines. After incubation of the cell lines with IL-15 in the absence (a) or presence (b) of 100-fold excess amount of IL-2, the
cell-surface-bound IL-15 was detected by an anti-IL-15 MoAb (closed
histogram). All cell lines had almost the equivalent amounts of the
IL-15 binding sites, which were not inhibited by IL-2. Open hitograms
indicate the cells incubated with a control MoAb.
|
|
View larger version (33K):
[in this window]
[in a new window]
| Fig 3.
Inhibition of the IL-15-induced proliferation of ATL
cell lines by anti-IL-15 antibody. Anti-IL-15 antibody inhibited the proliferation induced by IL-15 but did not inhibit the proliferation induced by IL-2. The extent of the inhibition was the lowest in OMT
cell line.
|
|
Inhibition of the IL-15-induced proliferation of ATL cell lines by
anti-IL-2R , , and chain antibodies.
Because there was a possibility that IL-15 used IL-2R instead of IL-15R
for the cell-surface binding and signaling for proliferation, an
inhibition study using antibodies against IL-2R , , and chains was performed. All cell lines expressed the , , and chains, with the strongest expression of , medium expression of ,
and minimum expression of (Fig 4).
Antibodies against the and chains significantly inhibited the
IL-15-induced proliferation with the strongest inhibition by anti-
chain antibody (Fig 5). In contrast, the
antibody against the chain had little effect on the proliferation,
suggesting that the binding of IL-15 occurred through IL-15R but not
through IL-2R. The proliferation of OMT was not significantly inhibited
by any of the antibodies.
View larger version (34K):
[in this window]
[in a new window]
| Fig 4.
Expression of IL-2R , , and chains on the
surface of ATL cell lines. All cell lines expressed the components of
IL-2R, with the strongest expression of , medium expression of ,
and minimum expression of . Closed histograms indicate the cells incubated with MoAbs against each component of IL-2R. Open histograms indicate the cells incubated with a control MoAb.
|
|
View larger version (29K):
[in this window]
[in a new window]
| Fig 5.
Inhibition of IL-15-induced proliferation of ATL cell
lines by anti-IL-2R , , or chain antibodies. The percent
inhibition was based on a comparison with cells cultured in IL-15
alone. The anti- and chain antibodies significantly inhibited
the proliferation induced by IL-15, with the maximum inhibition of anti-. The anti- chain antibody did not inhibit the
proliferation. The extent of the inhibition was the smallest in the OMT
cell line.
|
|
IL-15 binding assay.
A binding experiment of [125I]-IL-15 was performed using
the ST1 cell line. Analysis of the data by the method of Scatchard plot showed that [125I]-IL-15 bound to ST1 cells with an
apparent kd of 0.17 nmol/L, a single high-affinity binding
(Fig 6). Maximal binding capacity (Bmax) was 0.61 fmol/5 × 105 cells (732 sites/cell).
View larger version (16K):
[in this window]
[in a new window]
| Fig 6.
Binding of [125I]-IL-15 to ST1 cell line.
Bmax and kd were determined by the method of Scatchard plot
(inset) using 5 × 105 cells. ST1 showed a single high
affinity binding for IL-15.
|
|
Expression of the mRNA of IL-15R and IL-15.
Because the inhibition studies and [125I]-IL-15 binding
study suggested the presence of the IL-15R chain on ATL cell lines, a semiquantitative RT-PCR analysis for the mRNA of IL-15R was performed. The ATL cell lines and activated PBMC had larger amounts of
IL-15R mRNA than those of the fresh ATL cells or resting PBMC (Fig 7A). The myeloid leukemia cell line
HL-60 and one sample of fresh ATL cells did not have IL-15R mRNA.
Because the RT-PCR of IL-15R yielded several unexpected products, a
Southern blot analysis was performed for a confirmation of the origin
of the products, using an internal oligo probe. The RT-PCR products
hybridized with the probe (Fig 7B), suggesting that the bands with
sizes other than 778 bp are alternatively spliced isoforms of IL-15R . Using the same cells, the RT-PCR of IL-15 was also performed. The
four ATL cell lines, the fresh ATL cells, and the normal PBMC expressed
the mRNA of IL-15, but the HL-60 cell line did not
(Fig 8). The HuT-102 cells expressed much
more of the RT-PCR product of IL-15 than did the four ATL cell lines
(data not shown).
View larger version (57K):
[in this window]
[in a new window]
| Fig 7.
Expression of the mRNA of IL-15R on ATL cell lines.
RT-PCR for IL-15R mRNA (A) and Southern blot analysis of the
products (B), and RT-PCR for -actin mRNA as a control of PCR
products (C) were performed. The results indicated that all four ATL
cell lines (lane 2, SO4; lane 3, ST1; lane 4, KK1; lane 5, OMT) had the
mRNA of IL-15R (778 bp). Three samples of fresh ATL cells (lanes 7, 8, and 10) had smaller amounts of the mRNA equivalent to those of the
resting normal PBMC (lanes 11 through 14). One sample of fresh ATL
cells (lane 9) and the HL-60 cells (lane 6) did not have the IL-15R mRNA. The activated normal PBMC (lane 1) had an amount of the mRNA
larger than that of the resting PBMC.
|
|
View larger version (22K):
[in this window]
[in a new window]
| Fig 8.
Expression of the mRNA of IL-15 on the ATL cell lines.
Using the same RNA used for IL-15R , the RT-PCR for IL-15 mRNA was done. The results showed that the four ATL cell lines (lane 2, SO4;
lane 3, ST1; lane 4, KK1; lane 5, OMT), the fresh ATL cells (lanes 7 through 10), the activated PBMC (lane 1), and the resting PBMC (lanes
11 through 14) had almost identical amounts of IL-15 mRNA. The
activation of PBMC did not cause an increase of the mRNA. HL-60 (lane
6) did not have any IL-15 mRNA.
|
|
Response of fresh ATL cells to IL-15.
Using the ATL cells from peripheral blood, the response of fresh ATL
cells to IL-15 was examined. ATL cells of all patients examined except
one responded to IL-15 to the same degree as they did to IL-2
(Fig 9A through C). ATL cells of one
patient did not respond to any of the IL-15 or IL-2 (Fig 9D).
Concentration of IL-15 in the culture supernatants of ATL cell lines,
fresh ATL cells, and plasma from ATL patients.
Because the cell lines and fresh ATL cells expressed the mRNA of IL-15,
the concentrations of IL-15 in their culture supernatants were
examined, as was the plasma from ATL patients. None of the culture
supernatants from the ATL cell lines contained a detectable amount of
IL-15 (the detection limit was 1 pg/mL)
(Table 2). The samples from fresh ATL cells
without stimulation also did not contain IL-15, but one sample from the
fresh ATL cells stimulated with IL-2 contained 1.1 pg/mL of IL-15,
although it is not known whether the source of the IL-15 was ATL cells
or contaminated normal monocytes. Three of the 31 plasma samples from
the ATL patients examined contained 4.9, 1.7, and 1.7 pg/mL of IL-15. The culture supernatant from the HuT-102 cell line as a positive control contained 118 pg/mL of IL-15.
| |
DISCUSSION |
Although many cytokine receptors have components in common (eg, IL-3R,
granulocyte-macrophage colony-stimulating factor receptor [GM-CSFR],
and IL-5R have the same chain, and IL-2R, IL-4R, IL-7R, IL-9R, and
IL-13R have a common chain), these components may trigger different
functions in cells. This suggests that at least some of the
consequences of signals are not dependent on the pathway but are rather
related to the binding cytokine. IL-15R is unique in that it has two
subunits in common with IL-2R, the and chains, which are
essential for the signal transduction of IL-2.18,20
Consequently, IL-15 mimics the signal of IL-2, stimulates the
proliferation of activated T cells,1,2 induces cytotoxic T
lymphocytes (CTL) and lymphokine-activated killer (LAK)
activity,2,21 and activates natural killer
(NK) cells,22 which are all functions of IL-2. The
biological activities of IL-15 are not, however, totally redundant to
those of IL-2. Although the murine cell line 32D has the and chains of IL-2R and responds to IL-2, it does not respond to
IL-15.3 Similarly, although neutrophils express the and
chains of IL-2R and are activated by IL-15, they are not activated
by IL-2.23 IL-15 and IL-2 differentially affect the differentiation of bipotential T/NK progenitors. IL-15 is a
10 to 50 times more potent inducer of the differentiation of NK cells
compared with IL-2.24,25 Such differences in activities seem to be based on the difference of chains between IL-15R and
IL-2R.
In the present study, we showed that the signal for cell proliferation
transduced by IL-2 can be replaced with IL-15 in IL-2-dependent ATL
cell lines. The maximum proliferation was obtained with as little as 10 ng/mL of IL-15 in all cell lines. However, because the and chains of IL-2R also have some affinity for IL-15, there was a
possibility that the IL-15 used IL-2R instead of IL-15R to produce the
proliferation. The possibility was disproved by the inhibition study.
In cytofluorometric analysis, excess amount of IL-2 did not inhibit the
binding of IL-15. Although the anti-IL-2R and chain antibodies
inhibited the proliferation of the ATL cell lines induced by IL-15, the
anti-IL-2R chain antibody did not. In addition, Scatchard plot
analysis of [125I]-IL-15 binding showed that ST1 cell
line had a single high-affinity binding site, which indicates the
presence of IL-15R . The presence of the mRNA of IL-15R chain in
these cell lines also supports the notion that the complete form of
IL-15R does exist on the surface of ATL cells. The antibody against
IL-2R was the most effective for inhibition of IL-15-induced
proliferation. The result may indicate that the chain is the most
important for the signal transduction of IL-15, as has already been
pointed out in a study of B-cell proliferation.26 It has
also been reported that IL-15 upregulates the IL-2R chain but
downregulates the high-affinity binding site of IL-15 and rapidly
reduces the responsiveness to IL-1527; in addition, the
binding affinity of IL-15 with the IL-2R and chains is less
stable than that of IL-2.28 However, the responsiveness of
the four present ATL cell lines to IL-15 was not transient; these cell
lines were maintained by IL-15 for more than several months (data not
shown). The fresh ATL cells from three of the four patients examined
also had IL-15R mRNA, although the amounts were smaller than those
of the cell lines. The finding that cells from one patient did not have
the mRNA may indicate that the expression of IL-15R on fresh ATL
cells differs among ATL patients. This point should be examined more
accurately when an antibody against IL-15R becomes available.
Despite the similarity of the biological functions of IL-2 and IL-15,
they have no sequence homology. Moreover, the sources of the two
cytokines are quite different. IL-2 is secreted preferentially from T cells.5 The mRNA of IL-15 is detectable in cells and tissues such as placenta, kidney, skeletal muscle, lung, liver, fibroblasts, and monocytes.1 A recent study indicated that the mRNA of IL-15 was also present in T-cell lines.27 The
present four ATL cell lines also had IL-15 mRNA. However, the
production and secretion of IL-15 protein is tightly regulated at the
level of translation by the native leader sequence, and consequently IL-15 protein has rarely been detected in most cells and cell lines,
including T cells and T-cell lines.29 This regulation is
invalidated in HuT-102 cells by the insertion of the R region of the
LTR of HTLV-I at AUG codons, a putative suppresser region for
translation upstream from the major ORF of the IL-15
gene.12,13 In the present study, no IL-15 protein was
detected in the culture supernatants from the ATL cell lines. None of
the culture supernatants from fresh ATL cells contained a detectable
amount of IL-15 without stimulation. Only one sample from fresh ATL
cells stimulated with IL-2 contained a marginal amount of IL-15.
Although three plasma samples contained IL-15, the concentrations were
not enough to stimulate the proliferation of ATL cell lines. These
results seem to deny the possibility that the proliferation of ATL
cells in vivo is regulated by an autocrine mechanism of IL-15.
When we consider the pathological role of IL-15 in the clinical
manifestation of ATL, the report of the expression of IL-15 in human
skin that is upregulated by ultraviolet B radiation30 is
quite suggestive. ATL is well known to show frequent skin invasion. Because IL-15 functions as a chemoattractant for human T
cells,31,32 IL-15 produced by the skin may be responsible
for the skin involvement in ATL. Such a local production of IL-15 in
various tissues may explain the frequent multi-organ involvement in
ATL, such as in the lungs,33 liver,34
gastrointestinal tract,35 and central nervous
system.36 An unknown mechanism that tightly regulates the
translation of IL-15 mRNA may be released locally, and the secreted
IL-15 may stimulate ATL cells in tissue. Indeed, fresh ATL cells were
stimulated for proliferation by IL-15 as shown in the present study.
IL-15 also stimulates other lymphoid leukemia cells. It has been shown
that IL-15 promotes the proliferation and differentiation of
preactivated normal B cells.26 This effect is not limited
to normal B cells, but IL-15 stimulates the proliferation of freshly
isolated leukemic B cells from chronic lymphocytic leukemia and hairy
cell leukemia patients37; however, this stimulation is
thought to take place through the IL-2R system and not through the
IL-15R system. The proliferation of granular lymphocytes (GL) in
patients with lymphoproliferative disease of granular lymphocytes
(LDGL) are also stimulated by IL-15.38 Interestingly, GL
express the mRNA of IL-15R , as did the present ATL cell lines, but
do not express the mRNA of IL-15, in contrast to our ATL cell lines.
Because a variety of cells express the mRNA of IL-15, IL-15 protein
produced under specific unknown conditions may trigger and promote
leukemic cell growth in vivo.
In conclusion, we showed that the four IL-2-dependent ATL cell lines
used expressed a probably complete form of IL-15R with its own chain, had the mRNA of IL-15, and responded to exogenous IL-15. The
proliferation signal induced by IL-2 was replaceable with an IL-15
signal. Because peripheral blood ATL cells from patients also responded
to IL-15, IL-15-mediated growth signal may be used for the development
of ATL and the invasion and proliferation of ATL cells in tissue.
| |
FOOTNOTES |
Submitted August 25, 1997;
accepted January 23, 1998.
Address reprint requests to Yasuaki Yamada, MD, Department of
Laboratory Medicine, Nagasaki University School of Medicine, 1-7-1 Sakamoto-machi, Nagasaki 852, Japan.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
| |
ACKNOWLEDGMENT |
We thank Dr Masahiro Mori (Department of Microbiology and Molecular
Pathology, Faculty of Pharmaceutical Sciences, Teikyo University,
Kanagawa, Japan) for his helpful suggestions in the radio-iodination of IL-15.
| |
REFERENCES |
1.
Grabstein KH,
Eisenman J,
Shanebeck K,
Rauch C,
Srinivasan S,
Fung V,
Beers C,
Richardson J,
Schoenborn MA,
Ahdieh M,
Johnson J,
Alderson MR,
Watson JD,
Anderson DM,
Giri JG:
Cloning of a T cell growth factor that interacts with the chain of the interleukin-2 receptor.
Science
264:965,
1994[Abstract/Free Full Text]
2.
Burton JD,
Bamford RN,
Peters C,
Grant AJ,
Kurys G,
Goldman CK,
Brennan J,
Roessler E,
Waldmann TA:
A lymphokine, provisionally designated interleukin T and produced by a human adult T cell leukemia line, stimulates T-cell proliferation and the induction of lymphokine-activated killer cells.
Proc Natl Acad Sci USA
91:4935,
1994[Abstract/Free Full Text]
3.
Giri JG,
Ahdieh M,
Eisenman J,
Shanebeck K,
Grabstein K,
Kumaki S,
Namen A,
Park LS,
Cosman D,
Anderson D:
Utilization of the and chains of the IL-2 receptor by the novel cytokine IL-15.
EMBO J
13:2822,
1994[Medline]
[Order article via Infotrieve]
4.
Giri JG,
Kumaki S,
Ahdieh M,
Friend DJ,
Loomis A,
Shanebeck K,
DuBose R,
Cosman D,
Park LS,
Anderson DM:
Identification and cloning of a novel IL-15 binding protein that is structurally related to the chain of the IL-2 receptor.
EMBO J
14:3654,
1995[Medline]
[Order article via Infotrieve]
5.
Smith KA:
Interleukin-2: Inception, impact, and implications.
Science
240:1169,
1988[Abstract/Free Full Text]
6.
Anderson DM,
Kumaki S,
Ahdieh M,
Bertles J,
Tometsko M,
Loomis A,
Giri J,
Copeland NG,
Gilbert DJ,
Jenkins NA,
Valentine V,
Shapiro DN,
Morris SW,
Park LS,
Cosman D:
Functional characterization of the human interleukin-15 receptor chain and close linkage of IL-15RA and IL-2RA genes.
J Biol Chem
270:29862,
1995[Abstract/Free Full Text]
7.
Uchiyama T,
Yodoi J,
Sagawa K,
Takatsuki K,
Uchino H:
Adult T-cell leukemia: Clinical and hematologic features of 16 cases.
Blood
50:481,
1977[Free Full Text]
8.
Yamada Y:
Phenotypic and functional analysis of leukemic cells from 16 patients with adult T-cell leukemia/lymphoma.
Blood
61:192,
1983[Abstract/Free Full Text]
9.
Hinuma Y,
Nagata K,
Hanaoka M,
Nakai M,
Matsumoto T,
Kinoshita K,
Shirakawa S,
Miyoshi I:
Adult T-cell leukemia: Antigen in an ATL cell line and detection of antibodies to the antigen in human sera.
Proc Natl Acad Sci USA
78:6476,
1981[Abstract/Free Full Text]
10.
Poiesz BJ,
Ruscetti FW,
Gazdor AF,
Bunn PA,
Minna JD,
Gallo RC:
Detection and isolation of type C retrovirus particles from fresh and cultured lymphocytes of a patients with cutaneous T-cell lymphoma.
Proc Natl Acad Sci USA
77:7415,
1980[Abstract/Free Full Text]
11.
Yoshida M,
Miyoshi I,
Hinuma Y:
Isolation and characterization of retrovirus from cell lines of human adult T-cell leukemia and its implication in the disease.
Proc Natl Acad Sci USA
79:2031,
1982[Abstract/Free Full Text]
12.
Bamford RN,
Battiata AP,
Burton J,
Sharma H,
Waldmann TA:
Interleukin (IL) 15/IL-T production by the adult T-cell leukemia cell line HuT-102 is associated with a human T-cell lymphotrophic virus type I R region/IL-15 fusion message that lacks many up stream AUGs that normally attenuate IL-15 mRNA translation.
Proc Natl Acad Sci USA
93:2897,
1996[Abstract/Free Full Text]
13.
Bamford RN,
Battiata AP,
Waldmann TA:
IL-15 The role of translational regulation in their expression.
J Leukoc Biol
59:476,
1996[Abstract]
14.
Siekevitz M,
Feinberg MB,
Holbrook N,
Wong-Staal F,
Greene WC:
Activation of interleukin 2 and interleukin 2 receptor (Tac) promoter expression by the trans-activator (tat) gene product of human T-cell leukemia virus, type I.
Proc Natl Acad Sci USA
84:5389,
1987[Abstract/Free Full Text]
15.
Yamada Y,
Nagata Y,
Kamihira S,
Tagawa M,
Ichimaru M,
Tomonaga M,
Shiku H:
IL-2-dependent ATL cell lines with phenotypes differing from the original leukemia cells.
Leuk Res
15:619,
1991[Medline]
[Order article via Infotrieve]
16.
Yamada Y,
Fujita M,
Suzuki H,
Atogami S,
Sohda H,
Murata K,
Tsukasaki K,
Momita S,
Kohno T,
Maeda T,
Joh T,
Kamihira S,
Shiku H,
Tomonaga M:
Established IL-2-dependent double-negative (CD4 /CD8) TCR /CD3+ ATL cells: Induction of CD4 expression.
Br J Haematol
88:234,
1994[Medline]
[Order article via Infotrieve]
17.
Kohno T,
Yamada Y,
Hata T,
Mori H,
Yamamura M,
Tomonaga M,
Urata Y,
Goto S,
Kondo T:
Relation of oxidative stress and glutathione synthesis to CD95(Fas/APO-1)-mediated apoptosis of adult T cell leukemia cells.
J Immunol
156:4722,
1996[Abstract]
18.
Bamford RN,
Grant AJ,
Burton JD,
Peters C,
Kurys G,
Goldman CK,
Brennan J,
Roessler E,
Waldmann TA:
The interleukin (IL) 2 receptor chain is shared by IL-2 and a cytokine, provisionally designated IL-T, that stimulates T-cell proliferation and the induction of lymphokine-activated killer cells.
Proc Natl Acad Sci USA
91:4940,
1994[Abstract/Free Full Text]
19.
Kumaki N,
Anderson DM,
Cosman D,
Kumaki S:
Expression of interleukin-15 and its receptor by human fetal retinal pigment epithelial cells.
Curr Eye Res
15:876,
1996[Medline]
[Order article via Infotrieve]
20.
Tagaya Y,
Bamford RN,
DeFilippis AP,
Waldmann TA:
IL-15: A pleiotropic cytokine with diverse receptor/signaling pathways whose expression is controlled at multiple levels.
Immunity
4:329,
1996[Medline]
[Order article via Infotrieve]
21.
Munger W,
Dejoy SQ,
Jeyasseelan R,
Torley LW,
Grabstein KH,
Eisenmann J,
Paxton R,
Cox T,
Wick MM,
Kerwar SS:
Studies evaluating the antitumor activity and toxicity of interleukin-15, a new T cell growth factor: Comparison with interleukin-2.
Cell Immunol
165:289,
1995[Medline]
[Order article via Infotrieve]
22.
Carson WE,
Giri JG,
Lindemann MJ,
Linett ML,
Ahdieh M,
Paxton R,
Anderson D,
Eisenmann J,
Grabstein K,
Caligiuri MA:
Interleukin (IL) 15 is a novel cytokine that activates natural killer cells via components of the IL-2 receptor.
J Exp Med
180:1395,
1994[Abstract/Free Full Text]
23.
Girard D,
Paquet ME,
Paquin R,
Beaulieu A:
Differential effects of interleukin-15 (IL-15) and IL-2 on human neutrophils: modulation of phagocytosis, cytoskeleton rearrangement, gene expression, and apoptosis by IL-15.
Blood
88:3176,
1996[Abstract/Free Full Text]
24.
Leclercq G,
Debacker V,
De Smedt M,
Plum J:
Differential effects of interleukin-15 and interleukin-2 on differentiation of bipotential T/natural killer progenitor cells.
J Exp Med
184:325,
1996[Abstract/Free Full Text]
25.
Puzanov IJ,
Bennett M,
Kumar V:
IL-15 can substitute for the marrow microenvironment in the differentiation of natural killer cells.
J Immunol
157:4282,
1996 |
Abstract
Introduction
Abstract
). The results were expressed as relative values against control cultured without these cytokines. The results of a representative four
cases were shown. ATL cells of all patients (A, B, and C) but one (D)
responded to IL-15 to the same degree as to IL-2.