|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 2 (January 15), 1998:
pp. 406-418
The SH3 Domain Contributes to BCR/ABL-Dependent Leukemogenesis In
Vivo: Role in Adhesion, Invasion, and Homing
By
Tomasz Skorski,
Malgorzata Nieborowska-Skorska,
Pawel Wlodarski,
Mariusz Wasik,
Rossana Trotta,
Palanisamy Kanakaraj,
Paolo Salomoni,
Mark Antonyak,
Robert Martinez,
Miroslaw Majewski,
Albert Wong,
Bice Perussia, and
Bruno Calabretta
From the Kimmel Cancer Institute, Jefferson Medical College,
Philadelphia, PA; and the Department of Pathology and Laboratory
Medicine, University of Pennsylvania, Philadelphia, PA.
 |
ABSTRACT |
To determine the possible role of the BCR/ABL oncoprotein SH3 domain
in BCR/ABL-dependent leukemogenesis, we studied the biologic properties
of a BCR/ABL SH3 deletion mutant ( SH3 BCR/ABL) constitutively expressed in murine hematopoietic cells. SH3 BCR/ABL was able to
activate known BCR/ABL-dependent downstream effector molecules such as
RAS, PI-3kinase, MAPK, JNK, MYC, JUN, STATs, and BCL-2. Moreover,
expression of SH3 BCR/ABL protected 32Dcl3 murine myeloid precursor
cells from apoptosis, induced their growth factor-independent proliferation, and resulted in transformation of primary bone marrow
cells in vitro. Unexpectedly, leukemic growth from cells expressing
SH3 BCR/ABL was significantly retarded in SCID mice compared with
that of cells expressing the wild-type protein. In vitro and in vivo
studies to determine the adhesive and invasive properties of SH3
BCR/ABL-expressing cells showed their decreased interaction to collagen
IV- and laminin-coated plates and their reduced capacity to invade the
stroma and to seed the bone marrow and spleen. The decreased
interaction with collagen type IV and laminin was consistent with a
reduced expression of  2 integrin by SH3 BCR/ABL-transfected
32Dcl3 cells. Moreover, as compared with wild-type BCR/ABL, which
localizes primarily in the cytoskeletal/ membrane fraction, SH3
BCR/ABL was more evenly distributed between the cytoskeleton/membrane
and the cytosol compartments. Together, the data indicate that the SH3
domain of BCR/ABL is dispensable for in vitro transformation of
hematopoietic cells but is essential for full leukemogenic potential in
vivo.
| |
INTRODUCTION |
BCR/ABL ARE ONCOGENIC chimeric tyrosine
kinases generated from the reciprocal t(9;22) (q34;q11) translocation
in chronic myelogenous leukemia (CML) and in Philadelphia1
acute lymphocytic leukemia (ALL). The translocation fuses a truncated
bcr gene with sequences upstream of the second exon of the
c-abl gene.1,2 The BCR/ABL proteins p210 and p185
cause, CML- and ALL-like syndromes, respectively, in
mice3,4 and are required for Philadelphia1 cell
growth.5 Cytoplasmic BCR/ABL proteins6
transduce oncogenic signals to the nucleus via several
pathways.7-9 Signaling from BCR/ABL affects the function of
intracellular regulators involved in apoptosis10 and growth
factor-dependent proliferation11 and may intervene in
cell-cell communication and cell-extracellular matrix
interaction.12,13
BCR/ABL mutants have been used to define potential downstream effectors
of wild-type BCR/ABL7-9 and to identify the BCR/ABL domains
required for its transforming activity.14-19 Only a few of
the signaling proteins, eg, Shc,7 RAS,20,21
phosphatidylinositol 3-kinase (PI-3k),22 RAF,23 BCL-2,10 c-MYC,24 and cyclin
D1,25 appear essential for BCR/ABL-mediated leukemogenesis
and/or colony formation by Philadelphia1 cells.
These molecules, among others, are responsible for the BCR/ABL-dependent phenotype characterized by growth factor
independence,11,26 protection from apoptosis,27
abnormal adherence to the stroma,12,13 and leukemogenesis
in vivo.3 Each of these functions may be regulated through
different signaling pathways activated by distinct BCR/ABL domains.
Few domains or single amino acids are necessary for the full
leukemogenic potential of BCR/ABL. The kinase domain,28 the 176-427 amino acids segment in the BCR portion of the
protein,15 and the FLVRES motif in the SH2
domain7 are required for BCR/ABL oncogenic activity,
because single amino acid substitutions or deletions in these regions
result in impairment or abrogation of the transformation potential.
c-ABL SH3 domain mutations or deletions cause its oncogenic
activation.29 However, the role of this domain in
BCR/ABL-mediated leukemogenesis is unknown.
We report here that the SH3 domain is not required for the activation
of BCR/ABL-dependent signaling pathways associated with the transformed
phenotype in vitro. However, the same domain is important for
BCR/ABL-mediated leukemogenesis in vivo because it regulates adhesion,
invasion, and homing of leukemic cells.
| |
MATERIALS AND METHODS |
BCR/ABL Constructs
The p210 BCR/ABL(bcr exon 3/abl exon 2) wild-type (WT) cDNA
was generated by replacing the EcoRI-BsrGI fragment of
p185BCR/ABL in the pSRMSVtkneo retroviral construct (gift of Dr C. Sawyers, UCLA, Los Angeles, CA) with that of the p210 BCR/ABL(bcr
exon 3/abl exon 2) cloned in the sp65 plasmid (gift of Dr E. Canaani, Kimmel Cancer Institute, Philadelphia, PA). The p210BCR/ABL
K1172R mutant was obtained from Dr C. Sawyers (UCLA). The p210  SH3
BCR/ABL mutant was generated as follows: the
HindII-BsrGI fragment obtained by digestion from
SK-p210 BCR/ABL(bcr exon 3/abl exon 2) and the Bsm
I-NIaIV fragment obtained by digestion of the BCR/ABL PCR
product from nucleotides 3201-3471 were ligated in-frame into the
Bsm I-BsrGI-less p210 BCR/ABL, generating the
SK-SH3 BCR/ABL plasmid, which lacks the SH3 domain from amino acids
959-1020 of p210 BCR/ABL(bcr exon3/abl exon2). The
EcoRI-BsrGI fragment, containing the deletion, was
cloned into the EcoRI/BsrGI-digested pSRp210BCR/ABL.
The P1013L mutation of p210 BCR/ABL(b3a2) was generated by
polymerase chain reaction (PCR)-based mutagenesis. The mutant 3
primer oligonucleotide used for the proline to leucine substitution at
the 1013 codon in the SH3 domain of p210 BCR/ABL was 5-CAG ACT
GTT GAC TGG CGT GAT GTA GTT GCT TAG GA-3, where the
underlined sequence replaced the wild-type codon CCA. The 5
primer was 5-TTC AGA AGC TTC TCC CTG ACA-3. The wild-type p210 BCR/ABL cDNA was used as a template for PCR amplification of the
mutant SH3 domain. The PCR product was subcloned into p210 BCR/ABL
pBluescript as a Bsm I-HincII fragment and sequenced to verify the presence of the nucleotide substitutions. The P1013L mutation was then introduced into pSRp210BCR/ABL by replacement of
the wild-type with the mutated EcoRI-BsrGI fragment.
The SH2 mutant (from Dr R. Van Etten, Harvard Medical School,
Boston, MA) in the pGD210 vector was subcloned into the
pSRMSVtkneo-p210 BCR/ABL(bcr exon 3/abl exon 2) by
replacing the wild-type EcoRI-BsrGI fragment with that
lacking the SH2 domain. The pSRMSVtkneo 176-426 p185 BCR/ABL
mutant was obtained from Dr A.M. Pendergast (Duke University Medical Center, Durham, NC). In the pSRMSVtkneo construct, the BCR/ABL cDNAs
are under the control of the long terminal repeat (LTR) of the murine
sarcoma virus (MSV), whereas the neomycin resistance gene (neo) is
driven by the herpes simplex thymidine kinase (tk) promoter.
32Dcl3 Cell Transfection
Constructs were electroporated into 32Dcl3 murine growth
factor-dependent myeloid cells30 grown in Iscove's
modified Dulbecco medium (IMDM) supplemented with 10% fetal bovine
serum (FBS), 2 mmol/L L-glutamine, penicillin/streptomycin (100 µg/mL
each), and 15% WEHI-conditioned medium (WEHI-CM) as a source of
interleukin-3 (IL-3). BCR/ABL-expressing clones were selected in G418
(1 mg/mL) and were maintained in IMDM-CM.
Infection of Bone Marrow Cells (BMC) With BCR/ABL Viruses
Helper-free retroviral stocks were prepared as
described.13,30 BMC from C57BL/6TacfBR mice (The Jackson
Laboratory, Bar Harbor, ME) treated with 5-fluorouracil (150 mg/kg body
weight) 6 days before cell harvest were infected with BCR/ABL viruses or the insert-less virus in the presence of recombinant IL-3, Kit
ligand, and IL-6 as described.31 Expression of BCR/ABL
proteins was confirmed in sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE) followed by Western blotting with anti-ABL
monoclonal antibody (MoAb; Ab-3; Oncogene Science, Uniondale, NJ).
Northern Blot Analysis
Cells were starved of serum and growth factors during 5 hours of
incubation in IMDM supplemented with 0.1% bovine serum albumin, 2 mmol/L L-glutamine, and penicillin/streptomycin (100 µg/mL). Total
cellular RNA (10 µg/lane) was electrophoresed on agarose gels and
blotted onto a nitrocellulose PROTRAN membrane (Schleicher & Schuell,
Keene, NH). Full-length c-myc and c-jun cDNAs labeled with [-32P]dCTP (Dupont NEN Research Products, Boston,
MA) were used as probes. Glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) cDNA was used to control for equal RNA loading.
Western Blot Analysis
A rabbit anti-p85 PI-3k (UBI, Lake Placid, NY) was used for
immunoprecipitation.20 Postnuclear cell lysate and
immunoprecipitates were electrophoresed on SDS-polyacrylamide gels and
Western immunoblotting was performed with anti-ABL MoAb (Oncogene
Science), anti-p85 Ab (UBI), or anti-P.Tyr MoAb (UBI). Appropriate
horseradish peroxidase-labeled antibodies were used for detection using
ECL (Amersham Corp, Arlington Heights, IL).
Enzymatic Assays
Cells used in all the enzymatic assays were serum-starved and growth
factor-deprived as described above.
RAS activation was determined by measuring GTP-bound RAS.20
PI-3k activity was measured in the anti-P.Tyr
immunoprecipitates.22
MAPK activity was analyzed based on myelin basic protein (MBP; UBI)
phosphorylation, measured as described.32 Eluted products were separated by 13% SDS-PAGE and transferred to nitrocellulose membranes. In vitro phosphorylation of MBP was visualized after exposure of the filters to X-AR films (Eastman Kodak, Rochester, NY).
Western blot with anti-ERK2 antibody was performed to verify the
precipitated amounts of MAPK.
JNK activity was analyzed as described,33 with some
modifications. JNK was precipitated (3 hours at 40°C) with
GST-c-JUN (amino acids 1-79) glutathione-Sepharose beads (Pharmacia
Biotech, Piscataway, NJ) from 300 µg of whole cell extracts in 0.1 mL
of cell lysis buffer (10 mmol/L Na2HPO4, 150 mmol/L NaCl, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS,
0.2% NaH3, 0.004% NaF, 1 mmol/L
Na3VO4, 25 mmol/L  -glycerolphosphoric acid,
100 µg/mL phenylmethyl sulfonyl fluoride [PMSF], and 1 µg/mL each
of aprotinin and leupeptin, pH 7.35). Immunoprecipitates were washed
three times with phosphate-buffered saline containing 1% NP-40 and 2 mmol/L Na3VO4 and once with kinase reaction
buffer (25 mmol/L HEPES, 25 mmol/L MgCl2, 2 mmol/L
dithiothreitol [DTT], 0.1 mmol/L Na3VO4, and
25 mmol/L -glycerolphosphoric acid). Kinase reaction buffer
containing 2.0 µCi [ 32P]ATP (NEN) and 20 µmol/L of
cold ATP (30 µL) was added and, after 20 minutes of incubation at
30°C, samples were electrophoresed on SDS-polyacrylamide gels,
transferred to nitro-cellulose, and visualized after exposure to x-ray
film.
STATs Assay
Serum and growth factor-starved cells were resuspended in lysis buffer
containing 0.32 mol/L sucrose, 3 mmol/L CaCl2, 2 mmol/L Mg-acetate, 0.1 mmol/L EDTA, 10 mmol/L Tris-HCl, pH 8.0, 1 mmol/L DTT,
0.5 mmol/L PMSF, and 0.1% (vol/vol) NP-40. After centrifugation (2,600 rpm for 5 minutes at 4°C), nuclei were washed with lysis buffer
without NP-40, spun as described above, and resuspended in buffer
containing 20 mmol/L HEPES, 60 mmol/L KCl, 0.5 mmol/L EDTA, 2.5 mmol/L
DTT, 12% (vol/vol) glycerol. After 10 minutes on ice, nuclei were
freeze-thawed four times and centrifuged (14,000 rpm for 15 minutes at
4°C). Electrophoretic mobility shift assays (EMSAs) were performed
as follows. An oligonucleotide corresponding to the FcRI probe
(5 AGCTTGTATTTCCCAGAAAAGGGA 3; GAS motif is in
bold) was used as wild-type probe. A mutant oligonucleotide (5
AGCTTGTATGGATTGTCCAAGGGATC 3; mutated GAS motif is in
bold) was used as nonspecific (NS) competitor. The oligonucleotides were end-labeled with [-32P]ATP and T4 polynucleotide
kinase. DNA probe (30,000 cpm) was incubated with 3 µg poly(dI-dC)
and 10 µg of nuclear extract in incubation buffer (see above; 15 minutes at room temperature). Samples were electrophoresed in a 5%
polyacrylamide gel in 0.25× Tris-borate-EDTA (TBE) buffer for 120 minutes at 4°C (10 V/cm). Radioactivity was visualized after
exposure of the dried gels to x-ray film.
Clonogenic Assay
A total of 104 32Dcl3 or 105 BMC were plated in
MethoCult H4230 semisolid methylcellulose medium (Stem Cell
Technologies, Inc, Vancouver, British Columbia, Canada) as
described.20 Colonies were scored on day 12.
Apoptosis Assay
Cells (2 × 105/mL) were incubated in IMDM
supplemented with 10% FBS, 2 mmol/L L-glutamine, and
penicillin/streptomycin (without WEHI-CM) for 24 and 48 hours. The
percentage of apoptotic cells was determined using the TACS1 Klenow in
situ apoptosis detection kit (Trevigen, Inc, Gaithersburg, MD)
according to the manufacturer's protocol.
Detection of BCR/ABL-Positive Cells in SCID Mice
C.B-17/IcrTac-SCID (H-2Kd) male mice (Taconic Farms Inc,
Germantown, NY) and C57BL/6-SCID-SzJ mice (The Jackson Laboratory) received 350 rads of total body irradiation and 1 day later were injected intravenously with 5 × 106 32Dcl3 cells
(H-2Kk) or 106 BMC, respectively, expressing
the indicated BCR/ABL proteins. The number of 32Dcl3 transfectants in
bone marrow and spleen was analyzed 3 weeks later by flow cytometry
measurement of mononuclear cells labeled with the fluorescein
isothiocyanate (FITC)-conjugated anti-H-2Kk antibody (gift
of Dr R. Korngold, Kimmel Cancer Institute). To assess the development
of leukemia from BMC infected with the wild-type or the SH3 BCR/ABL
retrovirus, total RNA was isolated34 from 106
bone marrow, spleen, and peripheral blood mononuclear cell suspensions 4 weeks after cell inoculation. BCR/ABL transcripts were detected by
RT-PCR followed by Southern blotting as described,35 using the following primers: 5 primer, AAGATGATGAGTCTCCGGGGC; 3
primer, CGTCAGGCTGTATTTCTTCCA; and the probe spanning the b3/a2
junction-region, AGAGTTCAA AAGCCCTTC. To show that the reverse
transcription-PCR (RT-PCR) reaction was equally efficient
in each sample, 102 32Dcl3 transfectants carrying a
SH3+SH2 BCR/ABL mutant were added to each cell sample before RNA
extraction and the truncated SH3+SH2 BCR/ABL transcripts were
coamplified with either the wild-type or the SH3 BCR/ABL
transcripts. Because RT-PCR was performed with reagents used in excess
and only 102 cells were added to the samples, it is
unlikely that SH3+SH2 BCR/ABL mRNA was a competitor for the
BCR/ABL mRNA isolated from mouse tissues. The expected lengths of PCR
products are as follows: wild-type BCR/ABL, 800 bp; SH3 BCR/ABL, 605 bp; and SH3+SH2 BCR/ABL, 328 bp.
Homing Assay
Cells were labeled with [3H]-uridine (NEN Research
Products, DuPont, Wilmington, DE; 0.5 µCi/mL IMDM-CM medium) for 24 hours at 37°C, washed, and injected intravenously into SCID mice (5 × 106 32Dcl3 cells/mouse and 106
BMC/mouse). Bone marrow (from both femurs) and spleen cells were collected after 24 and 48 hours and deposited onto glass microfiber filters (Whatman International Ltd, Maidstone, UK). Cell-associated radioactivity was measured in a -scintillation counter.
Invasion Chamber Assay
BCR/ABL-expressing 32Dcl3 cells (106/mL) or BMC (0.5 × 106/mL) suspended in 2 mL of IMDM without WEHI-CM
were placed in the upper chamber of Biocoat Matrigel invasion chambers
(Becton Dickinson, Bedford, MA); the lower chamber was filled with 2 mL
of IMDM-CM as chemoattractant. Cells migrating into the lower chamber
were counted 24 hours later. Cells remaining on the membrane were
counted after washing and staining the membrane according to the
manufacturer's protocol.
Invasion of Monolayer
This assay was performed as described36 with some
modifications. Briefly, 104 32Dcl3 cell transfectants were
suspended in 1 mL IMDM-CM and layered on stromal bone marrow fibroblast
monolayers (third passage in 24-well plates for 24 hours at 37°C).
Cells in suspension and those adhering to the monolayer were removed by
washing and mechanical agitation monitored by phase-contrast
microscopy. The remaining cells were collected after trypsinization and
plated in MethoCult H4230 semisolid medium containing 15% WEHI-CM.
Colonies were scored on day 12.
Adhesion to Stroma
Confluent stromal cell layers were prepared in 12-well plates from BMC
cultured in Dulbecco medium supplemented with 10% FBS, 2 mmol/L
L-glutamine, and penicillin/streptomycin, with or without 2 × 10 6 mol/L methyl-prednisolone (MP), as
described.12 Before the experiments, adherent cells were
treated with 10 µg/mL mitomycin C for 2 hours at 37°C. 32Dcl3
cell transfectants (104) were incubated on the layers for 1 hour at 37°C. Nonadherent cells were collected and adherent cells
were harvested after trypsinization. Cells were plated in MethoCult
H4230 semisolid medium and colonies were scored 12 days later.
Adherence to Substrates
32Dcl3 cells and BMC expressing wild-type or mutant BCR/ABL proteins
were suspended (2 × 106/4 mL and 106/4
mL, respectively, IMDM supplemented with 0.1% bovine serum albumin)
and incubated (4 hours at 37°C) in 6-well plates coated with the
indicated substrate (Biocoat Cellware; Becton Dickinson, Bedford, MA).
Nonadherent cells were removed and adherent cells were harvested after
trypsinization and counted.
Flow Cytometry Analysis of Integrin Expression
Parental and BCR/ABL-expressing 32Dcl3 cells were washed and incubated
with FITC antirat CD29 (integrin 1 chain), FITC
antimouse CD49b (integrin 2 chain), or hamster antirat/mouse CD49a
(integrin 1 chain) for 45 seconds at 4°C. For
detection of the integrin 1 chain, cells were
extensively washed and incubated with FITC antihamster IgG for 45 seconds at 4°C. Cells were washed and analyzed by flow cytometry.
Cells stained with FITC antihamster IgG served as negative controls.
All antibodies were from PharMingen (San Diego, CA).
Cellular Localization of Wild-Type and SH3 BCR/ABL in
32Dcl3-Transfected Cells
Protein fractionation.
Clones of 32Dcl3 cell transfectants were lysed in hypotonic buffer (10 mmol/L Tris, pH 7.5, 5 mmol/L MgCl2, 1 mmol/L EGTA, 1 mmol/L Na2VO4, 5 mmol/L leupeptin, 20 µg/mL
aprotinin, 1 mmol/L benzamidin, and 1 mmol/L PMSF) at
107/mL as described.37 After 5 minutes on ice,
lysates were homogenized in a Dounce homogenizer. Nuclei and debris
were removed by 5 minutes of centrifugation at 1,000g and the
supernatant was adjusted with NaCl until isotonic (100 mmol/L NaCl) and
centrifuged at 100,000g for 40 minutes. The sedimented fraction
was resuspended in RIPA buffer and designated the membrane fraction;
the supernatant was designated the cytosol fraction. Protein
concentration in the corresponding fractions of each cell lysate was
adjusted after protein content measurements by the Bradford method
(Bio-Rad Protein Assay; Bio-Rad Laboratories, Hercules,
CA). As a control for similar levels of protein expression
in cells used in the experiments, 5 × 105 cells of
each clone were lysed in RIPA buffer and total cell extracts, along
with the membrane and cytosolic fractions, were separated by SDS-PAGE.
Proteins were detected by Western blotting with antibodies against
c-ABL (Oncogene Science), anti-p120GAP (UBI), and anti-CD71
(transferrin receptor; PharMingen).
Confocal microscopy.
Cytospin preparations of 32Dcl3 cells from individual clones expressing
wild-type or SH3 BCR/ABL protein were fixed with methanol for 5 minutes and permeabilized in acetone for 2 minutes at
 20°C.29 All subsequent steps were at room
temperature. After 30 minutes of incubation in 1% goat IgG (Organon
Teknika Corp, Cappel Research Products, Durham, NC), cells were
incubated sequentially with anti-ABL MoAb (PharMingen; 10 µg/mL) for
45 minutes and FITC-(Fab)2 goat antimouse Ig
(Organon Teknika) at a 1:100 dilution with intermediate washings.
Slides were mounted with Slowfade antiquenching agent (Molecular
Probes, Eugene, OR) and examined for confocal microscopy using an
Axiovert 100 Zeiss microscope and MRC-600 system (Bio-Rad Corp).
| |
RESULTS |
SH3 BCR/ABL Signaling
BCR/ABL activates specific signaling pathways, inhibits apoptosis,
stimulates growth factor-independent proliferation, and induces
leukemic transformation when expressed in growth factor-dependent hematopoietic cell lines or in BMC. To determine whether the SH3 domain
of BCR/ABL plays a role in these processes, the wild-type protein and
an SH3 deletion mutant (SH3) were expressed in myeloid precursor
32Dcl3 cells. The kinase-deficient K1172R BCR/ABL mutant, defective in
many BCR/ABL functions,8 was used as negative control.
Several G418-resistant clones of 32Dcl3 cells transfected with a vector
carrying wild-type or mutant BCR/ABL were analyzed for BCR/ABL protein
expression. Four clones from each group were selected for further study
(Fig 1A). Clones transfected with vector only or with the K1172R kinase-deficient BCR/ABL mutant served as
negative controls. Experiments were performed with individual clones
and pools of clones expressing the same BCR/ABL protein. As indicated
by Western blotting with antiphosphotyrosine (P.Tyr) MoAb, tyrosine
phosphorylated proteins of similar mass were detected in cell lysates
from 32Dcl3 cells expressing wild-type or SH3 BCR/ABL (Fig 1B).
View larger version (39K):
[in this window]
[in a new window]
| Fig 1.
BCR/ABL expression and protein tyrosine phosphorylation
in individual 32D clone transfectants expressing wild-type or mutant BCR/ABL protein. (A) Expression of wild-type (WT), kinase-deficient mutant (K1172R), or SH3 BCR/ABL proteins was examined in four 32Dcl3
transfectants by Western blotting with anti-ABL MoAb. (B) Phosphorylation of cellular proteins was analyzed after SDS-PAGE of
cell lysates from the same clones as in (A) using anti-P.Tyr MoAb 4G10.
Results are representative of three independent experiments.
|
|
32Dcl3 cell clones (4 for each transfectant), starved of serum and
growth factors, were then assessed for the activation of several
proteins involved in different signaling pathways. Wild-type and SH3
BCR/ABL expression resulted in the activation of the same proximal
(RAS, PI-3k, mitogen-activated protein kinase [MAPK], Jun kinase
[JNK]) and distal (Myc, Jun, signal transducers and activators of
transcription [STATs]) signaling molecules
(Fig 2), whereas expression of the
kinase-deficient K1172R BCR/ABL mutant did not activate any of the
signal transduction proteins analyzed.
View larger version (46K):
[in this window]
[in a new window]
| Fig 2.
Activation of signal transduction pathways by BCR/ABL
proteins. (A) Levels of GTP-bound RAS in BCR/ABL-expressing cells.
Pools of clones expressing the indicated vectors were labeled with
[32P] orthophosphate. RAS was immunoprecipitated and
the proportion of GTP- and GDP-bound forms was analyzed by thin-layer
chromatography. (B) PI-3k interaction with BCR/ABL proteins. (Left
panel) PI-3k activity was detected in antiphosphotyrosine
immunoprecipitates from a mixture of clones expressing the indicated
vectors. (Right panel) p85 immunoprecipitates from the indicated
mixtures of clones were analyzed after SDS-PAGE and Western blotting
with anti-ABL antibody. p85 was detected with anti-p85 antibody after
stripping the filter. (C) Activation of MAPK and JNK pathways by
BCR/ABL proteins. (Left panel) MAPK and JNK activities were measured in the appropriate immunoprecipitates using, respectively, myelin basic
protein (MBP) and GST-JUN as substrates. (Right panel) Expression of
c-MYC and c-JUN mRNA was determined in total cellular RNA (10 µg) by
Northern blotting. GAPDH was detected as a control for equal gel
loading. (D) DNA binding activity of STAT proteins. EMSA was performed
using nuclear extracts of the indicated clone mixtures and synthetic
oligonucleotides containing the GAS motif as a probe. Results are
representative of three to four independent experiments.
|
|
Functional Consequences In Vitro of SH3 BCR/ABL Expression in
Myeloid Precursor Cells
To assess the ability of SH3 BCR/ABL to prevent apoptosis induced by
cytokine deprivation, the percentage of apoptotic cells was determined
in transfected 32Dcl3 cells starved of WEHI-CM. BCR/ABL wild-type or
SH3 mutant-expressing 32Dcl3 cells were resistant to apoptosis
(Fig 3A), whereas cells carrying the K1172R kinase-deficient BCR/ABL mutant underwent apoptosis with kinetics (not
shown) similar to that of control cells transfected with the vector.
These results are consistent with the upregulation of BCL-2 levels only
in wild-type and SH3 transfectants (data not shown).
View larger version (13K):
[in this window]
[in a new window]
| Fig 3.
Effects of wild-type and SH3 BCR/ABL on apoptosis and
proliferation. (A) Cells were seeded without growth factors and
apoptosis was quantitated at 24 ( ) and 48 hours ( )
using an in situ apoptosis detection kit. Results represent the mean ± SD of four independent experiments using individual clones. In (B)
and (C), cells from individual clones growing in IMDM-CM were plated
with or without, respectively, added WEHI-CM in 96-well plates. The
number of cells in each well was scored daily. Results are
representative of four independent experiments using individual clones
( ) vector, () WT, () K1172R, and ( ) SH3.
|
|
Individual clones transfected with any of the plasmids had similar
proliferation rates in the presence of WEHI-CM as a source of growth
factors (Fig 3B). However, only clones expressing the wild-type protein
or the SH3 BCR/ABL mutant were able to generate cell lines with
similar proliferation rates in the absence of WEHI-CM (Fig 3C), and
only these cells generated growth factor-independent colonies in
semisolid methylcellulose medium (Table 1).
To examine the role of the SH3 domain in the ability of BCR/ABL to
transform murine BMC in vitro, cells were infected with retroviruses
carrying the different constructs. Expression of BCR/ABL was detected
by SDS-PAGE and Western blotting (not shown), and clonogenic activity
of the infected cells was measured in the presence of G418 (1 mg/mL) in
semisolid methylcellulose medium with or without recombinant murine
IL-3 (rmuIL-3). As compared with marrow cells infected with the K1172R
kinase-deficient mutant or the insert-less virus, cells infected with
wild-type BCR/ABL formed an increased number of colonies in the
presence of threshold concentrations (0.1 U/mL) of IL-3 (Table 1).
Colony formation was also observed in the absence of IL-3 (Table 1),
consistent with a previous report.38 The extent of colony
formation from marrow cells infected with the SH3 BCR/ABL mutant was
indistinguishable from that of wild-type BCR/ABL cells (Table 1).
BCR/ABL transcripts were detected by RT-PCR in individual colonies
recovered from methylcellulose (10 colonies tested from each group;
data not shown) as described.39
Leukemogenic Potential of SH3 BCR/ABL-Expressing Cells
To assess the leukemogenic potential of the SH3 BCR/ABL mutant,
individual 32Dcl3 transfectant clones expressing BCR/ABL proteins or
carrying the vector only were injected intravenously into SCID mice.
Leukemia development was analyzed after 3 weeks. Spleen and bone marrow
of mice (H-2Kd) injected with 32Dcl3 cells
(H-2Kk) expressing wild-type BCR/ABL were massively
infiltrated by these cells (38.7% and 44.9% of the cells,
respectively; Table 2), as assessed by
immunofluorescence with the anti-H-2Kk antibody. In
contrast, spleen and bone marrow of mice implanted with 32Dcl3 cells
expressing SH3 BCR/ABL contained fewer leukemic cells (7.4% and
7.3%, respectively; Table 2). 32Dcl3 cells expressing the K1172R
tyrosine kinase-deficient mutant or transfected with vector only were
not detectable in either organ (not shown). Consistent with these
results, mice injected with 32Dcl3 clones expressing wild-type BCR/ABL
died within 6 to 9 weeks (6.2 ± 1.1 weeks) after injection, whereas
mice injected with SH3 BCR/ABL mutant died of leukemia after 17 to
45 weeks (25.4 ± 7.4 weeks, P < .001 as compared with the wild-type group; Fig 4).
View larger version (12K):
[in this window]
[in a new window]
| Fig 4.
Survival curves of mice injected with BCR/ABL-expressing
32D cells. SCID mice (5 mice/clone) were injected intravenously with 5 × 106 cells from each of the 4 clones analyzed expressing
the indicated protein or carrying the empty vector. () Vector, ()
WT, () K1172R, and () SH3.
|
|
At necropsy, histopathologic examination showed that leukemic cell
infiltration of bone marrow, spleen, liver, lungs, and kidneys from
mice of either group that succumbed to leukemia was similar (data not
shown). Complete replacement of the red and white pulp by a diffuse
cellular infiltrate was detected in spleens from mice injected with
wild-type or SH3 BCR/ABL mutant-expressing cells, and the
infiltrates were composed primarily of blast cells with a low degree of
myeloid and megakaryocytic differentiation (data not shown). Myeloid
differentiation was confirmed by staining for chloroacetate esterase.
Similar acute myeloid leukemic infiltrates were seen in liver, lungs,
and kidneys; bone marrow was also involved and myeloid differentiation
was more pronounced at this site (data not shown).
To further assess the leukemogenic potential of SH3 BCR/ABL,
leukemia development from mouse marrow cells infected with retroviruses carrying wild-type or SH3 BCR/ABL and injected into preirradiated SCID mice was examined 4 weeks later by RT-PCR detection of BCR/ABL transcripts in peripheral blood, bone marrow, and spleen. To ensure that the results of RT-PCR detection of BCR/ABL transcripts
quantitatively reflected the number of leukemic cells in the various
tissues, the following steps were taken. (1) Marrow cells infected with a retrovirus carrying the wild-type or the SH3 BCR/ABL mutant formed
the same number of methylcellulose colonies in 0.1 U/mL of IL-3 and in
the absence of the growth factor and expressed similar levels of
BCR/ABL transcripts (not shown). (2) A total of 102 cells
of a 32Dcl3 transfectant expressing a SH3 + SH2 BCR/ABL mutant
were added to each cell suspension obtained from peripheral blood, bone
marrow, or spleen, thus allowing the detection of a shorter BCR/ABL
transcript used as an internal control of the RT-PCR procedure. (3)
-Actin transcripts were also amplified from an aliquot of each
sample as an additional control. Levels of SH3 BCR/ABL transcripts
in bone marrow, spleen, and peripheral blood were much lower (7- to
10-fold less abundant in bone marrow and spleen, respectively) or even
undetectable (in the peripheral blood) compared with the amount of
wild-type BCR/ABL transcripts in the corresponding tissues
(Fig 5).
View larger version (50K):
[in this window]
[in a new window]
| Fig 5.
Detection of BCR/ABL transcripts in hematopoietic organs
of SCID mice inoculated with BMC infected with wild-type or SH3 BCR/ABL. Preirradiated C57BL/6-SCID-SzJ mice were injected with 106 BMC infected with the wild-type (lanes 1 through 5) or
SH3 BCR/ABL (lanes 6 through 10) retrovirus. After 4 weeks,
mononuclear cells from bone marrow (BMC), spleen (SPL), and peripheral
blood (PBL) were harvested and BCR/ABL transcripts were detected by
RT-PCR. To control the efficiency of RT-PCR in each sample,
102 32Dcl3 transfectants expressing the SH3+SH2
BCR/ABL mutant were added to each sample before RNA extraction. As an
additional control of the RNA preparation, -actin transcripts were
also amplified from each sample.
|
|
In marked contrast, levels of SH3+SH2 BCR/ABL and -actin
transcripts were essentially identical in tissue samples from mice
injected with cells carrying the wild-type or SH3 BCR/ABL retrovirus
(Fig 5).
Homing Ability of SH3 BCR/ABL-Expressing Cells In Vivo
The homing ability of wild-type and SH3 BCR/ABL-expressing 32Dcl3
transfectants was determined in SCID mice injected with [3H]uridine-labeled 32Dcl3 cells. Radioactivity in spleen
and bone marrow from mice injected 24 or 48 hours earlier with cells
expressing SH3 BCR/ABL was twofold to threefold lower than that
detected in the corresponding organs of mice injected with cells
expressing wild-type BCR/ABL (Fig
6A).
View larger version (27K):
[in this window]
[in a new window]
| Fig 6.
In vivo homing of BCR/ABL-expressing cells. Single-cell
suspensions were prepared from bone marrow (BMC) and spleen (SPL) of
mice 24 ( ) and 48 () hours after injection with
[3H]-uridine-labeled 32Dcl3 clones (A) or
retrovirus-infected BMC (B) and deposited onto glass microfiber
filters. Cell-associated radioactivity was determined as described in
the Materials and Methods. Results are expressed as the percentage of
injected radioactivity (mean ± SD from 3 mice in each group).
|
|
To assess whether the defect in homing was specifically due to the
deletion of the SH3 domain, the homing ability of 32Dcl3 transfectants
expressing either the SH2 or the 176-426 BCR/ABL deletion mutants
was examined and found to be essentially identical to that of wild-type
BCR/ABL transfectants (Fig 6A). At 48 hours, radioactivity levels in
spleen and bone marrow of mice injected with 32Dcl3 cells expressing
K1172R BCR/ABL or carrying the empty vector were lower than those
detected at 24 hours, probably reflecting the greater propensity of
these cells, as compared with the wild-type or SH3 BCR/ABL
transfectants, to undergo apoptosis upon growth factor deprivation.
Histopathologic examination showed no differences in organ distribution
of the 32Dcl3 leukemic cells, and no radioactivity was detected in
association with peripheral blood leukocytes at the time of the assay
(data not shown). Thus, the SH3 BCR/ABL-expressing cells that did
not home to hematopoietic organs were likely eliminated from the mice.
To exclude the possibility that the differences in the homing ability
of 32Dcl3 transfectants expressing wild-type or SH3 BCR/ABL were
unique to these cells, murine BMC infected with a retrovirus carrying
either construct were selected in G418-containing medium for 14 days,
labeled with [3H]-uridine, and injected into mice. Radioactivity in
spleen and bone marrow was assessed 24 and 48 hours later. The homing
ability of SH3 BCR/ABL-infected BMC was impaired, as compared with
that of cells expressing wild-type BCR/ABL (Fig 6B).
Invasion and Adherence Abilities of SH3 BCR/ABL-Expressing Cells
In Vitro
Invasion and adherence ability of 32Dcl3 cell clones or murine BMC
expressing wild-type or mutant BCR/ABL were analyzed in assays for
invasion and interaction with specific substrates. In invasion chamber
assays, a greater number of 32Dcl3 cells expressing the wild-type
BCR/ABL passed through the membrane, as compared with cells expressing
SH3 BCR/ABL, K1172 BCR/ABL or carrying the vector only
(Table 3). 32Dcl3 cells transfected with
the P1013L BCR/ABL mutant, which is equivalent to the P131L c-abl mutant defective in binding to proline-rich target
proteins,40 had also a reduced invasive potential (Table
3). In contrast, 32Dcl3 cells transfected with SH2 BCR/ABL or with
the 176-426 BCR/ABL mutant behaved like the wild-type transfectants
(data not shown).
A similar pattern was observed using BMC infected with wild-type,
SH3 BCR/ABL, or K1172R BCR/ABL mutant or carrying the empty vector
and selected for 14 days in medium containing G418 (1 mg/mL) and Kit
ligand, IL-3, and IL-6 (Table 3).
The reduced invasive potential of SH3 BCR/ABL transfectants was
confirmed on a fibroblast monolayer; as compared with cells transfected
with wild-type BCR/ABL, fewer 32Dcl3 cells transfected with the SH3
BCR/ABL mutant invaded the fibroblast monolayer (Table 3).
Adherence of 32Dcl3 transfectants expressing the various BCR/ABL
proteins to bone marrow stroma cultured in the presence (+) or absence
() of MP was also analyzed. Murine bone marrow progenitors, like
human hematopoietic progenitor cells, adhere to MP+, but
not to MP stroma.12 As compared with
32Dcl3 cells expressing K1172R BCR/ABL mutant or transfected with
vector only, a greater number of cells expressing wild-type BCR/ABL
adhered to MP than to MP+ stroma.
Deletion of the SH3 domain from BCR/ABL reduced the adhesive ability of
transfected cells to MP stroma by approximately
2.5-fold, without a significant influence on the adhesion to
MP+ stroma (Table 3).
To examine in more detail the defect in adhesive properties of 32Dcl3
and murine BMC expressing SH3 BCR/ABL, we tested their ability to
adhere to components of the basement membrane (ie, collagen IV and
laminin) and to fibronectin, a component of the stroma. Cells
expressing wild-type BCR/ABL showed increased adherence to collagen IV
(3.5- to 9-fold) and to laminin (2.5- to 3.5-fold) and decreased
adherence to fibronectin (2- to 6-fold) as compared with cells
expressing the K1172R BCR/ABL mutant or carrying the vector only (Table
3). Deletion of the SH3 domain from BCR/ABL or introduction of the
proline to leucine mutation at codon 1013 of the BCR/ABL SH3 domain
markedly reduced the ability of SH3 BCR/ABL-expressing cells or
32Dcl3 cells transfected with the P1013L mutant to adhere to collagen
IV- and laminin-coated, but not to fibronectin-coated plates, as
compared with cells expressing the wild-type protein (Table 3). The
number of SH2- and 176-426- transfected 32Dcl3 cells adhering to
collagen IV and laminin was similar to that of wild-type BCR/ABL
transfectants (data not shown). None of the BCR/ABL proteins changed
the adherence abilities of the cells to poly-L-lysine-coated plates
(Table 3).
To determine whether the reduced adherence to laminin- and collagen
IV-coated plates of SH3 and P1013 BCR/ABL-expressing cells reflected
changes in the expression of the corresponding integrin receptors, the
levels of 1, 2, and 1 integrins were measured by flow
cytometry in parental and BCR/ABL-transfected 32Dcl3 cells. 1
integrin was expressed at equivalent levels in parental and
BCR/ABL-transfected 32Dcl3 cells, whereas 1 integrin levels were
undetectable in these cells (data not shown). In contrast, 2
integrin was detectable in 32Dcl3 cells expressing wild-type BCR/ABL,
but not in parental cells (Fig 7);
interestingly, 2 integrin was not detectable in 32Dcl3 cells
expressing SH3 BCR/ABL or the P1013L mutant (Fig 7).
View larger version (29K):
[in this window]
[in a new window]
| Fig 7.
Cytofluorimetric detection of 2 integrin in parental
and BCR/ABL-transfected 32Dcl3 cells. (A) Parental 32Dcl3 cells; (B) BCR/ABL-transfected 32Dcl3 cells; (C) SH3 BCR/ABL-transfected 32Dcl3
cells; (D) P1013L BCR/ABL-transfected 32D cells. Representative of
three separate experiments with similar results. Solid line, negative
control; stippled line, 2 integrin.
|
|
Intracellular Localization of Wild-Type and SH3 BCR/ABL
Because the SH3 domain has been reported to affect the intracellular
localization of the Src tyrosine kinase,41 we analyzed localization of the BCR/ABL protein in the 32Dcl3 transfectants. Compared with wild-type BCR/ABL,which localizes mainly in the membrane
fraction, SH3 BCR/ABL was more evenly distributed between the
membrane cytoskeleton and the cytosol compartments
(Fig 8, top panel). Note that the
transferrin receptor (CD71) was expressed only in the membrane
fraction, whereas p120GAP was detected primarily in the cytosol (Fig
8), showing that the preparation of membrane and cytosol fractions was
sufficiently pure.
View larger version (77K):
[in this window]
[in a new window]
| Fig 8.
Intracellular localization of BCR/ABL proteins. (Top
panel) Membrane (m) and cytosolic (c) BCR/ABL, p120 GAP, and
transferrin receptor (CD71) were analyzed in BCR/ABL (wild-type and
SH3) transfectants by SDS-PAGE followed by Western blotting with
anti-ABL, anti-GAP, and anti-CD71 MoAbs. As a control, the same
proteins were also detected in total cell lysates. Results are
representative of three different experiments. (Bottom panel) 32Dcl3
cells expressing wild-type (A) or SH3 mutant (B) BCR/ABL were
incubated with anti-ABL followed by FITC-conjugated goat antirabbit
antibody and examined by confocal microscopy. Results are
representative for three individual clones from each group (original
magnification × 800).
|
|
Confocal microscopy analysis showed a finely punctate localization for
wild-type BCR/ABL, whereas SH3 BCR/ABL exhibited a coarsely punctate
pattern of cellular distribution (Fig 8, right panel). The use of an
antibody directed to an ABL epitope did not affect the interpretation
of these results, because the ratio of BCR/ABL to ABL proteins in
transfected cells is approximately 3 to 5:1 and c-ABL localizes
primarily to the nucleus.29
| |
DISCUSSION |
SH3 domains consist of a short conserved stretch of 50 amino acids that
interact with proline-rich regions in other proteins,42 thereby modulating function and/or cellular localization of the proteins involved in the interactions.43 For example, the
SH3 domain-mediated interaction of oncogenic tyrosine kinases with the
p85 subunit of PI-3k plays an important role in signal
transduction.44,45 Deletion or mutation of the SH3 domain
of the c-ABL nuclear tyrosine kinase is one mechanism whereby v-ABL is
oncogenically activated.29 However, deletion of c-ABL
carboxy-terminal sequences with retention of the SH3 domain and fusion
with viral sequences also activates the oncogenic potential of
v-ABL,46,47 suggesting that deletion/mutation of the SH3
domain is not strictly required for v-ABL activation.
The mechanism of ABL oncogenic activation after its joining with the
truncated BCR gene and formation of the chimeric BCR/ABL oncogene48 differs from those involved in v-ABL activation. The SH3 domain and carboxy-terminal sequences of c-ABL are both intact
in BCR/ABL, and BCR/ABL tyrosine kinase activity is autoregulated by
BCR sequences.14,15 Thus, it is unclear whether the BCR/ABL SH3 domain plays a role in BCR/ABL-induced leukemogenesis. To test
this, we generated a p210BCR/ABL SH3 deletion mutant (SH3 BCR/ABL)
and assessed the properties of hematopoietic cells constitutively expressing this mutant in vitro and in vivo.
The BCR/ABL SH3 Domain Is Not Required for Activation of
Intracellular Signals Regulating Proliferation and Survival
Like wild-type BCR/ABL, SH3, but not the K1172R mutant, induced
growth factor-independent proliferation of transfected 32Dcl3 cells,
inhibited their differentiation in the presence of granulocyte colony-stimulating factor (G-CSF; not shown), and protected the cells
from apoptosis. Also, SH3 BCR/ABL was capable of transforming murine
BMC. The SH3 BCR/ABL mutant induced signaling pathways leading to
stimulation of RAS,7,20,49,50 PI-3k,22,51 JNK,52 MAPK,53 and STATs54 and to
increased c-MYC expression.8 This indicates that the SH3
domain is not required for the signaling to known BCR/ABL effectors. On
the other hand, the SH3 domain might be involved in the activation of
some of these BCR/ABL effectors, but its absence might be compensated
by distinct pathways activated by other BCR/ABL domains, analogous to
the involvement of different domains of BCR/ABL that interact with
Grb-2 and/or Shc in RAS activation.7
The Leukemogenic Potential of BCR/ABL Is Impaired upon Deletion
of the SH3 Domain
Unlike the functions discussed above, the in vivo leukemogenic
potential of hematopoietic cells expressing the SH3 BCR/ABL protein
was significantly impaired. Hematopoietic tissues of SCID mice injected
with cells expressing the mutant protein showed markedly reduced levels
of BCR/ABL transcripts as compared with tissues from mice injected with
cells expressing the wild-type protein. Moreover, infiltration of bone
marrow and spleen by 32Dcl3 cells expressing the SH3 BCR/ABL mutant
was fivefold to sixfold lower than that in mice injected with wild-type
BCR/ABL transfectants. Consistent with these data, survival of SCID
mice injected with 32Dcl3 cells expressing SH3 BCR/ABL was about
fourfold longer than that of mice injected with cells expressing
wild-type BCR/ABL. Thus, the presence of the SH3 domain is required for
aggressive leukemia in vivo. The stage of differentiation of these
leukemic cells in vivo was identical in all mice, excluding the
possibility that delayed leukemogenesis from SH3 BCR/ABL cells
reflects an increased rate of cell differentiation. This conclusion is
further supported by the observation that the transfected cells do not undergo granulocyte differentiation in vitro in the presence of G-CSF
(data not shown). Moreover, in vitro proliferation rates of 32Dcl3
cells and BMC expressing the SH3 mutant or wild-type BCR/ABL were
similar, which argues against the possibility that differences in
growth rate determine the in vivo leukemogenic potential of cells
expressing the mutant oncogene.
Lack of the SH3 Domain Impairs Lodging of BCR/ABL-Expressing
Cells in Bone Marrow and Spleen
Because proliferation and survival of SH3 and wild-type
BCR/ABL-expressing cells were comparable, we asked whether the impaired leukemogenic potential of SH3 BCR/ABL-transfected cells might rest
in defects in cell-cell and cell-extracellular matrix interactions that
allow efficient lodging of leukemic cells in tissues. Indeed, such
defective interactions were suggested in each of the assays performed
to test the ability of SH3 BCR/ABL-expressing cells to adhere to
basement membrane and stroma substrates, to pass through artificial
membranes, to infiltrate the stroma, and to lodge in vivo in bone
marrow and spleen. Verfaillie et al13 suggested that
abnormal trafficking of CML cells is dependent on the changes in their
ability to adhere to stromal and basement membrane components (collagen
IV, fibronectin, and laminin) due to elevated levels of 2 and 6
integrins. Analysis of integrin expression in 32Dcl3 cells transfected
with wild-type and mutant BCR/ABL showed that, compared with parental
cells, wild-type BCR/ABL induced expression of 2 integrin.
Interestingly, the reduced ability of SH3 BCR/ABL-expressing cells
to adhere to collagen IV- and laminin-coated plates correlated with
lack of 2 integrin expression in these cells. The 21 complex
serves as ligand for laminin and collagens.55 Cells
transfected with the P1013L mutant also lacked 2 integrin
expression, raising the possibility that wild-type BCR/ABL activates
the expression of 2 integrin via proline-rich proteins interacting
with the SH3 domain. Several ABL SH3 binding proteins have been
identified, such as 3BP-1,56 Abi-1,57
Abi-2,58 AAP1,59 RIN1,60 and
PAG.61 However, only two of them (RIN1 and PAG) were also
described as BCR/ABL-binding proteins and, accordingly, as potential
downstream molecules in the signaling from the SH3 domain of BCR/ABL.
The reduced ability of SH3 BCR/ABL-expressing cells to home into
bone marrow and spleen correlated with a reduced tissue infiltration by
these cells at 3 or 4 weeks of leukemia growth (Table 2 and Fig 5) and
with a marked survival prolongation of mice injected with SH3
BCR/ABL 32Dcl3 cells as compared with those injected with wild-type
BCR/ABL 32Dcl3 cells (Fig 4). Because the in vitro survival of SH3
BCR/ABL-expressing cells under condition of growth factor deprivation
was undistinguishable from that of wild-type BCR/ABL-expressing cells,
it seems likely that the defect in homing of SH3 BCR/ABL-expressing
cells was the consequence of the impairment in their adhesion and
infiltration abilities rather than of a reduced survival. However, it
is also possible that a loss of survival and/or a reduced
proliferation becomes only manifest when SH3 BCR/ABL-expressing
cells need to respond to cell-cell- or cell-extracellular
matrix-mediated signals. By contrast, cells expressing the SH2 or
the 176-426 mutant were not defective in invasion, substrate
interaction, or homing, even if defective in transformation and in the
ability to activate various intracellular signaling pathways in
hematopoietic cells.7,8,62 Thus, the leukemogenic potential
of BCR/ABL involves distinct domains that affect, respectively,
intracellular signaling or cell adhesion and motility. It has been
postulated that SH3 domains are involved in intracellular localization
of the interacting proteins because most proteins that contain SH3
domains associate with the cortical actin cytoskeleton and/or
cellular membranes.63-65 In fibroblasts, activated Src
associates with integrin-dependent cytoskeletal
complexes,66 and this localization appears to depend, at
least in part, on the Src SH3 domain.41
A recent study suggests that, in transfected 32Dcl3 cells, p210 BCR/ABL
localizes to punctate structures similar to focal adhesions of
epithelial cells.67 Such localization is believed to be
important in regulating integrin function through phosphorylation and
dephosphorylation of specific tyrosine residues.68 Integrin receptors play an important role not only in mediating cell-cell and
cell-extracellular matrix interactions, but also in regulating cell
proliferation, differentiation, and survival, possibly through the
formation of multiprotein signaling complexes that trigger the
activation of intracellular pathways in response to extracellular matrix-generated signals.68,69 Thus, loss of the BCR/ABL
SH3 domain might not only impair the initial lodging of
BCR/ABL-expressing cells into bone marrow and spleen, but also their
subsequent proliferation.
The wild-type BCR/ABL protein is mainly found in the
cytoskeletal/membrane fraction, whereas SH3 BCR/ABL is more evenly
distributed between the membrane and cytosolic compartments. The
cellular redistribution of BCR/ABL protein upon removal of the SH3
domain is not unprecedented, because SH3 Src mutant also did
interact with focal adhesions and cytoskeletal matrix less than the
wild-type protein, despite maintaining the myristylation site for
membrane attachment.41 Interestingly, SH3 Src mutant was
reported to be unable to transform efficiently NIH-3T3
fibroblasts.70 Confocal microscopy after staining with
anti-ABL antibody showed a coarsely punctate pattern for SH3 BCR/ABL
that contrasts with the finely punctate pattern of wild-type BCR/ABL
(Fig 8). This might reflect protein aggregation or the association of
SH3 BCR/ABL with structures different from those to which wild-type
BCR/ABL localizes.
In conclusion, the SH3 domain does not influence intracellular
signaling that regulates proliferation and survival of
BCR/ABL-transfected cells but is required for full leukemogenic
potential in vivo. The molecular mechanism(s) underlying the impaired
leukemogenic potential of SH3 BCR/ABL-transfected cells appears to
involve changes in the adhesion and motility of these cells. The
correlation of this phenotype with lack of 2 integrin expression
suggests a possible causative effect associated with disruption of
signals generated by SH3-dependent protein-protein interactions.
| |
FOOTNOTES |
Submitted June 9, 1997;
accepted September 4, 1997.
Supported in part by a grant from the Elsa U. Pardee Foundation (T.S.)
and a grant (DHP-3D) from the American Cancer Society (B.C.).
Address reprint requests to Tomasz Skorski, MD, PhD, or Bruno
Calabretta, MD, Kimmel Cancer Institute, Jefferson Medical
College, BLSB 630, 233 S 10th St, Philadelphia, PA 19107.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section 1734 solely
to indicate this fact.
| |
REFERENCES |
1.
Shtivelman E,
Lifshitz B,
Gale RP,
Roe BA,
Canaani E:
Fused transcript of abl and bcr genes in chronic myelogenous leukemia.
Nature
315:550,
1985
2.
Clark SS,
McLaughlin J,
Timmonis M,
Pendergast AM,
Ben-Neriah Y,
Dow L,
Rovera G,
Smith SD,
Witte ON:
Expression of a distinctive bcr-abl oncogene in Ph1-positive acute lymphoblastic leukemia (ALL).
Science
239:775,
1988
3.
Daley GQ,
Van Etten RA,
Baltimore D:
Induction of chronic myelogenous leukemia in mice by the p210bcr/abl gene of the Philadelphia chromosome.
Science
247:824,
1990
4.
Heisterkamp N,
Jenster G,
ten Hoeve J,
Zovich D,
Pattengale PK,
Groffen J:
Acute leukemia in bcr/abl transgenic mice.
Nature
344:351,
1990
5.
Szczylik C,
Skorski T,
Nicolaides NC,
Manzella L,
Malaguarnera L,
Venturelli D,
Gewirtz AM,
Calabretta B:
Selective inhibition of leukemia cell proliferation by BCR-ABL antisense oligodeoxynucleotides.
Science
253:562,
1991
6.
Dhut S,
Champlin T,
Young BD:
BCR/ABL and ABL proteins: Biochemical characterization and localization.
Leukemia
4:745,
1990
7.
Goga A,
McLaughlin J,
Afar DEH,
Saffran DC,
Witte ON:
Alternative signals to RAS for hematopoietic transformation by the BCR-ABL oncogene.
Cell
82:981,
1995
8.
Cortez D,
Kadlec L,
Pendergast AM:
Structural and signaling requirements for BCR-ABL-mediated transformation and inhibition of apoptosis.
Mol Cell Biol
15:5531,
1995
9.
Afar DEH,
Goga A,
McLaughlin J,
Witte ON,
Sawyers CL:
Differential complementation of Bcr-Abl point mutants with c-Myc.
Science
264:424,
1994
10.
Sanchez-Garcia I,
Grutz G:
Tumorigenic activity of the BCR-ABL oncogenes is mediated by BCL2.
Proc Natl Acad Sci USA
92:5287,
1995
11.
Sirard C,
Laneuville P,
Dick JE:
Expression of bcr-abl abrogates factor-dependent growth of human hematopoietic MO7e cells by an autocrine mechanism.
Blood
83:1575,
1994
12.
Gordon MY,
Dowding CR,
Riley GP,
Goldman JH,
Greaves MF:
Altered adhesive interactions with marrow stroma of hematopoietic progenitor cells in chronic myeloid leukemia.
Nature
328:342,
1987
13.
Verfaillie CM,
McCarthy JB,
McGlave PB:
Mechanisms underlying abnormal trafficking of malignant progenitors in chronic myelogenous leukemia.
J Clin Invest
90:1232,
1992
14.
Muller AJ,
Young JC,
Pendergast AM,
Pondel M,
Landau NR,
Littman DR,
Witte ON:
BCR first exon sequences specifically activate the BCR/ABL tyrosine kinase oncogene of Philadelphia chromosome-positive human leukemias.
Mol Cell Biol
11:1785,
1991
15.
Pendergast AM,
Muller AJ,
Havlik MH,
Maru Y,
Witte ON:
BCR sequences essential for transformation by the BCR-ABL oncogene bind to the ABL SH2 regulatory domain in a non-phosphotyrosine-dependent manner.
Cell
66:161,
1991
16.
Pendergast AM,
Gishizky ML,
Havlik MH,
Witte ON:
SH1 domain autophosphorylation of p210 BCR/ABL is required for transformation but not growth factor independence.
Mol Cell Biol
13:1728,
1993
17.
Reuther GW,
Fu H,
Cripe LD,
Collier RJ,
Pendergast AM:
Association of the protein kinases c-Bcr and Bcr-Abl with proteins of the 14-3-3 family.
Science
266:129,
1994
18.
Oda T,
Tamura T,
Griffin JD,
Druker BJ:
The SH2 domain of ABL is not required for factor-independent growth induced by BCR-ABL in a murine myeloid cell line.
Leukemia
9:295,
1995
19.
Ilaria RL,
Van Etten RA:
The SH2 domain of p210BCR/ABL is not required for the transformation of hematopoietic factor-dependent cells.
Blood
86:3897,
1995
20.
Skorski T,
Kanakaraj P,
De-Hui K,
Nieborowska-Skorska M,
Canaani E,
Zon G,
Perussia B,
Calabretta B:
Negative regulation of p120GAP GTPase promoting activity by p210Bcr-Abl: Implication for RAS-dependent Philadelphia chromosome positive cell growth.
J Exp Med
179:1855,
1994
21.
Sawyers CL,
McLaughlin J,
Witte ON:
Genetic requirement for RAS in the transformation of fibroblasts and hematopoietic cells by the BCR/ABL oncogene.
J Exp Med
181:307,
1995
22.
Skorski T,
Kanakaraj P,
Nieborowska-Skorska M,
Ratajczak MZ,
Wen SC,
Zon G,
Gewirtz AM,
Perussia B,
Calabretta B:
Phosphatidylinositol-3 kinase activity is regulated by BCR/ABL and is required for the growth of Philadelphia chromosome-positive cells.
Blood
86:726,
1995
23.
Skorski T,
Nieborowska-Skorska M,
Szczylik C,
Kanakaraj P,
Perrotti D,
Zon G,
Gewirtz AM,
Perussia B,
Calabretta B:
c-RAF-1 serine/threonine kinase is required in BCR/ABL-dependent and normal hematopoiesis.
Cancer Res
55:2275,
1995
24.
Sawyers CL,
Callahan W,
Witte ON:
Dominant negative MYC blocks transformation by ABL oncogenes.
Cell
70:901,
1992
25.
Afar DEH,
McLaughlin J,
Sherr CJ,
Witte ON,
Roussel MF:
Signaling by ABL oncogenes through cyclin D1.
Proc Natl Acad Sci USA
92:9540,
1995
26.
Mandanas RA,
Boswell HS,
Lu L,
Leibowitz D:
BCR/ABL confers growth factor independence upon a myeloid cell line.
Leukemia
6:769,
1992
27.
Bedi A,
Zehnbauer BA,
Barber JP,
Sharkis SJ,
Jones RJ:
Inhibition of apoptosis by BCR-ABL in chronic myeloid leukemia.
Blood
83:2038,
1994
28.
Lugo TG,
Pendergast AM,
Muller AJ,
Witte ON:
Tyrosine kinase activity and transformation potency of bcr/abl oncogene products.
Science
247:1079,
1990
29.
Van Etten RA,
Jackson P,
Baltimore D:
The mouse type IV c-abl gene product is a nuclear protein, and activation of transforming ability is associated with cytoplasmic localization.
Cell
58:669,
1989
30.
Valtieri M,
Tweardy DJ,
Caracciolo D,
Johnson K,
Mavilio F,
Altman S,
Santoli D,
Rovera G:
Cytokine-dependent granulocytic differentiation. Regulation of proliferative and differentiative responses in a murine progenitor cell line.
J Immunol
138:3829,
1987
31.
Skorski T,
Nieborowska-Skorska M,
Wlodarski P,
Perrotti D,
Martinez R,
Wasik MA,
Calabretta B:
Blastic transformation of p53-deficient bone marrow cells by p210bcr/abl tyrosine kinase.
Proc Natl Acad Sci USA
93:13137,
1996
32.
Thomas SM,
DeMarco M,
D'Arcangelo G,
Hagelogua S,
Brugge JS:
Ras is essential for nerve growth factor- and phorbol ester-induced tyrosine phosphorylation of MAP kinases.
Cell
68:1031,
1992
33.
Hibi T,
Lin A,
Smeal T,
Minden A,
Karin M:
Identification of an oncoprotein- and UV- responsive protein kinase that binds and potentiates the c-Jun activation domain.
Genes Dev
7:2135,
1993
34.
Chomczynski P,
Sacchi N:
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156,
1987
35.
Skorski T,
Nieborowska-Skorska M,
Wlodarski P,
Zon G,
Iozzo RV,
Calabretta B:
Antisense oligodeoxynucleotide combination therapy of primary chronic myelogenous leukemia blast crisis in SCID mice.
Blood
88:1005,
1996
36.
Habets GGM,
Schottes EHM,
Zuydgeest D,
van der Kammen RA,
Starn JC,
Berns A,
Collard JG:
Identification of an invasion-inducing gene, Tiam-1, that encodes a protein with homology to GDP-GTP exchangers for Rho-like proteins.
Cell
77:537,
1994
37.
Braselman S,
McCormick F:
BCR and RAF form a complex in vivo via 14-3-3 proteins.
EMBO J
14:4839,
1995
38.
Gishizki ML,
Witte ON:
Initiation of deregulated growth of multipotent progenitor cells by bcr-abl in vitro.
Science
256:836,
1992
39.
Skorski T,
Nieborowska-Skorska M,
Barletta C,
Malaguarnera L,
Szczylik C,
Chen S-T,
Lange B,
Calabretta B:
Highly efficient elimination of Philadelphia1 leukemic cells by exposure to bcr/abl antisense oligodeoxynucleotides combined with mafosfamide.
J Clin Invest
92:194,
1993
40.
Van Etten RA,
Debnaith J,
Zhou H,
Casasnovas JM:
Introduction of a loss-of-function point mutation from the SH3 region of the Caenorhabditis elegans sem-5 gene activates the transforming ability of c-abl in vivo and abolishes binding of proline-rich ligands in vitro.
Oncogene
10:1977,
1995
41.
Kaplan KB,
Bibbins KB,
Swedlow JR,
Arnaud M,
Morgan DO,
Varmus HE:
Association of the amino-terminal half of c-Src with focal adhesions alters their properties and is regulated by phosphorylation of tyrosine 527.
EMBO J
13:4745,
1994
42.
Weng Z,
Rickles RJ,
Feng S,
Richard S,
Shaw AS,
Schreiber SL,
Brugge JS:
Structure-function analysis of SH3 domains: SH3 binding specificity altered by single amino acid substitutions.
Mol Cell Biol
15:5627,
1995
43.
Koch CA,
Anderson D,
Moran MF,
Ellis C,
Pawson T:
SH2 and SH3 domains: Elements that control interactions of cytoplasmic signalling proteins.
Science
252:668,
1991
44.
Liu X,
Marengere LEM,
Koch CA,
Pawson T:
The v-src SH3 domain binds phosphatidylinositol 3-kinase.
Mol Cell Biol
13:5225,
1993
45.
Pleiman CM,
Hertz WM,
Cambier JC:
Activation of phosphatidyl-inositol-3 kinase by src-family kinase SH3 binding to the p85 subunit.
Science
263:1609,
1994
46.
Bergold PJ,
Blumenthal JA,
Andrea ED,
Snyder HW,
Lederman L,
Silverstone A,
Nguyen H,
Besmer P:
Nucleic acid sequence and onco-genic properties of the HZ2 Feline sarcoma virus v-abl insert.
J Virol
61:1193,
1987
47.
Goga A,
McLaughlin J,
Pendergast AM,
Parmar K,
Muller A,
Rosenberg N,
Witte ON:
Oncogenic activation of c-ABL by mutation within its last exon.
Mol Cell Biol
13:4967,
1993
48.
Shtivelman E,
Lifshitz B,
Gale RP,
Roe BA,
Canaani E:
Alternative splicing of RNAs transcribed from the human abl gene and from bcr-abl fused gene.
Cell
47:277,
1986
49.
Puil L,
Liu J,
Gish G,
Mbamalu G,
Bowtell D,
Pelicci PG,
Arlinghaus R,
Pawson T:
Bcr-Abl oncoproteins bind directly to activators of the Ras signalling pathway.
EMBO J
13:764,
1994
50.
Tauchi T,
Boswell HS,
Leibowitz D,
Broxmeyer HE:
Coupling between p210bcr-abl and Shc and Grb2 adaptor proteins in hematopoietic cells permits growth factor receptor-independent link to Ras activation pathway.
J Exp Med
179:167,
1994
51.
Varticovski L,
Daley GQ,
Jackson P,
Baltimore D,
Cantley L:
Activation of phosphatidylinositol 3-kinase in cells expressing abl oncogene variants.
Mol Cell Biol
11:1107,
1991
52.
Raitano AB,
Halpern JR,
Hambuch TM,
Sawyers CL:
The Bcr-Abl leukemia oncogene activates Jun kinase and requires Jun for transformation.
Proc Natl Acad Sci USA
92:11746,
1995
53.
Kabarowski JHS,
Allen PB,
Wiedermann LM:
A temperature sensitive p210 BCR-ABL mutant defines the primary consequences of BCR-ABL tyrosine kinase expression in growth factor dependent cells.
EMBO J
13:5887,
1994
54.
Carlesso N,
Frank DA,
Griffin JD:
Tyrosyl phosphorylation and DNA binding activity of signal transducers and activators of transcription (STAT) proteins in hematopoietic cell lines transformed by Bcr/Abl.
J Exp Med
183:811,
1995
55.
Hynes RO:
Integrins: Versatility, modulation, and signaling in cell adhesion.
Cell
69:11,
1992
56.
Cicchetti P,
Mayer BJ,
Thiel G,
Baltimore D:
Identification of a protein that binds to the SH3 region of Abl and is similar to Bcr and GAP-rho.
Science
257:803,
1992
57.
Shi Y,
Alin K,
Goff SP:
Abl-interactor-1, a novel SH3 protein binding to the carboxy-terminal portion of the Abl protein, suppresses v-abl transforming activity.
Genes Dev
9:2583,
1995
58.
Dai Z,
Pendergast AM:
Abl-2, a novel SH3-containing protein, interacts with the c-Abl tyrosine kinase and modulates c-Abl transforming activity.
Genes Dev
9:2569,
1995
59.
Zhu J,
Shore SK:
c-Abl tyrosine kinase activity is regulated by association with a novel SH3-domain-binding protein.
Mol Cell Biol
16:7054,
1996
60.
Afar DEH,
Han L,
McLaughlin J,
Wong S,
Dhaka A,
Parmar K,
Rosenberg N,
Witte ON,
Colicelli J:
Regulation of the oncogenic activity of BCR-ABL by a tightly bound substrate protein RIN1.
Immunity
6:773,
1997
61. Wen S-T, VanEtten RA: The product of the PAG gene is an Abl
SH3-binding protein and a physiological inhibitor of c-Abl tyrosine
kinase activity. Genes Dev (in press)
62.
Anderson SM,
Mladenovic JM:
The BCR/ABL oncogene requires both kinase activity and src-homology 2 domain to induce cytokine secretion.
Blood
87:238,
1996
63.
Drubin DG,
Mulholland J,
Zhu Z,
Botstein D:
Homology of a yeast actin-binding protein to signal transduction proteins and myosin-1.
Nature
343:288,
1990
64.
Musacchio A,
Gibson T,
Lehto VP,
Saraste M:
SH3 An abundant protein domain in search of a function.
FEBS Lett
307:55,
1992
65.
Pawson T,
Gish G:
SH2 and SH3 domains: From structure to function.
Cell
71:359,
1992
66.
Schlaepfer DD,
Hanks SK,
Hunter T,
van der Geer P:
Integrin-mediated signal transduction linked to Ras pathway by GRB2 binding to focal adhesion kinase.
Nature
372:786,
1994
67.
Salgia R,
Brunkhorst B,
Pesick E,
Li J-L,
Lo S-H,
Chen LB,
Griffin JD:
Increased tyrosine phosphorylation of focal adhesion proteins in myeloid cell lines expressing p210bcr/abl.
Oncogene
11:1149,
1995
68.
Clark EA,
Brugge JS:
Integrins and signal transduction pathways: The road taken.
Science
268:233,
1995
69.
Wary KK,
Mainiero F,
Isakoff SJ,
Marcantonio EE,
Giancotti FG:
The adaptor protein Shc couples a class of integrins to the control of cell cycle progression.
Cell
87:733,
1996
70.
Erpel T,
Superti-Furga G,
Courtneidge SA:
Mutational analysis of the Src SH3 domain: The same residues of the ligand binding surface are important for intra- and intermolecular interactions.
EMBO J
14:963,
1995
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
N. Jinawath, A. Norris-Kirby, B. D. Smith, C. D. Gocke, D. A. Batista, C. A. Griffin, and K. M. Murphy
A Rare e14a3 (b3a3) BCR-ABL Fusion Transcript in Chronic Myeloid Leukemia: Diagnostic Challenges in Clinical Laboratory Practice
J. Mol. Diagn.,
July 1, 2009;
11(4):
359 - 363.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
W. Yu, X. Sun, N. Clough, E. Cobos, Y. Tao, and Z. Dai
Abi1 gene silencing by short hairpin RNA impairs Bcr-Abl-induced cell adhesion and migration in vitro and leukemogenesis in vivo
Carcinogenesis,
September 1, 2008;
29(9):
1717 - 1724.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Scheich, J. Duyster, C. Peschel, and H. Bernhard
The immunogenicity of Bcr-Abl expressing dendritic cells is dependent on the Bcr-Abl kinase activity and dominated by Bcr-Abl regulated antigens
Blood,
October 1, 2007;
110(7):
2556 - 2560.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Li, N. Clough, X. Sun, W. Yu, B. L. Abbott, C. J. Hogan, and Z. Dai
Bcr-Abl induces abnormal cytoskeleton remodeling, beta1 integrin clustering and increased cell adhesion to fibronectin through the Abl interactor 1 pathway
J. Cell Sci.,
April 15, 2007;
120(8):
1436 - 1446.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Srinivasan and R. Plattner
Activation of Abl Tyrosine Kinases Promotes Invasion of Aggressive Breast Cancer Cells
Cancer Res.,
June 1, 2006;
66(11):
5648 - 5655.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Nieborowska-Skorska, G. Hoser, L. Rink, M. Malecki, P. Kossev, M. A. Wasik, and T. Skorski
Id1 transcription inhibitor-matrix metalloproteinase 9 axis enhances invasiveness of the breakpoint cluster region/abelson tyrosine kinase-transformed leukemia cells.
Cancer Res.,
April 15, 2006;
66(8):
4108 - 4116.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Notari, P. Neviani, R. Santhanam, B. W. Blaser, J.-S. Chang, A. Galietta, A. E. Willis, D. C. Roy, M. A. Caligiuri, G. Marcucci, et al.
A MAPK/HNRPK pathway controls BCR/ABL oncogenic potential by regulating MYC mRNA translation
Blood,
March 15, 2006;
107(6):
2507 - 2516.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S.-y. Ren, E. Bolton, M. G. Mohi, A. Morrione, B. G. Neel, and T. Skorski
Phosphatidylinositol 3-Kinase p85{alpha} Subunit-Dependent Interaction with BCR/ABL-Related Fusion Tyrosine Kinases: Molecular Mechanisms and Biological Consequences
Mol. Cell. Biol.,
September 15, 2005;
25(18):
8001 - 8008.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Deutsch, S. Jarrousse, D. Buet, A. Dugray, M.-L. Bonnet, M.-C. Vozenin-Brotons, F. Guilhot, A. G. Turhan, J. Feunteun, and J. Bourhis
Down-regulation of BRCA1 in BCR-ABL-expressing hematopoietic cells
Blood,
June 1, 2003;
101(11):
4583 - 4588.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. J. Schreiner, A. P. Schiavone, and T. E. Smithgall
Activation of STAT3 by the Src Family Kinase Hck Requires a Functional SH3 Domain
J. Biol. Chem.,
November 15, 2002;
277(47):
45680 - 45687.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H.-K. Al-Ali, S. Leiblein, I. Kovacs, E. Hennig, D. Niederwieser, and M. W. N. Deininger
CML with an e1a3 BCR-ABL fusion: rare, benign, and a potential diagnostic pitfall
Blood,
July 18, 2002;
100(3):
1092 - 1093.
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Tiribelli, A. Tonso, D. Ferrero, A. Parziale, G. R. Cambrin, P. Scaravaglio, D. Cilloni, E. Gottardi, and G. Saglio
Lack of SH3 domain does not imply a more severe clinical course in Ph+ chronic myeloid leukemia patients
Blood,
June 15, 2000;
95(12):
4019 - 4020.
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Horita, E. J. Andreu, A. Benito, C. Arbona, C. Sanz, I. Benet, F. Prosper, and J. L. Fernandez-Luna
Blockade of the Bcr-Abl Kinase Activity Induces Apoptosis of Chronic Myelogenous Leukemia Cells by Suppressing Signal Transducer and Activator of Transcription 5-Dependent Expression of Bcl-XL
J. Exp. Med.,
March 20, 2000;
191(6):
977 - 984.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Sillaber, F. Gesbert, D. A. Frank, M. Sattler, and J. D. Griffin
STAT5 activation contributes to growth and viability in Bcr/Abl-transformed cells
Blood,
March 15, 2000;
95(6):
2118 - 2125.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Ghaffari, H. Wu, M. Gerlach, Y. Han, H. F. Lodish, and G. Q. Daley
BCR-ABL and v-SRC tyrosine kinase oncoproteins support normal erythroid development in erythropoietin receptor-deficient progenitor cells
PNAS,
November 9, 1999;
96(23):
13186 - 13190.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. W. Gross, X. Zhang, and R. Ren
Bcr-Abl with an SH3 Deletion Retains the Ability To Induce a Myeloproliferative Disease in Mice, yet c-Abl Activated by an SH3 Deletion Induces Only Lymphoid Malignancy
Mol. Cell. Biol.,
October 1, 1999;
19(10):
6918 - 6928.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Plattner, L. Kadlec, K. A. DeMali, A. Kazlauskas, and A. M. Pendergast
c-Abl is activated by growth factors and Src family kinases and has a role in the cellular response to PDGF
Genes & Dev.,
September 15, 1999;
13(18):
2400 - 2411.
[Abstract]
[Full Text]
|
|
|
|
|
|
|
M. Nieborowska-Skorska, M. A. Wasik, A. Slupianek, P. Salomoni, T. Kitamura, B. Calabretta, and T. Skorski
Signal Transducer and Activator of Transcription (STAT)5 Activation by BCR/ABL Is Dependent on Intact Src Homology (SH)3 and SH2 Domains of BCR/ABL and Is Required for Leukemogenesis
J. Exp. Med.,
April 19, 1999;
189(8):
1229 - 1242.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Okuda, A. D'Andrea, R.A. Van Etten, and J.D. Griffin
The C-Terminus of c-Abl Is Required for Proliferation and Viability Signaling in a c-Abl/Erythropoietin Receptor Fusion Protein
Blood,
November 15, 1998;
92(10):
3848 - 3856.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Skorski, P. Wlodarski, L. Daheron, P. Salomoni, M. Nieborowska-Skorska, M. Majewski, M. Wasik, and B. Calabretta
BCR/ABL-mediated leukemogenesis requires the activity of the small GTP-binding protein Rac
PNAS,
September 29, 1998;
95(20):
11858 - 11862.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract