|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 12 (June 15), 1998:
pp. 4531-4542
Regulation of p21(WAF1) Expression During Normal Myeloid
Differentiation
By
Richard A. Steinman,
Jianping Huang,
Beatrice Yaroslavskiy,
Julie
P. Goff,
Edward D. Ball, and
Aline Nguyen
From the University of Pittsburgh Cancer Institute and Departments of
Medicine and Radiation Oncology, University of Pittsburgh School of
Medicine, Pittsburgh, PA.
 |
ABSTRACT |
The G1-phase cell-cycle inhibitor p21 has been proposed to mediate
growth arrest during differentiation. Upregulation of p21 has been
shown in multiple cell lines induced to differentiate; however, the
mechanism of p21 induction during normal differentiation is largely
unknown. In this report, we use normal hematopoietic precursor cells
obtained from umbilical cord to model p21 regulation during
differentiation. Myeloid maturation of CD34+ precursor
cells is associated with a marked increase in p21 expression at the RNA
and protein level. The upregulation of p21 transcripts during
differentiation is associated with decreased binding to a highly
conserved 44-bp fragment within the p21 promoter. This 44-bp regulatory
element binds a novel modulator of p21 expression. It is of
considerable interest that, although the binding activity is expressed
in p53-negative as well as in p53-positive cells, the DNA sequence
recognized by this protein overlaps a PuPuPuC(A/T)(T/A)GPyPyPy consensus sequence for p53.
 |
INTRODUCTION |
NUMEROUS STUDIES1-4 have
confirmed the association between differentiation commitment and arrest
in the G1 phase of the cell cycle, but mechanisms of the linkage are
incompletely understood. The cell cycle inhibitor p215-8
may play a role in the growth arrest of differentiated cells. p21
inhibits the ability of G1-phase cyclin-cdk complexes to phosphorylate sustrates such as the members of the Rb gene family.5
Through its antagonism of cdk action and potentially by interfering
with PCNA processivity,9 high levels of p21 arrest cells in
G1 phase. p21 may contribute to the growth arrest of differentiated
cells by supporting the ability of Rb, p107, and/or p130 to
bind and sequester E2F factors.3,10-15 Several studies have
demonstrated that p21 expression is upregulated during differentiation
of hematopoietic cells16-20 and may promote the transition
into the differentiated state.21 Subsequent studies have
confirmed the association of p21 expression and differentiation both
through in vitro differentiation models17,22 and through in
situ staining of p21 message in embryonic and adult
tissues.23,24 Cell cycle arrest mediated by p21 may also
inhibit apoptosis of differentiated cells.25-28
The mechanism of p21(WAF1) induction during differentiation is largely
unknown. p21 is induced during DNA damage through the action of p53 at
discrete sites within the p21 promoter.23,29 However, the
p53 pathway is unlikely to modulate p21 upregulation during
differentiation, because p21 and p53 are expressed in distinct patterns
on immunohistochemical staining of colon, keratinocytes, and mouse
embryo and because p21 induction occurs in p53-null models of differentiation.16,17,23,24,30-32 Regulation of
p21 during differentiation is likely to be complex and involve
transcriptional adaptor molecules such as p30031 as well as
tissue-specific factors. Analysis of p21 induction in
monocyte/macrophage cell line models may be particularly pertinent to
hematopoietic differentiation. Induction of U937 myelomonocytic cells
by phorbol ester or okadaic acid to differentiate into macrophages is
associated with p21 upregulation mediated by recruitment of the Sp1
transcription factor to binding sites adjacent to the transcription
startsite.20 Vitamin D3 also promotes U937 differentiation and upregulates p21, acting through a response element in the p21
promoter.33 As downstream effectors of cytokines,
Stat134 and Stat 535 induction of p21 could
also contribute to p21 modulation during hematopoiesis. However,
modulators of p21 expression that are active in normal hematopoietic
development and are stage-specific in their action have yet to be
reported. Indeed, the normal pattern of p21 expression during
myelomonocytic differentiation of normal cells has not previously been
characterized. In this report, we present data that characterize p21
expression in CD34+ hematopoietic precursor cells as they
are induced to differentiate along the myelomonocytic lineage.
Additionally, a highly conserved, transcriptionally active fragment in
the p21 promoter is demonstrated to bind proteins specific to distinct
stages of hematopoietic maturation. This activity is distinct from
previously reported modulators of p21 expression, including p53,
although a p53-response element is contained within the binding
sequence. The binding activity is inversely correlated with p21
expression, suggesting that a transcriptional repressor is involved.
Moreover, the binding activity appears to be inhibited by protein
extracts of more mature cells. A subset of leukemic cells exhibit
aberrant binding to this element. We hypothesize that the protein(s)
binding to this site contributes to the proper modulation of p21
expression during normal myeloid development.
 |
MATERIALS AND METHODS |
Cells and cell separation.
For CD34+ cells, human umbilical cord blood (CB) samples
were obtained immediately after delivery in accordance with
institutional guidelines, and placed in 50-mL tubes containing ACD-A
(Cytosol Labs, Braintree, MA). The CB was diluted with Ca- and Mg-free phosphate-buffered saline (PBS), and low-density mononuclear cells are
isolated by Ficoll-Paque (1.077 g/mL) density gradient centrifugation for 30 minutes at 400g (Pharmacia Biochem, Piscataway, NJ). CB mononuclear cells were washed twice in PBS and resuspended in PBS + 0.6% ACD-A for magnetic labeling and separation. CD34+
progenitor cells were isolated by immunomagnetic selection techniques, as previously described.36 Briefly, cells were incubated
with blocking reagent (human IgG) and QBEND/10 anti-CD34 antibody for 15 minutes at 4°C and then washed in PBS/ACD-A followed by
incubation with a secondary antibody-magnetic microbead conjugate for
an additional 15 minutes at 4°C. The percentage of
CD34+ cells was determined by flow cytometric analysis and
generally exceeded 95%.
CD34+ cells were cultured in Iscove's modified Dulbecco's
medium (IMDM) supplemented with 15% heat-inactivated
fetal bovine serum (FBS; Life Technologies, Grand Island, NY)
containing 100 ng/mL kit ligand (R&D Systems, Minneapolis, MN), 100 ng/mL interleukin-3 (IL-3; R & D Systems), and 30 ng/mL granulocyte
colony-stimulating factor (G-CSF; Neupogen; Amgen, Inc, Thousand Oaks,
CA). Parallel experiments in which the cells were grown in serum-free
CD34+ supportive media (StemPro TM; Life Technologies) gave
essentially the same results. Neutrophils were harvested after spinning
plasma and removing residual erythrocytes with hypotonic washes,
followed by Ficoll-Paque (1.077 g/mL) density gradient centrifugation
for 30 minutes at 400g and collection of the pellet in PBS.
Purity (generally >95%) was verified by Wright-Giemsa staining.
HL-60 cells were cultured in RPMI media (Mediatech, Washington DC)
supplemented with 10% heat-inactivated FBS (Life Technologies
Laboratories) and 100 U/mL of penicillin and streptomycin. Cells were
split at 1:10 every 4 to 5 days to maintain a concentration of less than 8 × 106/mL. All cells were maintained in
log-phase at 37°C in a humidified atmosphere with 5%
CO2, and fresh vials from a common freeze were thawed every
4 to 6 weeks to prevent senescence.
Reagents and probes.
Reagents included 12-O-tetradecanoylphorbol 13-acetate
(TPA; stored at 800 µmol/L in PBS and diluted for
use), butyrate, trans-retinoic acid (stored as a 1 mmol/L stock in
alcohol), and dimethylsulfoxide (all from Sigma Chemicals, St Louis,
MO) and other reagents from commercial vendors. Full-length p21 probe
was obtained by digestion and gel purification from a p21 (WAF1/CIP1)
plasmid (kindly provided by Dr Wafik El-Diery, University of
Pennsylvania, Philadelphia, PA). All probes were
radiolabeled to 5 to 10 × 108 cpm/µg by random
priming according to manufacturer's instructions (Life Technologies,
Gaithersberg, MD).
Northern blot analysis.
Total RNA was extracted from cell lines by solubilization in 4 mol/L
guanidium isothiocyanate followed by centrifugation through a cesium
chloride cushion. Fifteen to 30 µg of total RNA was separated on
agarose-formaldelhyde gels blotted onto Zetabind (AMF-Cuno, Meridan,
CT), covalently bound by brief UV irradiation, and hybridized by
established procedures to radiolabeled probes for 12 to 24 hours. Blots
were exposed to Kodak XAR-5 film (Eastman Kodak, Rochester,
NY) with intensifying screens at 80°C.
Exposure times varied from 8 days for p53 probes, 1 to 3 days for p21
probes, and 1 to 12 hours for 18S probes.
In situ hybridization.
Digoxigenin-labeled DNA probes were prepared by random priming using
the Genius System and hybridized to cytocentrifuged preparations as
described (Boehringer Mannheim, Indianapolis, IN). Briefly, cells were
centrifuged onto gelatin-subbed slides, fixed in 4% paraformaldehyde, ethanol-dehydrated, air-dried, and stored at 20°C. Cytospin preparations were prehybridized in 10 mmol/L
Tris-HCl, 50% formamide, 0.6 mol/L NaCl, 1 mmol/L EDTA, 1×
Denhardt's, 0.5 mg/mL carrier RNA, and 10% dextran sulfate for 1 hour
at 37°C. The digoxigenin-labeled p21 probe, diluted in
prehybridization buffer, was applied to the cells and allowed to
hybridize overnight at 37°C. After posthybridization washes,
detection of digoxigenin-labeled probe was accomplished by incubating
the cells with alkaline phosphatase-conjugated anti-digoxigenin
antibody (1:500) for 2 hours at room temperature Alkaline phosphatase
activity was then visualized by incubating the cells in the absence of
light with NBT and BICP (Boehringer Mannheim). The color development
was monitored and the enzymatic reaction was stopped by immersing the
slides in 10 mmol/L Tris, 1 mmol/L EDTA.
Immunostaining.
Cytospins of cells were prepared, dried, and stained indirectly for p21
expression. In brief, cells were fixed with methanol/acetone and
incubated in primary antibody (either mouse monoclonal anti-p21 antibody CP36 or isotype control mouse IgG) in 0.2% NP-40 at a 1:50
dilution for 2 hours, followed by four PBS washes and incubation for 30 minutes with biotinylated goat antimouse IgG antibody (Vector Laboratories, Burlingame, CA) again followed by three
washes. Immunodetection was enabled by a final 30 minutes of incubation with Cy3-conjugated streptavidin (Jackson Immunochemicals, West Grove,
PA) and three PBS washes. Cells were counterstained with Hoechst.
Extract preparation and gel-shift assay.
Cells were washed in PBS and whole cell extracts were prepared by
resuspending cell pellets in high salt lysis buffer (20 mmol/L HEPES,
pH 7.9, 420 mmol/L NaCl, 20 mmol/L NaF, 1 mmol/L Na3Vo4, 1 mmol/L
Na4P2O7, 1 mmol/L EDTA, 1 mmol/L
EGTA, 1 mmol/L dithiothreitol [DTT], 1 µg/mL
leupeptin, 1 µg/mL aprotinin, 0.5 mmol/L phenylmethyl sulfonyl
fluoride [PMSF], and 50% glycerol) followed by
three rapid freeze-thaw cycles. For gel-shift assays, equivalent
amounts of extract protein were preincubated for 20 minutes in binding
buffer (15 mmol/L HEPES, pH 7.9, 65 mmol/L NaCl, 1 mmol/L DTT, 0.15 mmol/L EDTA, 8% glycerol) with poly dI:dC (0.3 µg)
followed by 20 minutes of incubation with 0.2 ng end-labeled target
sequence, followed by fractionation on a 4% nondenaturing polyacrylamide gel.
Plasmids.
Plasmid psvluc is used to designate pGL2 promoter (Promega, Inc,
Seattle WA) that contains an sv40 promoter upstream of the luciferase
gene; plasmid p21luc contains 2.4 kb of the p21 promoter cloned into
the HindIII site of pGL2basic (Promega, Inc) and was a gift
from Dr Xiao-Fan Wang (Duke University Medical
Center). Plasmid pd21luc consists of a truncated p21
promoter in which 2.2 kb of p21 promoter upstream sequence was deleted
from p21 luc. It was contructed by digesting p21luc with Sac I
and Pst I, filling in overhanging ends, and autoligating.
Plasmid pd21.443 luc contains a triplication of the 44-bp
fragment upstream of that truncated promoter. The 44-bp fragment was
synthesized with GATC-overhangs, autoligated, and cloned into the
BamHI site of pBluescript, generating pBlue-443. A
Sac I-Pst I fragment from pBlue-443 was
cloned into pd21 to generate pd21.443luc. Plasmid psv.443luc similarly contains a triplication of 44-bp
fragments cloned into a Sac I-Xho I site upstream of
the sv40 promoter.
Transient transfection.
Log-phase HL-60 were washed twice in Opti-mem medium (Life
Technologies) and 107 cells were suspended in 200 µL
Opti-mem per transfection. A total of 15 µg of uncut plasmid
(reporter plus transfection control) in 50 µL Opti-mem medium was
added to the cells and the mixture was preincubated in a chilled
electroporation cuvette for 10 minutes. Electroporation was performed
in a Bio-Rad electroporation apparatus (Bio-Rad, Hercules,
CA) at 270 V, 960 µF, generating a time constant around 70. The mixture was maintained on ice for 10 minutes followed by
dilution in RPMI medium containing 10% FBS. Cells were harvested 6 hours later and lysed by freeze-thaw cycles, and luciferase activity
and -galactosidase activity were determined by standard techniques
on aliquots of 20% of the extract.
 |
RESULTS |
Stage-specific expression of p21 in differentiating myeloid cells.
We have previously demonstrated that p21 expression is directly
upregulated in HL-60 cells by multiple chemical inducers of differentiation. This upregulation occurs at the mRNA and protein levels and does not require new protein synthesis because it is not
blocked by cycloheximide.16 Other p53-negative
hematopoietic and hepatoma cell lines displayed similar upregulation of
p21 within hours of the addition of differentiation
inducers.16 To assess whether similar induction of p21
occurred during progressive differentiation of normal hematopoietic
cells, p21 message was determined in differentiating CD34+
cells. CD34+ cells were harvested from umbilical cord
blood, expanded for 3 days with kit-ligand and IL-3, and then driven to
differentiate along the myeloid lineage by addition of G-CSF. Such an
approach has been shown37 to lead to roughly synchronous
differentiation. Figure 1 demonstrates
progressive upregulation of p21 as the cells differentiate. Nonadherent
cells were collected at 3-day intervals after the addition of G-CSF and
analyzed for morphology and for p21 message on Northern blot.
Representative results of triplicate experiments are shown. Concurrent
upregulation of G-CSF receptor confirms granulocytic
differentiation.38 The sharpest increase in p21 levels
occurs coincident with the appearance of metamyelocytic and
granulocytic cells on cytospin. These data establish a progressive increase in p21 message as cells mature.

View larger version (19K):
[in this window]
[in a new window]
| Fig 1.
p21 upregulation during myeloid differentiation of
CD34+ cells. CD34+ cells were expanded in
100 ng/mL IL-3 and 100 ng/mL KL in 10% IMDM for 3 days and then G-CSF
was added at 10 ng/mL. Similar results are seen if G-CSF is added at
day 0. At day 0 and at 3-day intervals after the addition of G-CSF,
nonadherent cells were harvested for morphologic analysis and RNA
preparation. (Right) (bottom) Morphologic analysis of 86-107 cells on
cytospins shown as percentages; myelocytes (not shown) peaked at 6%.
(Top) Normalized p21 message as determined on a phosphoimager is
plotted. (Left) RNA was blotted and sequentially probed with
radiolabeled p21, G-CSF receptor, and actin cDNAs.
|
|
The absence of p21 message in CD34+ blast cells and
presence of p21 message in neutrophils was also demonstrated by in situ hybridization (Fig 2A through F). To
characterize the variation in p21 expression within this mixed
population of differentiating cells, cytospins of undifferentiated or
differentiating cells were stained for p21 expression. It is evident
that little p21 protein is expressed by the CD34+ cells
before culture in cytokines (Fig 2G and H) and that p21 is expressed in
most cells after 11 days of differentiation, with high levels of
expression in a subset of cells (Fig 2I and J).

View larger version (76K):
[in this window]
[in a new window]
| Fig 2.
p21 message and protein in CD34+ blast
cells and in differentiated cells. (Top) In situ analysis of p21
message in CD34+ blast cells (above) and in neutrophils
(below). (A) and (D), Wright Giemsa; (B) and (E), digoxigenin-labeled
control; (C) through (F), digoxigenin-labeled p21 probe. (Bottom)
Immunohistochemical demonstration of p21 protein in differentiating
cells. Day 0 CD34+ blasts stained with isotype control
(G) or anti-p21 antibodies. Some nonspecific staining of
antibody-coated magnetic beads is present. Differentiated progeny
arising after 11 days of culture stained with isotype control (I) or
anti-p21 antibody (J) stain strongly for p21.
|
|
Loss of a p21 promoter-binding activity during differentiation.
We reasoned that stage-specific regulation of p21 expression was likely
to be a central feature of the physiologic role of p21 and therefore
might be shared across species. Should that be the case, homologous
sequences within the p21 promoter that bind similar regulatory factors
might be conserved. Comparison of the sequences of the human, mouse,
and rat p21 promoter39 disclosed a striking 44-bp region of
homology (bp 1367 to 1324 of the human promoter). This
region also contains two sequence elements present in the p27
promoter:
There are no other high-level matches to the 44-bp
sequence on BLAST analysis of the Genbank database. There are several
sequence features in this fragment that could be of significance. The
fragment contains a motif, TTN5AA, which conceivably could be
recognized by Stat proteins. There is also a hexameric consensus motif
(AGGTCA) for orphan nuclear receptors40 and a recognition
site for the pu.1 transcription factor. The fragment contains a direct
repeat of a sequence (CTGGGCAT/G) that is present six times in the p21 promoter. It is noteworthy that a putative p53 binding sequence (italicized) is contained within this fragment.23,39,41 To determine whether proteins other than p53 bound to this region, we
assayed HL-60 extracts for binding activity to this 44-bp fragment. It
should be noted that HL-60 cells are p53-negative due to homozygous deletions42 and do not express p53. Any activity in protein extracts of HL-60 binding to this fragment would therefore be distinct
from p53. As shown in Fig 3, HL-60 cells
express a protein that binds specifically to this p21 promoter
fragment. This activity will hereafter be referred to as 21PBA (p21
promoter-binding activity). Binding is eliminated by specific but not
by nonspecific competitor DNA. Both target strands are required for
binding, which is eliminated by protease treatment (data not shown).

View larger version (50K):
[in this window]
[in a new window]
| Fig 3.
HL-60 cells express a DNA-binding activity that
specifically binds a 44-bp fragment in the p21 promoter. Whole cell
extracts of log-phase HL-60 cells were incubated in the presence of a
radiolabeled 44-bp fragment from the p21 promoter and subjected to
electrophoretic mobility shift analysis. Binding was performed in the
presence of 30× or 100× excess of specific (44) or non-specific
(YY1) unlabeled competitor DNA as indicated.
|
|
Binding during differentiation of HL-60 and
CD34+ cells.
To see whether proteins binding to this sequence were expressed in a
stage-specific manner during differentiation, we assayed extracts of
exponentially growing HL-60 cells and of HL-60 cells differentiated
with various agents for 21PBA. Exponentially growing HL-60 cells were
incubated with chemical inducers of differentiation, and RNA was
extracted 20 hours later. Northern blot analysis
(Fig 4A) confirmed upregulation of p21
message by all inducers used. The ability of proteins present in
undifferentiated and differentiated cell extracts to bind to the 44-bp
fragment was determined using a gel shift assay. Figure 4B demonstrates
that proliferating HL-60 cells contain a DNA-binding activity, and that
binding activity is decreased in extracts of differentiating HL-60
cells.

View larger version (44K):
[in this window]
[in a new window]
| Fig 4.
Protein-binding of a p21 promoter fragment is inversely
associated with p21 message expression. Log-phase HL-60 cells were exposed to medium alone or medium containing DMSO (1.25%), ATRA (1 µmol/L), PMA (80 nmol/L), or butyrate (1 mmol/L) and harvested 20 hours later for RNA and protein extraction. Northern blot (A) confirms
p21 induction. Gel-shift assay (B) of 20 µg whole cell extract
incubated with 44-bp promoter fragment discloses a band upon addition
of uninduced extract, which is decreased in lanes using differentiating
cell extract.
|
|
To determine whether 21PBA existed in normal hematopoietic precursor
cells induced to undergo myeloid differentiation, extracts were
prepared from umbilical cord CD34+ cells upon harvest and
at different times after culture in differentiating medium consisting
of kit ligand, IL-3, and G-CSF. As shown in Fig 5,
CD34+ cells also contained a DNA-binding protein that
recognized the same fragment and yielded the same gel shift as in HL-60
cells. As in HL-60 cells, the 21PBA was extinguished as
CD34+ cells differentiated and p21 levels increased;
binding was undetectable 6 days after the cells had been induced to
differentiate. In contrast, DNA binding proteins targeting other
elements were active in the differentiating CD34+ cell
extracts, as demonstrated by their ability to bind a serum inducible
element target (SIE; GATCCATTTCCCGTAAATCGATC43) on gel
shift assay (see Fig 7C).

View larger version (70K):
[in this window]
[in a new window]
| Fig 5.
Stage-specific presence of p21-promoter binding activity
in differentiating CD34+ cells. Umbilical cord
CD34+ cells prepared with magnetic beads were expanded in
differentiating medium (KL, IL-3, and G-CSF) and extracts prepared for
gel-shift in parallel with p21 mRNA determination as shown in Fig 1.
The faint and slightly faster band at day 3 is reproduceable. Lane 2 indicates competition by cold fragment of the band induced by HL-60
extract.
|
|

View larger version (36K):
[in this window]
[in a new window]
| Fig 7.
Elimination DNA-binding activity of extracts by
coincubation with differentiated cell extracts. (A) Twelve micrograms
of HL-60 extract was incubated in the absence ( ) or presence of 12 µg of extract from CD34+ blast cells (0) or
CD34+ cells incubated for 3 to 15 days in the presence of
kit ligand (100 ng/mL), IL-3 (100 ng/mL), and G-CSF (20 ng/mL) as
indicated. After 20 minutes of coincubation, radiolabeled target DNA
was added and gel-shift was performed as described. (B) (Left half) Thirty micrograms of extract from HL-60 cells (H) and cord neutrophils (N) were incubated separately or together (H+N) before the addition of labeled 44-bp fragment or labeled SIE probes. The typical gel-shift band seen upon incubation with each fragment is indicated with an arrow
(forward arrow, 44-bp band shift; backward arrow, SIF bands). The
lower, nonspecific band seen in the H+N lane was not extinguished by
unlabeled competitor 44-bp fragment (not shown). (Right half) Twenty-six micrograms of HL-60 extract (H) or 9 µg of
extract from sorted CD11b CD15+ cells
(CD15) or from CD11B+CD15+ cells (11b/15)
were incubated separately with labeled 44-bp fragment as shown. In
addition, these amounts of extracts were combined in mixing experiments
(H+CD15), (H+11b/15) as indicated. Specific bands are indicated as
before. (C) Incubation of differentiating cell extracts with SIE.
Extracts from CD34+ cells incubated for 3 to 15 days in
the presence of kit ligand, IL-3, and G-CSF were incubated with
radiolabeled SIE target. Characteristic bands (SIF43) are
evident.
|
|
Aberrant binding in leukemia cells.
Aberrant expression of p21 protein has been reported in leukemia, and
dysregulated expression of p21 has been posited to be a negative
prognostic sign.44 Because of this observation and because
normal differentiation is dysregulated in leukemia, we analyzed the
expression of 21PBA in leukemic blasts freshly harvested from untreated
patients. Figure 6 demonstrates that leukemic extracts vary in their ability to bind to the p21 promoter fragment. Five AML
leukemic samples varied both in the presence of binding activity and in
the patterns of bands arising on gel-shift assay. There was no clear
correlation between binding activity and CD34+ percentage
or French-American-British (FAB) class. Expression of
p21 message was also determined. It is apparent that the expression of
p21 in leukemic cells is complex. Patient samples no. 3 and 5, classified as M4 leukemias, express similar low levels of
CD34+ and Thy-1, but sample no. 3 lacks 21PBA activity and
expresses high levels of p21 transcripts, whereas sample no. 5 expresses high levels of 21PBA and low expression of p21 message.
However, it is clear that additional factors regulate p21 in leukemic
cells. This is evident in sample no. 2, in which both 21PBA and p21
message are undetectable.

View larger version (58K):
[in this window]
[in a new window]
| Fig 6.
Altered p21-promoter binding in a subset of leukemia cell
extracts. (A) Protein extracts were prepared from five random frozen samples of leukemic blasts from peripheral blood of patients presenting acutely with AML, and binding to the p21-promoter was determined on gel
shift. Differences in the presence and in the mobility of binding
complexes are evident. The slowly migrating band in extract from
patient no. 5 is specific and competed by cold fragment. A short
exposure is shown. HL-60 and CD34 extracts are loaded for comparison.
Equal amounts of protein are used in each binding reaction. FAB and FACS analysis results of the samples are also shown.
(B) Northern blot demonstrates variable expression of p21 message in
the leukemic samples.
|
|
Suppression of promoter-binding activity by extracts from neutrophils
or from differentiating CD34+ cells.
The loss of 21PBA in differentiated cells could arise from lack of
production or from lack of activation of necessary binding factors in
those cells or from sequestration of binding factors into other
complexes, making them unavailable to form a binding complex on the p21
promoter. To clarify this, extract mixing experiments were performed in
which extracts from neutrophils or differentiated CD34+
cells were mixed with uninduced HL60 cell extracts before assaying the
HL60 extracts for gel-shift activity. Figure 7A
demonstrates that CD34+ extracts from cells exposed to
G-CSF for 6 or more days suppressed the binding activity present in
extracts of exponentially growing HL-60 cells. To demonstrate that the
absence of the competed band in Fig 7A does not result from nonspecific
inhibitors in the competing extracts from the differentiating cells,
those extracts were incubated separately with a serum-inducible element
target sequence (SIE). Figure 7C demonstrates the ability of the
competing extracts to generate SIF bands43 upon incubation
with an SIE target, indicating their patency. Extracts from neutrophils
suppressed the ability of HL-60 extracts to bind the 44-bp p21 promoter
fragment (Fig 7B, left panel). Neutrophil extract also suppressed 44-bp
binding by extract from CD34+ blast cells (data not shown).
Suppressive activity was heat-labile and exhibited by both whole cell
and nuclear extracts of neutrophils (data not shown). Experiments
represented in the right panel of Fig 7B tested whether extracts from
distinct subpopulations of differentiating CD34+ cells
differed in their ability to suppress the 44-bp fragment binding by
uninduced HL-60 extracts. CD34+ blasts were induced to
differentiate for 9 days, and two subpopulations of cells were
separately collected by fluorescence-activated cell sorting
(FACS). One set of cells expressed CD15 antigen but
not the CD11b antigen; the other, more mature population expressed both
CD11b and CD15 antigens. Gel-shift analysis demonstrated that neither
of these cell types exhibited binding activity for the 44-bp fragment,
and extracts from either population could inhibit the binding activity
present in HL-60 extracts.
The 44-bp p21 promoter fragment is transcriptionally active.
The existence of proteins in CD34+ blast cells and HL-60
cells that specifically recognized and bound to the 44-bp fragment within the p21 promoter raised the prospect that this fragment was
transcriptionally active. Moreover, the inverse association of
DNA-binding and p21 mRNA expression suggested that a transcriptional repressor bound to the p21 promoter at this site.
Figure 8 shows the results of transfection
experiments using several constructs to evaluate the transcriptional
activity of the 44-bp element. This activity was assessed upstream of
heterologous promoters. This avoids the confounding effects inherent in
testing within the full-length p21 promoter. Stress-responsive elements
within the full-length p21 promoter activate transcription in response to transfection, masking the effects of upstream mutations (Timchenko et al45 and R.S., unpublished
observations). These transfections were performed
using the p53-negative HL-60 cell line to avoid confounding effects of
p53 on the transcriptional activity of the 44-bp fragment.

View larger version (23K):
[in this window]
[in a new window]
| Fig 8.
p53-independent transcription mediated by the 44-bp
element. (A) The 44-bp element enhances or suppresses transcription
depending on the promoter. Log phase HL-60 cells were transfected with
luciferase reporter plasmid driven by the sv40 promoter (psvluc) or a
promoter consisting of 209 bp of the p21 promoter proximal to the
transcription startsite (pdluc). Luciferase activity is compared with
that of reporter constructs with 3 copies of the 44-bp sequence
upstream of the promoter, as indicated. All values are normalized to
-galactosidase expression from cotransfected CMV- gal reporter to
correct for transfection efficiency. The average and standard error of
three experiments is shown. (B) Schematic of reporter plasmids used in
transfections.
|
|
Figure 8A demonstrates the effect of the 44-bp repeat on heterologous
promoters sv and pd21dluc. These plasmids or the corresponding plasmids
bearing 44-bp repeats upstream of the promoters were transfected into
HL-60 cells along with CMV- gal as a transfection efficiency control.
Transcription from the sv-promoter is enhanced fivefold by upstream
placement of a triplication of the 44-bp sequence. In contrast,
insertion of 44-bp repeats upstream of the truncated p21-promoter
decreases transcription roughly twofold, indicating that the
transcriptional effects of this element are promoter-specific, as has
been shown for other enhancer/repressor elements.46-48
Novelty of 21PBA binding.
Mapping of nucleotides involved in 21PBA binding was undertaken to
clarify whether this activity might represent a known transcription factor. The upstream half of the 44-bp element contains consensus binding sequences for orphan nuclear receptors RZR/ROR or
Coup-TF,40,49,50 the E1AF51 Ets-family
transcription factor, and a potential Stat binding site. These factors
have been shown to affect p21 expression, although binding within this
sequence has not been established for any of them. The downstream 22-bp
portion of the 44-bp element lacks major transcription factor binding
sequences, with the exception of a p53 consensus binding sequence
(GGGCATGTCT; Fig 9). To determine whether
21PBA represents one of these known factors or might conceivably
represent a novel factor, we first determined whether 21PBA bound to
the upstream or downstream half of the fragment. As is shown in Fig 9,
both a 29-bp and 23-bp truncation of the 44-bp element gave rise to the
same band on gel-shift assays as the full-length fragment, suggesting
that sequences within the downstream half of that fragment comprised a
recognition site for 21PBA. However, neither a 400-fold excess of 29 bp
( 1351 to 1323) or 23 bp ( 1345 to 1323)
effectively competed the full-length fragment, indicating that these
shorter fragments did not result in the highest affinity binding. This suggests that binding of 21PBA is stabilized by sequences present in
the 5 -half of the full-length 44-bp fragment. To more precisely to map nucleotides required for 21PBA binding, scanning mutations were
made in the 28-bp fragment (Fig 10A) in
which successive 4-bp sequences were replaced by thymidines. The third
(M3) and fourth (M4) substitutions negated ability of mutant sequence
to compete binding with wild-type; the fifth (M5) substitution retained
partial competitive ability (Fig 10B). Consistent with these findings, binding of HL-60 extracts to the M4 and M5 mutants was markedly decreased (Fig 10C); the M3 target resulted in altered mobility, which
most likely reflects impaired DNA-protein complex formation. The
scanning mutation results are also supported by our observation that
bisecting the 44-bp fragment at bp 1336 (ACT GG ) eliminated binding (data not shown).

View larger version (32K):
[in this window]
[in a new window]
| Fig 9.
Boundaries of the 21PBA target sequence. 21PBA binds the
3 -half of the 44-bp promoter fragment. HL-60 cell extract was
incubated with either the 44-bp fragment or 23- or 29-bp fragments
bearing identical sequence to the 3 portion of the longer
fragment. All targets generate the same gel-shift band, which can be
specifically competed, as shown. The 44-bp fragment is significantly
more effective than the shorter fragments as a cold competitor against
labeled 44- or 28-bp fragments. The bottom portion of the figure
depicts the positions of recognition sites for several transcription
factors relative to fragment boundaries.
|
|

View larger version (45K):
[in this window]
[in a new window]
| Fig 10.
Scanning mutation analysis of 21PBA recognition
sequence. (A) Juxtaposition of mutated sequences M1-M5 against the
wild-type sequence. Successive 4-bp sequence elements are substituted
with thymidine. Base changes affecting 21PBA binding are summarized at
the bottom in bolded letters; sequences comprising a p53 consensus site
are underlined. (B) Binding by mutant sequences is shown. Equal amounts
of radiolabeled mutant (M1-M5) or wild-type (29) probe were incubated
with HL-60 extract in gel-shift assay. Loss of binding to M4 and M5 and
novel migration using the M3 target is evident. (C) The ability of
mutant sequences to compete binding to the 29-bp target is shown. A
44-bp target labeled at low activity is shown in lane 1. HL-60 extract
is incubated with radiolabeled 29-bp target after preincubation for 30 minutes with 30-fold excess of unlabeled 44-bp competitor and either
30- or 100-fold excess of unlabeled 29-bp or mutant competitor as
shown.
|
|
The 21PBA recognition sequence overlaps a p53 binding sequence.
As Fig 10 demonstrates, 21PBA recognition site consists of a downstream
16-bp sequence
ACTGGGCATGTCTGGG (bp 1340 to 1325). Bases changed in the mutation sets 3, 4, and 5 are in bold; these mutations disrupt the p53 consensus and also inhibit 21PBA binding. Analysis of this sequence using the MatInspector52 and Transfac53 analysis programs
identify no known transcriptional factor binding sites within this
sequence; MacVector analysis highlights the p53 binding sequence
PuPuPuC(A/T)(T/A)GPyPyPy (underlined within the 16-bp shown above;
optimal p53 binding requires a repeat of this
sequence54-56). The p53 site overlap includes the bases
(CATG) essential for 21PBA binding that are altered in mutation 4. Despite the overlap in recognition sequence, 21PBA is clearly not p53,
because it is present in p53-negative HL-60 cells as well as in other
cells lacking wt p53, including K562, HT-29, and C33A (data not shown).
Although this p53 binding sequence has been reported to be bound
weakly57 by p53 using in vivo footprinting and in a
sensitive immunoprecipitation assay,23 it has not been
shown to bind p53 in gel-shift assays. Indeed, we have not detected
binding of a recombinant p53 core binding protein58 to the
29-bp sequence under conditions in which it binds to the upstream
p53-binding site of the p21 promoter (Fig 11). Similar results were seen with cell extracts containing activated p53 (data not shown). The wild-type 29-bp sequence is able to compete
binding of p53 to a p53 site containing two PuPuPuC(A/T)(T/A)GPyPyPy repeats (the p53 site 2.4 kb upstream of the p21 transcriptional startsite, labeled 2.4 in Fig 11). In contrast, the M4 mutant sequence is unable to compete p53 binding, underscoring the importance of the
mutated bases for p53 binding as well as for 21PBA binding.

View larger version (73K):
[in this window]
[in a new window]
| Fig 11.
p53 binding ability of 29-bp sequence. (A) Ability of
29-bp sequence to compete p53 binding in extracts. Extracts of
irradiated T10 cells are tested on gel-shift assay. The upstream p53
site in the p21 promoter (2.4) is targeted. The first two lanes
demonstrate the appearance of the expected p53 gel-shift band in the
presence of anti-p53 antibody pAb421. The p53 band is partially
competed by 100-fold excess of 29-bp sequence but not mutated sequence (M4). (B) Lack of direct binding of p53 to the 29-bp sequence. A
gel-shift assay is shown demonstrating binding of recombinant p53 core
protein to the upstream p53 site (2.4) but not to the 29-bp sequence.
|
|
 |
DISCUSSION |
This report demonstrates progressive upregulation of p21 message and
protein during maturation of hematopoietic progenitor cells.
Previous studies by ourselves and others had established an association
between differentiation and p21 expression in cell line models. This
report, as well as immunohistochemical evidence that p21 expression is
high in differentiated tissues,23,24 bolsters the case that
p21 contributes to normal differentiation. We present evidence that the
transcriptional activation of p21 during myelopoiesis is highly
regulated and is associated with protein-binding to a highly conserved
sequence in the p21 promoter.
Expression of p21 message increases in CD34+ cells
undergoing myelomonocytic differentiation. Because more mature progeny
arose sequentially under our culture conditions,37 the
sharpest increase in p21 message could be seen to coincide with the
emergence of metamyelocytes and neutrophils, cells that do not
proliferate.59 This supports a role for p21 in mediating
growth arrest in differentiated cells.16,17,60 However, p21
is clearly present at earlier time points characterized by
proliferating cells. This is consistent with the notion that p21 may
serve other functions, such as preventing apoptosis,25-28
or may play a primary role in differentiation independent of its
effects on the cell cycle.61 It has been reported that p21
action is stoichiometric and that the antiproliferative action of p21
requires binding of two p21 molecules to the cyclin-cdk complex.62,63 There may therefore be a threshold level at
which p21 expression promotes G1 arrest. We have found that
differentiating CD34+ cells include subpopulations that are
negative, dim, or bright for p21 (Fig 2 and Yaroslavskiy et al,
manuscript submitted); full characterization of each
population is underway. A distinct range of p21 levels may choreograph
the transition from growing precursor cells to a postmitotic,
differentiated population.
What regulates the stage-specific alterations in p21 expression in
differentiating CD34+ cells? Transcriptional activation of
p21 by MyoD22 and p30031 contribute to its
upregulation during differentiation of C2 mouse myoblasts. Such
findings raise the prospect that similar regulators exist in other
systems to activate p21 at appropriate maturational stages. Such a
specific regulator of p21 expression during myeloid differentiation has
not been elucidated.
Our data in both cell line models and in normal hematopoietic
precursors undergoing maturation indicated that a highly conserved 44-bp sequence in the p21 promoter could be a target for a regulator of
p21 expression specific to maturation stage. Binding proteins recognizing this sequence were present in blasts and to a lesser degree
in promyelocytes and absent thereafter. Disruption of this stage-specific pattern of expression may occur in a setting of abnormal
growth and differentiation. Using extracts from primary leukemia cells,
gel-shift analysis of proteins binding to the 44-bp fragment results in
aberrant gel-shift patterns or in absence of binding in blasts. This
suggests that the protein recognizing this sequence may be a target of
dysregulation in leukemia.
The fact that binding to this sequence was inversely correlated with
p21 message levels in normal CD34+ cells and in
differentiating HL-60 cells raised the prospect either that the binding
protein acted as a basal transcriptional repressor or that it prevented
access by an activating factor. Previous reports indicating induction
of p21 by cycloheximide16,64 support the view that p21
transcription is subject to negative modulation. However, transient
transfection experiments demonstrated either an activating or a weak
repressing function of this fragment when it was placed upstream of
heterologous promoters and transfected into HL-60 cells. It has been
noted elsewhere that the ability of transcriptionally active factors to
function as activators or as repressors is highly dependent on the
surrounding DNA region and the environment of surrounding binding
sites.46-48 However, tranfection experiments represent an
imperfect approximation of the role of these elements in their native
context. Indeed, although p21 message is undetectable in growing HL-60
cells, we have noted high levels of luciferase activity of
p21-promoter-driven constructs transfected into these cells. In fact,
we have noted that the process of transfection upregulates endogenous
p21 mRNA on Northern blots in HL-60 cells (R.S., unpublished
observations). Similar transfection-mediated
upregulation of p21 has been reported elsewhere.45
It is provocative that this differentiation stage-specific binding
activity, 21PBA, recognizes a 16-bp DNA sequence that also contains a
recognition sequence for p53.23,57 Mutations in the binding
site that alter critical nucleotides in the consensus binding sequence
for p53 also abolish 21PBA binding. This raises the interesting
prospect that occupation of this site by the 21PBA protein precludes
binding by p53 to this sequence. Isolation of the 21PBA protein
components is underway to enable precise mapping of the overlap of
these binding sites and to establish whether a functional relationship
exists between 21PBA and p53 binding.
An interesting aspect of this study has been the observation that
differentiated cell extract can obviate the binding capability of
precursor cell extract in coincubation experiments. It is feasible that
a transcriptional modulator present in the immature cells could be
sequestered by partners present in differentiated cells, so that it is
no longer available to bind to the p21 promoter. Such an interaction
has been reported for Rb, which can sequester a CCAAT-binding protein
required for cyclin A transcription.65 However,
preclearance of our differentiated cell extracts with antibodies to Rb,
E2F, p21, p107, and p53 or coincubation of extracts with T-antigen does
not alter their ability to inhibit binding to the 44-bp sequence (R.S.,
unpublished observations).
Our finding that mature cell extracts suppress promoter element binding
by extracts of immature cells is most compatible with a model of p21
regulation through active derepression. A repressor of p21
transcription is postulated to bind to the promoter within the 44-bp
fragment in CD34+ cells. The repressor disengages as the
cells mature, permitting p21 expression in differentiating cells. A
similar mechanism of developmentally regulated activation of
transcription has been reported for other genes. Activation of elastin
gene expression in developing aorta,66 of the stearoyl-CoA
desaturase 2 gene activation during preadipocyte
differentiation,67 and of the -globin gene during
erythroid differentiation68 all involve disruption of a
repressor complex. Our model proposes sequestration of a p21-promoter
repressor during the normal maturation of myeloid cells as the
mechanism through which derepression might occur.
 |
FOOTNOTES |
Submitted June 17, 1997;
accepted February 3, 1998.
Supported by grants from the Laurie Strauss Foundation, American Cancer
Society (JRFA-594), and National Institutes of Health (HL54172-01) to
R.S.
Address reprint requests to Richard A. Steinman, MD, PhD, E1052 BST,
University of Pittsburgh School of Medicine, Pittsburgh, PA 15213;
e-mail: Steinman+{at}pitt.edu.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
 |
ACKNOWLEDGMENT |
The authors thank Xiao-Fan Wang for the p2l promoter-luciferase plasmid
p21-P, David Tweardy for the SIE target fragment, Brian Dynlacht for
anti-p21 antibody CP-36, Nicola Pavletich for p53 core protein, and
Calbiochem for the gift of p53 Ab (MoAb-6). We are indebted to Sandra
Kaplan for hematopathologic analysis; to Ying Li, Augustine Iro, and
Wei Pei for excellent technical support; and to Donna Shields for
CD34+ cell isolation. We are also indebted to Tim Wright,
Robert Redner, Reza Zarnegar, and Qing Dou for helpful discussions of
the project and manuscript.
 |
REFERENCES |
1.
Sachs L:
Constitutive uncoupling of pathways of gene expression that control growth and differentiation in myeloid leukemia: A model for the origin and progression of malignancy.
Proc Natl Acad Sci USA
77:6152,
1980[Abstract/Free Full Text]
2.
Pardee AB:
G1 events and regulation of cell proliferation.
Science
246:603,
1989[Abstract/Free Full Text]
3.
Furukawa Y,
Uenoyama S,
Ohta M,
Tsunoda A,
Griffin JD,
Saito M:
Transforming growth factor-beta inhibits phosphorylation of the retinoblastoma susceptibility gene product in human monocytic leukemia cell line JOSK-I.
J Biol Chem
267:17121,
1992[Abstract/Free Full Text]
4.
Oberg,
Botling,
Nilsson:
Functional antagonism between vitamin D3 and retinoic acid in the regulation of CD14 and CD23 expression during monocytic differentiation of U-937 cells.
J Immunol
150:3487,
1993[Abstract]
5.
Harper JW,
Adami GR,
Wei N,
Keyomarsi K,
Elledge SJ:
The p21Cdk-interacting protein Cip1 is a potent inhibitor of G1-cyclin-dependent kinases.
Cell
75:805,
1993[Medline]
[Order article via Infotrieve]
6.
Dulic V,
Kaufmann WK,
Wilson SJ,
Tisty TD,
Lees E,
Harper JW,
Elledge SJ,
Reed SI:
p53-dependent inhibition of cyclin-dependent kinase activities in human fibroblasts during radiation-induced G1 arrest.
Cell
76:1013,
1994[Medline]
[Order article via Infotrieve]
7.
Xiong Y,
Hannon GJ,
Zhang H,
Casso D,
Kobayashi R,
Beach D:
p21 is a universal inhibitor of cyclin kinases.
Nature
366:701,
1993[Medline]
[Order article via Infotrieve]
|