|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 2 (January 15), 1998:
pp. 561-569
The Upregulation of p27Kip1 by Rapamycin Results in G1
Arrest in Exponentially Growing T-Cell Lines
By
Shin Kawamata,
Hitoshi Sakaida,
Toshiyuki Hori,
Michiyuki Maeda, and
Takashi Uchiyama
From the Institute for Virus Research, Chest Disease Research
Institute, Kyoto University, Kyoto, Japan.
 |
ABSTRACT |
An immunosuppressant Rapamycin (Rap) has been reported to cause G1
arrest by inhibiting p70 S6 kinase and G1 cyclin/cdks kinase activities
when added to quiescent cells with mitogens. However, antiproliferative
effects of Rap on exponentially growing cells have been poorly
investigated. We examined the intracellular events after the treatment
of Rap in exponentially growing T cells and found that Rap upregulated
a cdks inhibitor, p27Kip1 at both mRNA and protein levels
in Rap-sensitive cells. Antiproliferative effect of Rap was mainly
ascribed to the inhibition of cyclin E/cdk2 kinase activity through the
formation of cyclin E/cdk2-p27Kip1 complex rather than
inhibition of p70 S6 kinase activity. Furthermore, we showed that
Rap-sensitive cells with elevated p27Kip1 expression lost
sensitivity to Rap when antisense p27Kip1 was introduced,
which indicates that the basal level of p27Kip1 is one of
the limiting factors that determine the sensitivity to Rap in already
cycling cells. These data suggest the presence of a putative threshold
level of p27Kip1 at late G1 phase in already cycling cells.
Rap may cause G1 arrest by upregulating the amount of
p27Kip1 beyond the threshold in some Rap-sensitive cells
that are exponentially growing.
 |
INTRODUCTION |
RAPAMYCIN (Rap) EXERTS antiproliferative
effect by forming the complex with an intracellular protein FKBP12.
Rap-FKBP12 interacts with FRAP (also known as RAFT), a human homologue
of the target molecule of Rap (TOR) in yeast and inhibits FRAP activity
that is required for the activation of p70 S6 kinase.1-7
Although FRAP itself is not a mitogen-activated p70 S6 kinase kinase,
the Rap-FKBP12-FRAP complex selectively inhibits the mitogen-induced p70 S6 kinase activation without disrupting other known
pathways.8-13
The mitogen-stimulated signaling pathways also involve a sequential
regulation of the cell cycle-related molecules such as the elimination
of cdks inhibitor p27Kip1, the increment of
p21Waf1 and the activation of kinase activity of the G1
cyclin/cdks complexes that may phosphorylate Rb protein when quiescent
cells enter into the cell cycling.14-17 Rap has also been
reported to exert its antiproliferative effect by affecting these
molecules in G1 phase. Rap blocks the elimination of cdks inhibitor
p27Kip1,14 and inactivates the kinase activity
of the G1cyclin/cdks complex by facilitating the formation of the
G1cyclin/cdks-p27Kip1 complex.15-25 The
continuous elimination of p27Kip1, which is reported to be
mediated by the ubiquitin-dependent degradation26,27 is
observed throughout G1 phase when quiescent cells enter into the cell
cycling in response to mitogenic stimuli. However, the mechanism of how
Rap blocks the elimination of p27Kip1 remains to be
elucidated. Furthermore, with our limited knowledge about the mechanism
of G1 cell cycle progression, we cannot even tell whether the
inhibition of p70 S6 kinase and the inhibition of G1 cyclin/cdks kinase
activities occur serially or independently after the treatment of Rap.
Most of our knowledge about the effects of Rap has been provided by
previous studies that focused on the events in G1 phase when quiescent
cells were incubated with Rap and mitogens, while the mechanism of the
antiproliferative effect of Rap on exponentially growing cells has been
poorly investigated. The G1 cell cycle events of exponentially growing
cells that skip a putative G0/G1 transition may differ from that of the
cells leaving the quiescent state and entering into the cell cycling in
response to mitogenic stimuli. It is, therefore, possible that Rap may
use different mechanisms to exert its antiproliferative effect
depending on the cell cycling status. In addition, Rap does not always
exert an antiproliferative effect on exponentially growing cells, which provides us with the ground to postulate the factor(s) that may determine the sensitivity of exponentially growing cells to Rap.
To address these issues, we examined the antiproliferative effect of
Rap on various T-cell lines that were growing exponentially, comparing
with the previous findings on the cells leaving the quiescent state in
response to mitogenic stimuli. We found that Rap upregulated
p27Kip1 at both mRNA and protein levels and caused G1
arrest in Rap-sensitive cells. Based on the correlation between the
intracellular protein level of p27Kip1 and the sensitivity
to Rap, a possible mechanism of the antiproliferative effect of Rap on
exponentially growing T cells will be discussed.
 |
MATERIALS AND METHODS |
Cells and culture conditions.
Kit225, a human interleukin (IL)-2 dependent CD4-positive T-cell
line,28 was cultured in RPMI 1640 medium (GIBCO, Grand Island, NY) supplemented with 10% fetal calf serum (FCS) (Summit, Monfort, Ft. Collins, CO), 60 mmol/L tobramycin, 2 mmol/L L-glutamine, and 0.5 nmol/L recombinant human IL-2 (rIL-2, a gift of Shionogi Research Laboratories, Osaka, Japan). Kit225 cells were synchronized in
quiescent state by rIL-2 depletion for 48 hours. The cells entered into
the cell cycling in response to 2 nmol/L rIL-2. ED-40515( ) is a
human T-cell leukemia virus (HTLV)-I-infected IL-2 independent T-cell
line established from a patient with adult T-cell leukemia (ATL).29,30 TL-Oml,31 MJ,32 and
MT-233 are HTLV-I-infected T-cell lines previously
described. ED-40515( ), TL-Oml, MJ, Molt4, HSB-2, HPB-ALL, and Jurkat
cells were cultured in RPMI 1640 medium supplemented with
10% FCS, 60 mmol/L tobramycin and 2 mmol/L L-glutamine.
Cell proliferation assay.
Cell proliferation was measured by tritium-thymidine
([3H]thymidine) incorporation into DNA. After 48 hours
depletion of IL-2, Kit225 cells were plated into a 96 well-flat-bottomed plate at 1 × 104 cells/100 µL/well
and cultured with 2 nmol/L IL-2 at 37°C in 5% CO2 for 48 hours. A total of 10 nmol/L Rap was added at the indicated time and 0.5 µCi of [3H]thymidine (Dupont/NEN Research Products,
Boston, MA) was added to each well 6 hours before the harvest of the
culture. Incorporation of [3H]thymidine was measured by
liquid scintillation counting. For cell proliferation assay of
exponentially growing T-cell lines, cells were kept in exponentially
growing phase by changing the medium (RPMI 1640 plus 10% FCS) every 2 to 3 days and 8 hours before the assay. Cell proliferation with or
without 10 nmol/L Rap was examined as described above.
Cell cycle analysis.
Cells were harvested and washed twice with ice-cold phosphate-buffered
saline (PBS) containing 0.1% glucose. Cells were then fixed with 70%
ethanol for 1 hour and resuspended in acridine orange solution (50 µmol/L acridine orange in PBS/0.1% glucose) for 1 hour at room
temperature.34 DNA content analysis was performed by a
FACScan with LYSIS II and Cell Quest softwares (Becton Dickinson, San
Jose, CA).
Immunoprecipitation.
Cell lysates from 5 × 106 cells were prepared by lysing
the cells in 100 µL of lysing buffer (25 mmol/L HEPES [pH 7.4],
0.15 mol/L NaCl, 0.5% Triton-X, 1 mmol/L phenylmethylsulfonyl fluoride [PMSF], 1 mmol/L MgCl2, 10% glycerol, 1 mmol/L EDTA, 20 µg/mL TPCK, 20 µg/mL soybeans trypsin-inhibitor, 10 µg/mL
leupeptin). The cell extracts were incubated with polyclonal
anti-cyclin E antibody (Santa Cruz Biotechnology, Inc,
Santa Cruz, CA), anti-cyclin D3 antibody (Santa Cruz), or
anti-cdk4 antibody (Santa Cruz), and 20 µL of Protein A Sepharose 4 fast flow beads (Pharmacia Biotech, Uppsala, Sweden) for 2 hours at
4°C. The immunoprecipitates were subjected to immunoblotting with
anti-p27Kip1 antibody (Santa Cruz).
Immunoblotting.
Cell lysates containing 40 µg of soluble protein or
immunoprecipitates were separated by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) with 10% or
12.5% gel (ATTO, Tokyo, Japan). The samples were
transferred to 0.45 µm polyvinylidene difluoride (PVDF) filters
(Millipore Corp, Bedford, MA) with a semidry apparatus. The filters
were incubated with 10% bovine serum albumin (BSA) blocking buffer for
5 hours followed by diluted antibody (anti-p27Kip1 antibody
[Santa Cruz], anti-p21Waf1 antibody [Santa Cruz],
anti-cyclin E antibody [Santa Cruz], or anti-cyclin A antibody
[Upstate Biotechnology Incorporated, Lake Placid, NY]) for 1 hour.
The immunoblots were visualized by ECL detection system
(Amersham Life Science, Arlington Heights, IL).
Time course study of [35S]methionine-labeled
p27Kip1.
Exponentially growing ED-40515( ) cells were harvested and cultured
with methionine-free RPMI 1640 medium (GIBCO) for 30 minutes and
labeled with 150 µCi/mL of [35S]methionine (Dupont/NEN)
for 45 minutes at the indicated points (0, 24, 48 hours of the
culture). The cells were harvested again for lysis in hypotonic buffer
(1 mol/L Tris-HCl [pH 7.9], 1 mol/L KCl, 1 mol/L
MgCl2, 1 mmol/L dithiothreitol [DTT], 1 mmol/L PMSF). The
half-life of p27Kip1 at 28 hours of the culture was
evaluated by labeling the cells with [35S]methionine as
stated above. The cells were placed in full medium to chase the
metabolic labeling and harvested at the indicated times. The lysates
were incubated with anti-p27Kip1 antibody (Santa Cruz) and
Protein A Sepharose 4 fast flow (Pharmacia). The immunoprecipitates
were separated by SDS-PAGE with 12.5% gel. The radioactive signals
associated with the p27Kip1 band were measured by a
phosphorimager, BIO-IMAGE ANALYZER BAS 2000 (FujiX, Minamiashigara,
Kanagawa, Japan).
Kinase assay.
Histone H1 kinase assay was performed as described
previously.23 Cell lysates for histone H1 kinase assay were
prepared by lysing 4 × 106 cells in 100 µL of H1 lysing
buffer (50 mmol/L Tris-HCl [pH 7.5], 0.25 mol/L NaCl,
0.5% Nonidet P-40, 1 mmol/L PMSF, 1 mmol/L
Na3VO4, 20 µg/mL N-Tosyl-phenylalanine
chloromethyl ketone [TPCK], 20 µg/mL soybeans trypsin-chymotrypsin
inhibitor, 10 µg/mL leupeptin). The cell extracts were incubated with
anti-cdk2 antibody (Santa Cruz), anti-cyclin E antibody (Santa Cruz),
or anti-cyclin A antibody (UBI) and 20 µL of Protein A-Sepharose 4 fast flow beads for 2 hours at 4°C. Immunoprecipitates were then
washed twice with buffer containing 50 mmol/L Tris-HCl (pH7.5), 30 mmol/L Na4P2O7, 50 mmol/L NaF, 5 mmol/L EDTA (pH7.0), 5% wt/vol glycerol, 0.5% Triton X-100, 1 mmol/L
DTT, 10 µg/mL leupeptin, 5 µg/mL aprotinin, and 10 mmol/L -glycerophosphate, followed by washes two times with kinase buffer (50 mmol/L HEPES [pH 7.0], 10 mmol/L -glycerphosphate, 5 mmol/L MgCl2, 10 µg/mL leupeptin, and 1 mmol/L DTT). Histone
phosphrylation was initiated by the addition of 40 µL kinase buffer
containing 0.6 mg/mL calf thymus histone type III-S (Sigma Chemical Co,
St Louis, MO) and 10 µCi of [ -32P] adenosine
triphosphate (ATP) (Amersham). After a 30-minute incubation at 37°C,
phosphorylation reaction was terminated by adding 20 µL of 250 mmol/L
ice-cold EDTA (pH 8.0). The triplicate aliquots of each sample were
spotted onto phosphocellulose paper (Whatman International Ltd,
Maidstone, UK). The paper was immersed briefly in 1%
H3PO4 solution containing 10 mmol/L
Na4P2O7. After three additional
15-minute washes in H3PO4, the radioactivity incorporated into the filter-bound histone was measured by liquid scintillation counting.
Specific activity of p70 S6 kinase was determined by 32P
incorporation into S6 synthetic peptide (AKRRRLSSLRA, [UBI]). Cell extracts prepared as above were incubated with anti-p70 S6 kinase antibody (UBI) and 20 µL of protein A sepharose 4 fast flow beads. Kinase assay of the immunocomplex was performed suspending the beads in
40 µL of kinase buffer (20 mmol/L Tris-HCl [pH 7.5], 10 mmol/L MgCl
2, 10 mmol/L MgCl 2, 0.1 mg/mL BSA, 0.4 mmol/L DTT) containing 50 µmol/L ATP, 10 µCi of
[ -32P]ATP, 125 µmol/L S6 peptide. After a 20-minute
incubation at 30°C, phosphorylation reaction was terminated by adding
20 µL of 250 mmol/L ice-cold EDTA (pH 8.0). The triplicate aliquots of each sample were spotted onto phosphocellulose paper. The
radioactivity was measured by liquid scintillation counting.
pRB phosphorylation assay was determined by 32P
incorporation into glutathione S-transferase-pRb (GST-pRb;
corresponding to amino acid 769-921 [Santa Cruz]).35 Cell
extracts prepared as above were incubated with anti-cdk4 antibody,
anti-cdk6 antibody, anti-cyclin D1 antibody, anti-cyclin
D2 antibody, or anti-cyclin D3 antibody (Santa
Cruz). Kinase assay of the immunocomplex was performed by suspending
the beads in 40 µL of kinase buffer containing 0.2 µg of GST-Rb,
2.5 mmol/L EGTA, 20 µmol/L ATP, and 10 µCi of [ -32P]ATP. The triplicate aliquots of each sample were
incubated for 20 minutes at 30°C, denatured in SDS sample buffer, and
analyzed by SDS-PAGE with 10% gel. The radioactive signals associated
with GST-pRb protein were measured by liquid scintillation of the
excised bands.
Northern blotting.
Total cellular RNA was isolated from 1 × 107 cells by the
acid-guanidium thiocyanate-phenol-chloroform method. A total of 10 µg
of total RNA was fractionated by electrophoresis through 1% agarose/formaldehyde denaturing gel and transferred to Hybond-N membrane (Amersham). The membranes were hybridized with
32P-labeled probes. Human -actin cDNA probe (Clontech,
Palo Alto, CA) was used as control. For the detection of
p27Kip1 mRNA by Northern blotting, p27Kip1 cDNA
probe was generated by the reverse transcriptase-PCR (RT-PCR) method.
BamH I site-tagged oligonucleotides covering the entire coding region
of p27Kip1 and cDNA from phytohemagglutinin (PHA)
stimulated human peripheral blood mononuclear cells were used as the
primers and the template, respectively. The PCR product was inserted
into pT7Blue T-Vector (Novagen, Madison, MI). The cDNA probe of
p27Kip1 was obtained by digesting with BamH I. For the
detection of p21Waf1, cDNA probe was also generated by the
RT-PCR method.
Preparation of antisense or frame shifted-sense cDNA of
p27Kip1 and transfection to ED-40515( ) cells.
The BamH I site-tagged cDNA of p27Kip1 was generated by the
RT-PCR method as stated in Materials and Methods for Northern blotting. The PCR product was inserted into pBluescript II, SK(+) cloning vector
(STRATAGENE, La Jolla, CA). The construct was digested with Xho I and
Not I and ligated into expression vector pMKIT Neo (a gift from Dr
Maruyama of Tokyo Medical and Dental University) at Xho I and Not I
sites (Xho I site 3 side, Not I site 5 side) to generate pMKIT
Neo-antisense p27Kip1. The frame shifted-sense cDNA of
p27Kip1 was generated by the PCR method. Xho I site-tagged
frame shifted 5 oligonucleotide (CCTCGAGGATGTGTCAAACGTGCGAGTGTCT), Not
I site-tagged 3 oligonucleotide (TTGCGGCCGCAATTACGTTTGACGTCTTCTG) and
SK(+)-p27Kip1 were used as the primers and the template,
respectively. The PCR products were ligated into pMKIT Neo. The pMKIT
Neo-p27Kip1 constructs were transfected into ED-40515(-)
cells by the electroporation method. The total amount of transfected
vector was adjusted to 10 µg by adding a empty vector. The
transfected cells were cultured in medium containing 1 mg/mL G418
(Sigma Chemical Co) for 3 weeks (bulk culture) and subjected to
immunoblotting and proliferation assay in the presence or absence of 10 nmol/L Rap.
 |
RESULTS |
Inactivation of p70 S6 kinase by Rap is observed at any cell cycle
phase, while the antiproliferative effect of Rap is cell cycle
phase-dependent in an IL-2-dependent T-cell line Kit225.
Kit225 cells were synchronized in a quiescent state by IL-2 depletion
for 48 hours. The cells entered into the cell cycle and passed the G1/S
transition 18 hours after the addition of 2 nmol/L rIL-2.
Activation of p70 S6 kinase activity was observed within 1 hour after
the addition of 2 nmol/L rIL-2 to the cells synchronized in a quiescent
state by IL-2 depletion. Rap inhibited and reduced p70 S6 kinase
activity within 1 hour to the basal level when added at any of the time
points of 0 (concomitantly with IL-2), 6, 18, or 36 hours after the
addition of 2 nmol/L rIL-2 (Fig 1A).However, Rap failed to exhibit an antiproliferative effect when added
18 hours (more than 60% of the cells pass through G1/S transition) or
36 hours (the cells were growing exponentially) after the addition of 2 nmol/L rIL-2 (Fig 1B).

View larger version (18K):
[in this window]
[in a new window]

View larger version (16K):
[in this window]
[in a new window]
| Fig 1.
Inhibition of p70 S6 kinase (A) and suppression of cell
proliferation (B) by Rap in Kit225 cells entering into the cell cycling in response to IL-2. Kit225 cells deprived of IL-2 for 48 hours were
cultured with or without Rap in the presence of 2 nmol/L IL-2. (A) A
total of 10 nmol/L Rap was added 0 ( ), 6 ( ), 18 ( ), or 36 hours ( ) after the initiation of the culture with IL-2. As a
control, Kit225 cells were cultured with IL-2 only ( ). The cell
lysates prepared from 4 × 106 cells harvested at 0, 1, 6, 7, 18, 19, 36, and 37 hours of the culture were subjected to
immunoprecipitation with anti-p70 S6 kinase antibody. The kinase
activity of the immunoprecipitates was assayed with S6 peptide as the
substrate and was shown as [ -32P]ATP incorporation
into S6 peptide. Each point represents the average of duplicate
samples. (B) IL-2-depleted Kit225 cells were cultured with 10 nmol/L
Rap (columns 2 to 4) or without Rap (column 1) in the presence of 2 nmol/L IL-2 for 48 hours. Column 2, Rap was added concomitantly with
IL-2; column 3, at 6 hours; column 4, at 18 hours after the initiation
of the culture. The exponentially growing Kit225 cells were cultured in
the absence of Rap (column 5) or the presence of 10 nmol/L Rap (column
6) for 48 hours. The incorporation of [3H]thymidine by
cultured cells for the last 6 hours was measured. Each column
represents the means ± standard deviation (SD) of the triplicate
cultures.
|
|
Antiproliferative effect of Rap on exponentially growing T-cell lines
is cell type-specific.
Molt4, HSB-2, HPB-ALL, Jurkat, TL-Oml, MJ, MT-2, ED-40515( ) cells
were kept in exponentially growing phase by changing the condition
medium every 2 to 3 days and 8 hours before the assay. The
antiproliferative effect of Rap was evaluated by tritium-thymidine incorporation into DNA. As shown in Fig 2, Rap did not
always exert an antiproliferative effect on the growth of the
exponentially growing cell lines examined. No obvious
correlation between HTLV-I infection of the cell lines and their
sensitivity to Rap was observed. Among the cell lines we tested, the
HTLV-I-infected T-cell line, ED-40515( ) showed a relatively high
sensitivity (67% to 82% suppression in cell proliferation) to Rap.

View larger version (20K):
[in this window]
[in a new window]
| Fig 2.
Effect of Rap on the [3H]thymidine
incorporation by various T-cell lines that are exponentially growing.
HTLV-I-infected (TL-Oml, MJ, MT-2, ED-40515[ ]) or -uninfected
(Molt4, HPB-ALL, HSB-2, Jurkat) T-cell line cells kept in an
exponentially growing phase were cultured in fresh RPMI 1640 medium
containing 10% FCS at low concentrations of cells with or without 10 nmol/L Rap for 48 hours. The [3H]thymidine uptake by
cultured cells for the last 6 hours was measured. Each column
represents the means ± SD of triplicate samples. Three independent
experiments gave similar results.
|
|
Rap inhibits cdk2 kinase activity, cyclin E-dependent kinase
activity, cyclin A-dependent kinase activity, and p70 S6 kinase
activity and causes G1 arrest in exponentially growing ED-40515( )
cells.
ED-40515( ) cells in exponentially growing phase were incubated with
10 nmol/L Rap. Rap caused cell cycle arrest in G1 phase at 28 hours of
the culture (Fig 3A). Rap inhibited cdk2
kinase activity, cyclin E-dependent kinase activity, and cyclin
A-dependent kinase activity and markedly inhibited p70 S6 kinase
activity to the basal level (Fig 3B). There was no obvious correlation between the inhibition of p70 S6 kinase and the sensitivity to Rap, as
the inhibition of p70 S6 kinase was also observed in Rap-insensitive exponentially growing cells lines such as Kit225 (Fig 1A), HPB-ALL, and
HSB-2 (data not shown). Rap slightly suppressed cdk4 kinase activity
and cyclin D3-dependent kinase activity (Fig 3C). However, Rap inhibited neither cyclin D2-dependent kinase activity
nor cdk6 kinase activity (Fig 3C). The expression of cyclin D1 was not
detected by immunoblotting (data not shown).

View larger version (15K):
[in this window]
[in a new window]

View larger version (35K):
[in this window]
[in a new window]

View larger version (35K):
[in this window]
[in a new window]
| Fig 3.
Effect of Rap on the cell growth (A), cdk2 kinase
activity, p70 S6 kinase activity, cyclin E- and A-dependent kinase
activity (B), cdk4 kinase activity, cdk6 kinase activity. cyclin
D2- and D3-dependent kinase activity (C) in
exponentially growing ED-40515( ) cells. (A) ED-40515( ) cells were
incubated with or without 10 nmol/L Rap for 28 hours, then fixed with
70% ethanol for 1 hour and stained with 50 µmol/L acridine orange in
PBS/0.1% glucose for 1 hour. The relative DNA content was determined
by a flow cytometric analysis. (B) ED-40515( ) cells
(4 × 106 cells) cultured with or without 10 nmol/L Rap
for the indicated times were harvested and immunoprecipitated with
anti-cdk2 antibody, anti-p70 S6 kinase antibody, anti-cyclin E
antibody, or anti-cyclin A antibody. The kinase activity of the
immunoprecipitates was assayed with histone H1 or S6 peptide as a
substrate. Each column represents the average of triplicate samples
with ± SD. (C) ED-40515( ) cells (4 × 106 cells)
cultured with or without 10 nmol/L Rap for the indicated times were
harvested and immunoprecipitated with anti-cdk4 antibody, anti-cdk6
antibody, anti-cyclin D2 antibody, or anti-cyclin
D3 antibody. The kinase activity of the immunoprecipitates
was assayed with GST-Rb as a substrate. Each column represents the
average of triplicate samples ± SD.
|
|
Rap induces p27Kip1 expression and facilitates the
formation of the cyclin E/cdk2-p27Kip1 complex in
exponentially growing ED-40515( ) cells.
The induction of p27Kip1 mRNA, but not p21Waf1
mRNA, was detected by Northern blotting from 24 hours up to 48 hours of
the culture in the presence of 10 nmol/L Rap. Protein levels of
p27Kip1 also increased gradually with the treatment of Rap.
In contrast, upregulation of p21Waf1 mRNA, but not
p27Kip1 mRNA, was detected by Northern blotting in
serum-stimulated ED-40515( ) cells, which ceased to proliferate due
to overgrowth without Rap (Fig 4A). Rap
suppressed expression of cyclin A, but not cyclin E protein levels (Fig
4B). Rap increased the amount of p27Kip1 that was
immunoprecipitated with anti-cyclin E antibody, but not markedly with
anti-cyclin D3 antibody or with anti-cdk4 antibody (Fig
4B). To evaluate de novo synthesis of p27Kip1 protein,
metabolic labeling with [35S]methionine was performed at
0, 24, and 48 hours of the culture. Rap upregulated the amount of
[35S]methionine pulse-labeled p27Kip1
markedly at 24 and 48 hours of the culture (Fig 4C). The half life of
p27Kip1 evaluated by pulse chase of
[35S]methionine-labeled p27Kip1 at 28 hours
of the cuture was over 9 hours in the presence of 10 nmol/L Rap and
about 5.5 hours in the absence of Rap, respectively, indicating that
elevated protein level of p27Kip1 by Rap at 28 hours and
after 28 hours of the cuture was ascribed to both upregulation of de
novo synthesis and retarded degradation process of p27Kip1
(Fig 4D).

View larger version (46K):
[in this window]
[in a new window]

View larger version (41K):
[in this window]
[in a new window]

View larger version (19K):
[in this window]
[in a new window]
| Fig 4.
Effect of Rap on the expression of cdks inhibitors (A),
the formation of the G1 cyclin/cdks-p27Kip1 complex (B) and
[35S] methionine-labeled p27Kip1 (C and D) in
ED-40515( ) cells. Exponentially growing ED-40515( ) cells
incubated with or without Rap were harvested 0, 24, 28, or 48 hours
after the initiation of the culture. (A) Upper: the expression of
p21Waf1 and p27Kip1 at mRNA level. A total of
10 µg of total RNA was fractionated by electrophoresis and subjected
to Northern blotting with 32P labeled p21Waf1
or p27Kip1 probes. The same filter membrane was used for
p21Waf1 and p27Kip1 mRNA hybridization. Bottom:
the expression of p21Waf1 and p27Kip1 at
protein level. The cell lysates containing 40 µg of the protein were
subjected to immunoblotting with anti-p27Kip1 antibody and
anti-p21Waf1 antibody. (B) Upper: immunoblotting of cyclin
A and cyclin E. The cell lysate containing 40 µg of protein from
indicated samples was separated with 10% gel, followed by
immunoblotting with anticyclin A or E antibody. Bottom: the
immunoprecipitation (IP)-immunoblotting of p27Kip1. The
cell lysates prepared from 5 × 106 cells of the indicated
samples were immunoprecipitated with anti-cyclin E antibody, anti-cdk4
antibody, or anti-cyclin D3 antibody followed by SDS-PAGE
separation with 12.5% gel and immunoblotting with anti-p27Kip1 antibody. (C) The de novo synthesis rate of
p27Kip1 evaluated by [35S]methionine
metabolic labeling. ED-40515( ) cells cultured in RPMI 1640 plus 10%
FCS were incubated with or without 10 nmol/L Rap for 24 or 48 hours.
The cells were harvested at the indicated points and labeled with 150 µCi/mL of [35S]methionine for 45 minutes. The cells
were harvested again for lysis in hypotonic buffer. The cell lysates
were immunoprecipitated with anti-p27Kip1 antibody. The
radioactive signals associated with the p27Kip1 bands,
which were measured by a phosphorimager, were plotted as the relative
signal intensity. (D) The pulse chase study of [35S]methionine-labeled p27Kip1.
ED-40515g( ) cells cultured with or without 10 nmol/L Rap for 28 hours were harvested and labeled with [35S]methionine by
the same method as in (C). The cells were placed in full medium to
chase the metabolic labeling with or without 10 nmol/L Rap and
harvested at the indicated points (0, 3, 6, and 9 hours after
[35S]methionine labeling) for lysis in hypotonic buffer.
The radioactive signals associated with the p27Kip1 bands,
which were measured by a phosphorimager, were plotted as the percent of
the signal at the start of the chase of Rap-treated cells.
|
|
Expression level of p27Kip1 correlates well to the
sensitivity to Rap.
As shown in Fig 2, sensitivity to Rap differed among various T-cell
lines. To elucidate the factor(s) that determine(s) the sensitivity to
Rap, we examined the expression levels of p27Kip1 in a
Rap-sensitive cell line, ED-40515( ), and in a Rap-insensitive cell
line, HPB-ALL, and found that the basal levels of p27Kip1
were much higher in ED-40515( ) than in HPB-ALL (Fig
5A). Based on this result, we postulated
that Rap might show potent antiproliferative effects preferentially on
the cells with elevated p27Kip1 levels and induce G1 arrest
by increasing the amount of p27Kip1 beyond a putative
threshold. To test this hypothesis, we examined the antiproliferative
effect of Rap on ED-40515( ) cells into which antisense cDNA of
p27Kip1 was introduced. As shown in Fig 5B, the
introduction of antisense cDNA of p27Kip1 into the cells
markedly reduced the antiproliferative effect of Rap, as well as the
amount of p27Kip1 detected by immunoblotting.

View larger version (26K):
[in this window]
[in a new window]
| Fig 5.
Correlation between Rap sensitivity and
p27Kip1 levels (A) and the abrogation of antiproliferative
effect of Rap by introduction of antisense cDNA into ED-40515( )
cells (B). (A) Left, the expression of p27Kip1 after 48 hours culture with or without 10 nmol/L Rap in ED-40515( ) cells and
HPB-ALL cells were examined. A total of 40 µg of whole cell lysates
were subjected to immunoblotting with anti-p27Kip1
antibody. The relative proportion (%) of cells at S/G2M was also determined by a flow cytometric analysis after staining with acridine orange. Right: the antiproliferative effect of Rap on ED-40515( ) cells and HPB-ALL cells were examined by [3H]thymidine
uptake for the last 6 hours of the 48-hour culture with or without 10 nmol/L Rap. Each column represents the means ± SD of triplicate
samples. (B) Left: 5 µg of antisense p27Kip1 cDNA, 5 µg
of frame shifted-sense together with 5 µg of antisense p27Kip1 cDNA, or 10 µg of empty vector were transfected
into ED-40515( ) cells by electroporation method. The total amount of
transfected plasmids was adjusted to 10 µg by adding a empty vector.
The transfected cells were cultured in RPMI 1640 plus 10% FCS with 1 mg/mL G418 for 3 weeks. A total of 20 µg of protein from the
transfected cells was subjected to immunoblotting with
anti-p27Kip1 antibody. Right: the transfected cells were
cultured with or without 10 nmol/L Rap for 48 hours. The
[3H]thymidine uptake by the cells for the last 6 hours
was assayed. Each column represents the means ± SD of triplicate
samples.
|
|
 |
DISCUSSION |
In the present study, we analyzed the antiproliferative effect of Rap
on exponentially growing cells comparing with that on cells entering
into the cell cycling in response to mitogenic stimuli. Rap exerted its
antiproliferative effect well when it was added to quiescent cells
together with mitogenic agent. Indeed, the addition of 10 nmol/L Rap
and 2 nmol/L rIL-2 to Kit225 cells synchronized in a quiescent state by
IL-2 depletion caused G1 arrest as previously reported. However, as
shown in Fig 1, Rap failed to exert its antiproliferative effect when
it was added to the culture 18 hours after the IL-2 stimulation or
later. In addition to this, Rap did not always exert its effect on
exponentially growing cells as shown in Fig 2. These facts suggest that
the antiproliferative effect of Rap might be both cell cycle phase- and
cell type-dependent.
It was reported that the microinjection of the neutralizing antibody
against p70 S6 kinase into the quiescent cells blocked the cell cycle
entry in response to serum.36,37 In accordance with this,
we confirmed the inhibition of both p70 S6 kinase activity and the cell
proliferation when quiescent cells were incubated with Rap and IL-2.
However, Rap failed to inhibit the proliferation of the cells that
already pass G1/S transition or growing exponentially, although the
inhibition of p70 S6 kinase was always observed within 1 hour at any
cell cycling phase. Our results and reported data suggest one
possibility that p70 S6 kinase or one(s) of the downstream molecule(s)
of p70 S6 kinase plays a pivotal role in the cell cycle progression at
the G0/G1 transition when the cells leave a quiescent state in response
to mitogenic stimuli. Rap may cause cell cycle arrest by inactivating
p70 S6 kinase at the early stage of G1 phase, but not once the cells
enter into the cell cycling.
In addition to the inactivation of p70 S6 kinase, Rap has also been
reported to inactivate cdk2 kinase by forming the cyclin E/cdk2-p27Kip1 complex and cause cell cycle arrest in late
G1 phase.14,22,23 The antiproliferative effect of Rap does
not seem to be potent enough to disrupt all of the cell cycling
mechanisms instantly and simultaneously. For example, Rap did not
affect the expression of cdk2 or cyclin E,23 while it kept
the p27Kip1 protein levels as high as the initial level
throughout the culture period. It is, therefore, possible that Rap
facilitates the transient formation of the cyclin
E/cdk2-p27Kip1 complex even if cell cycle progression down
stream of p70 S6 kinase is disrupted by Rap at the early G1 phase. We
need to accumulate further evidence to determine whether the formation
of the cyclin E/cdk2-p27Kip1 complex indeed acts as the
negative regulator of the cell cycle progression or merely represents
the state of Rap-induced G1 arrest when Rap is added concomitantly with
mitogens to quiescent cells.
Extending the cell cycle studies of quiescent cells entering into the
cell cycling, we examined the effect of Rap in exponentially growing T
cells. Rap did not always exert its antiproliferative effect on various
exponentially growing T-cell lines. Among various T-cell lines, we
selectively examined an HTLV-I-infected IL-2 independent T-cell line,
ED-40515( ) that was found to be highly sensitive to Rap and obtained
the following results.
(1) Rap caused cell cycle arrest in G1 phase. (2) Rap inhibited p70 S6
kinase activity. (3) Rap upregulated p27Kip1 at both mRNA
and protein levels. (4) Rap inhibited cyclin A-dependent kinase
activity. (5) Rap inhibited cyclin E/cdk2 kinase activity and increased
the amount of p27Kip1 coimmunoprecipitated with cyclin E. (6) Rap slightly inhibited cyclin D3/cdk4 kinase activity
and did not markedly increase the amount of p27Kip1
coimmunoprecipitated with cyclin D3 or cdk4.
As the inhibition of p70 S6 kinase by Rap was observed in both
Rap-sensitive and -insensitive cell lines, it is unlikely that it plays
a major role in Rap-induced G1 arrest of exponentially growing cells.
The [35S]methionine pulse study of p27Kip1
showed that the marked increase of the protein by Rap was ascribed to
both increased de novo synthesis rate and retarded degradation process,
while moderate increase of the protein without Rap at 48 hours of
culture might be ascribed to retarded degradation process due to
overgrowth of the cells. As Rap suppressed the expression of cyclin A,
but not cyclin E, inhibition of cyclin A-dependent kinase activity by
Rap might be explained by the decreased amount of cyclin A. The cdk2
exerts its kinase activity by forming the complex with its cyclin
counter partners, cyclin E and cyclin A, while cdk4 with cyclin Ds. As
shown in Figs 3 and 4, Rap inhibited cyclin E/cdk2 kinase activity
clearly, but slightly cyclin D3/cdk4 kinase activity in the
cells. One possible interpretation of these results is that the
substantial proportion of p27Kip1 might preferentially
associate with and be sequestered with cyclin D3/cdk4
complex rather than with cyclin E/cdk2 complex20,25 and the
final regulations to enter S phase might be conducted by the periodical
and spiky activation of the cyclin E/cdk2 complex in normal G1 cell
cycle progression. The upregulated p27Kip1 by the treatment
of Rap might selectively bind to cyclin E/cdk2 complex after being
completely titrated with cyclin D3/cdk4 complex and
inhibited both kinase activities.
Recently, Zerfass-Thome et al38 reported that
p27Kip1 blocked cyclin E-dependent transactivation of
cyclin A by forming cyclinE/cdk2-p27Kip1 complex, which
might explain the Rap-induced suppression of cyclin A. Therefore, the
formation of the cyclin E/cdk2-p27Kip1 complex by
upregulated p27Kip1 and subsequent suppression of cyclin A
expression by this complex might be the major cause of Rap-induced G1
arrest in ED-40515( ) cells. Although the mechanism that leads to the
upregulation of de novo synthesis rate of p27Kip1 by Rap
remains to be elucidated, the cell cycle arrest caused by increased de
novo synthesis of p27Kip1 consequently retarded the
degadation process of p27Kip1. These two factors might work
cooperatively to maintain the state of Rap-induced G1 arrest.
We then explored the factor(s) that might determine or correlate with
the sensitivity to Rap in exponentially growing T cells and found that
the cells with high expression levels of p27Kip1 tended to
be more sensitive to Rap than the cells with low levels. To elucidate
the correlation between the basal level of p27Kip1 and the
sensitivity to Rap, we introduced antisense cDNA of p27Kip1
into ED-40515( ) cells and showed the loss of the sensitivity to Rap
when antisense cDNA of p27Kip1 was introduced into the
cells. These results suggest the presence of a putative
p27Kip1 threshold level at the late G1 phase in already
cycling cells. In other words, the cells with lower levels of
p27Kip1 may pass the G1/S boundary, while the cells with
higher levels may fail to pass and are arrested in the late G1 phase.
Rap may exert its antiproliferative effect on the growth of
exponentially growing T cells by increasing the amount of
p27Kip1 that exceeds a putative threshold, which results in
the cell cycle arrest at the late G1 phase. The basal levels of
p27Kip1 may be, therefore, one of the limiting factors to
determine the sensitivity to Rap in exponentially growing T cells. Luo
et al39 reported that the cell lines selected for
resistance to Rap exhibited constitutively low p27Kip1
levels, and p27-/- cells derived from p27-/-
mice exhibited a significant resistance to growth inhibition effect of
Rap when growing exponentially. Their report referred to the
correlation between expression of p27Kip1 and sensitivity
to Rap from a different approach and may support our experimental
results.
Studies with p27Kip1 knock out mice by Nakayama et
al40 showed that Rap exerted its antiproliferative effect
in both wild-type and p27Kip1-/-
thymocytes.41,42 They activated T cells with anti-CD3 and anti-CD28 monoclonal antibodies and examined the effect of Rap on day
6.39 If, however, wild and p27Kip1-/- cells are
no longer in an exponential phase, but rather in a resting state on day
6, Rap inactivates p70 S6 kinase and causes G1 arrest regardless of the
p27Kip1 level as we discussed in the previous paragraph.
In summary, our current understanding of the G1 cell cycle progression
and the effect of Rap is as follows. In cells leaving a quiescent state
and entering into the cell cycling, p70 S6 kinase might play a pivotal
role in driving the cell cycle at the G0/G1 transition. Rap inactivates
p70 S6 kinase, which might result in Rap-induced G1 arrest. On the
other hand, in exponentially growing cells that skip a putative G0/G1
transition, the level of p27Kip1 is able to serve as one of
the limiting factors in driving the cell cycle at late G1 phase. Rap
exerts its antiproliferative effect by upregulating p27Kip1
in Rap-sensitive T cells. Rap inactivates cyclin E/cdk2 kinase activity
by forming the cyclin E/cdk2-p27Kip1 complex, which might
play a pivotal role in causing late G1 arrest in Rap-sensitive T cells.
Rap also inhibits p70 S6 kinase, which, however, does not seem to be a
major cause of Rap-induced G1 arrest once the cells enter into the cell
cycling.
 |
FOOTNOTES |
Submitted March 20, 1997;
accepted September 5, 1997.
Supported in part by the grants from the Ministry of Education,
Science, Sports and Culture of Japan.
Address reprint requests to Takashi Uchiyama, MD, the Institute for
Virus Research, Kyoto University, 53 Shogoin-Kawaracho Sakyo-ku, Kyoto
606 Japan.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section 1734 solely
to indicate this fact.
 |
ACKNOWLEDGMENT |
We are grateful to Dr K. Sugamura for providing us with MJ and TL-Oml
cells, and Dr K. Maruyama for pMKIT Neo expression vector. We also
thank K. Fukunaga for her excellent technical assistance and useful
discussion.
 |
REFERENCES |
1.
Brown EJ,
Beal PA,
Keith CT,
Chen J,
Shin TB,
Schreiber SL:
Control of p70 S6 kinase activity of FRAP in vivo.
Nature
377:441,
1995[Medline]
[Order article via Infotrieve]
2.
Chung J,
Grammer TC,
Lemon KP,
Kazlauskas A,
Blenis J:
PDGF- and insulin-dependent pp70S6k activation mediated by phosphatidylinositol-3-OH kinase.
Nature
370:71,
1994[Medline]
[Order article via Infotrieve]
3.
Chung J,
Kuo CJ,
Crabtree GR,
Blenis J:
Rapamycin-FKBP specifically blocks growth-dependent activation of and signaling by the p70 kd S6 protein kinases.
Cell
69:1227,
1992[Medline]
[Order article via Infotrieve]
4.
Downward J:
Regulating S6 kinase.
Nature
371:378,
1994[Medline]
[Order article via Infotrieve]
5.
Kunz J,
Henriquez R,
Schneider U,
Deuter-Reinhard M,
Movva NR,
Hall MN:
Target of rapamycin in yeast, TOR2, is an essential phosphatidyl-inositol kinase homolog required for G1 progression.
Cell
73:585,
1993[Medline]
[Order article via Infotrieve]
6.
Lorenz MC,
Heitman J:
TOR mutations confer rapamycin resistance by preventing interaction with FKBP12-rapamycin.
J Biol Chem
270:27531,
1995[Abstract/Free Full Text]
7.
Sabatini D,
Erdjument-Bromage H,
Lui M,
Tempst P,
Snyder SH:
RAFT1: A mammalian protein that binds to FKBP12 in a rapamycin-dependent fashion and is a homologous to yeast TORs.
Cell
78:35,
1994[Medline]
[Order article via Infotrieve]
8.
Brown E,
Albers M,
Shin T,
Ichikawa K,
Keith C,
Lane W,
Schreiber S:
A mammalian protein targeted by G1-arresting rapamycin receptor complex.
Nature
369:756,
1994[Medline]
[Order article via Infotrieve]
9.
Calvo V,
Wood M,
Gjertson C,
Vik T,
Bierer BE:
Activation of 70-kDa S6 kinase, induced by the cytokines interleukin-3 and erythropoietin and inhibited by rapamycin, is not an absolute requirement for cell proliferation.
Eur J Immunol
24:2664,
1994[Medline]
[Order article via Infotrieve]
10.
Dumont FJ,
Altmeyer A,
Kastner C,
Fischer PA,
Lemin KP,
Chung J,
Blenis J,
Staruch MJ:
Relationship between multiple biologic effects of rapamycin and the inhibition of pp70S6 protein kinase activity.
J Immunol
152:992,
1994[Abstract]
11.
Heitman J,
Movva NR,
Hall MN:
Targets for cell cycle arrest by the immunosuppressant rapamycin in yeast.
Science
253:905,
1991[Abstract/Free Full Text]
12.
Kuo CJ,
Chung J,
Fiorentino DF,
Flanagan WN,
Blenis J,
Crabtree GR:
Rapamycin selectively inhibits interleukin-2 activated p70 S6 kinase.
Nature
358:70,
1992[Medline]
[Order article via Infotrieve]
13.
Price DJ,
Grove JR,
Calvo V,
Avruch J,
Bierer BE:
Rapamycin-induced inhibition of the p70-kilodalton S6 protein kinase.
Science
257:973,
1992[Abstract/Free Full Text]
14.
Nourse J,
Firpo E,
Flanagan WM,
Coats S,
Polyak K,
Lee M,
Massague J,
Crabtree G,
Roberts JM:
Interleukin-2 mediated elimination of the p27kip1 cyclin-dependent kinase inhibitor prevented by rapamycin.
Nature
372:570,
1994[Medline]
[Order article via Infotrieve]
15.
Polyak K,
Lee MH,
Erdjument-Bromage H,
Koff A,
Roberts JM,
Tempst P,
Massague J:
Cloning of p27Kip1, a cyclin-depndent kinase inhibitor and a potent mediator of extracellular antimitogenic signals.
Cell
78:59,
1994[Medline]
[Order article via Infotrieve]
16.
Sherr CJ,
Roberts JM:
Inhibitors of mammalian G1 cyclin-dependent kinase.
Genes Dev
9:1149,
1995[Free Full Text]
17.
Koff A,
Giordano A,
Desai D,
Yamashita K,
Harper JW,
Elledge S,
Nishimoto T,
Morgan DO,
Franza BR,
Roberts JM:
Formation and activation of a cyclin E/cdk2 complex during the G1 phase of the human cell cycle.
Science
257:1689,
1992[Abstract/Free Full Text]
18.
Albers M,
Williams R,
Brown E,
Tanaka A,
Hall F,
Schreiber S:
FKBP-rapamycin inhibits a cyclin-dependent kinase activity and a cyclin D1-cdk association in early G1 of an osteosarcoma.
J Biol Chem
268:22825,
1993[Abstract/Free Full Text]
19.
Jayaraman T,
Marks AR:
Rapamycin-FKBP12 blocks proliferation, induces differentiation and inhibits cdc2 kinase activity in a myogenic cell line.
J Biol Chem
268:25385,
1993[Abstract/Free Full Text]
20. Kato J, Matsuoka M, Polyak K, Massague, Sherr CJ: Cyclic
AMP-induced G1 phase arrest mediated by an inhibitor
(p27Kip1) of cyclin-dependent kinase-4 activation. Cell
79:487, 1994
21.
Morgan DO:
Principles of CDK regulation.
Nature
374:131,
1995[Medline]
[Order article via Infotrieve]
22.
Morice WG,
Brunn GJ,
Wiederrecht G,
Siekierka JJ,
Abraham RT:
Rapamycin-induced inhibition of p34cdc2 kinase activation is associated with G1/S-phase growth arrest in T lymphocytes.
J Biol Chem
268:3734,
1993[Abstract/Free Full Text]
23.
Morice WG,
Wiederrecht G,
Brunn GJ,
Siekierka JJ,
Abraham RT:
Rapamycin inhibition of interleukin-2-dependent p33cdk2 and p34cdc2 kinase activation in T lymphocytes.
J Biol Chem
268:22737,
1993[Abstract/Free Full Text]
24.
Peter M,
Herskowitz I:
Joining the complex: Cyclin-dependent kinase inhibitory proteins and the cell cycle.
Cell
79:181,
1994[Medline]
[Order article via Infotrieve]
25.
Toyoshima H,
Hunter T:
p27, a novel inhibitor of G1 cyclin-cdk protein kinase activity, is related to p21.
Cell
78:67,
1994[Medline]
[Order article via Infotrieve]
26.
Hengst L,
Reed SI:
Translational control of p27Kip1 accumulation during the cell cycle.
Science
271:1861,
1996[Abstract]
27.
Pagano M,
Tam SW,
Theodoras AM,
Beer-Romero P,
Del Sal G,
Chau V,
Yew PR,
Draetta GF,
Rolfe M:
Role of the ubiquitin proteosome pathway in regulating abundance of the cyclin-dependent kinase inhibitor p27.
Science
269:682,
1995[Abstract/Free Full Text]
28.
Hori T,
Uchiyama T,
Tsudo M:
Establishment of an interleukin-2 dependent human T cell line from a patient with T cell chronic lymphocytic leukemia who is not infected with human T cell leukemia/lymphoma virus.
Blood
70:1069,
1987[Abstract/Free Full Text]
29.
Maeda M,
Shimizu A,
Ikuta K,
Okamoto H,
Kashihara M,
Uchiyama T,
Honjo T,
Yodoi J:
Origin of human T-lymphotrophic virus I-positive T cell lines in adult T cell leukemia.
J Exp Med
162:2169,
1985[Abstract/Free Full Text]
30.
Arima N,
Kamio M,
Imada K,
Hori T,
Hattori T,
Tsudo M,
Okuma M,
Uchiyama T:
Pseudo-high affinity interleukin 2 (IL-2) receptor lacks the third component that is essential for functional IL-2 binding and signaling.
J Exp Med
176:1265,
1992[Abstract/Free Full Text]
31.
Sugamura K,
Fujii M,
Kannagi M,
Sakitani M,
Takeuchi M,
Hinuma Y:
Cell surface phenotypes and expression of viral antigens of various human cell lines carrying human T-cell leukemia virus.
Int J Cancer
34:221,
1984[Medline]
[Order article via Infotrieve]
32.
Popovic M,
Sarin PS,
Robert-Gurroff M,
Kalyanaraman VS,
Mann D,
Minowada J,
Gallo RC:
Isolation and transmission of human retrovirus (human T-cell leukemia virus).
Science
219:856,
1983[Abstract/Free Full Text]
33.
Miyoshi I,
Kubonishi I,
Yoshimoto S,
Akagi T,
Ohtsuki Y,
Shiraishi Y,
Nagata K,
Hinuma Y:
Type C virus particles in a cord T-cell line derived by co-cultivating normal human cord leukocytes and human leukemic T cells.
Nature
294:770,
1981[Medline]
[Order article via Infotrieve]
34.
Luk CK,
Keng PC,
Sutherland RM:
Regrowth and radiation sensitivity of quiescent cells isolated from EMT6/Ro-fed plateau monolayers.
Cancer Res
45:1020,
1985[Abstract/Free Full Text]
35.
Matsushime H,
Quelle DE,
Shurtleff SA,
Shibuya M,
Sherr CJ,
Kato J:
D-type cyclin dependent kinase activity in mammalian cells.
Mol Cell Biol
14:2066,
1994[Abstract/Free Full Text]
36.
Lane HA,
Fernandez A,
Lamb NJC,
Thomas G:
p70s6k function is essential for G1 progression.
Nature
363:170,
1993[Medline]
[Order article via Infotrieve]
37.
Reinhard C,
Fernandez A,
Lamb NJC,
Thomas G:
Nuclear localization of p85s6K: Functional requirement for entry into S phase.
EMBO J
13:1557,
1994[Medline]
[Order article via Infotrieve]
38.
Zerfass-Thome K,
Schulze A,
Zwerscke W,
Vogt B,
Helin K,
Bartek J,
Henglein B,
Jansen-Durr P:
p27KIP1 blocks cyclin E-dependent transactivation of cyclin A gene expression.
Mol Cell Biol
17:407,
1997[Abstract]
39.
Luo Y,
Marx SO,
Kiyokawa H,
Koff A,
Massague J,
Marks AR:
Rapamycin resistance tied to defective regulation of p27Kip1.
Mol Cell Biol
16:6744,
1996[Abstract]
40.
Nakayama K,
Ishida N,
Shirane M,
Inomata A,
Inoue T,
Shishido N,
Horii I,
Loh DK,
Nakayama K:
Mice lacking p27Kip1 display increased body size, multiple organ hyperplasia, retinal dysplasia, and pituitary tumors.
Cell
85:707,
1996[Medline]
[Order article via Infotrieve]
41.
Fero ML,
Rivkin M,
Tasch M,
Porter P,
Carow CE,
Firpo E,
Polyak K,
Tasai LH,
Broudy V,
Perlmutter RM,
Kaushansky K,
Roberts JM:
A syndrome of multiorgan hyperplasia with features of gigantism, tumorigenesis, and female sterility in p27Kip1-deficient mice.
Cell
85:733,
1996[Medline]
[Order article via Infotrieve]
42.
Kiyokawa H,
Kineman RD,
Manova-Todorova KO,
Soares VC,
Hoffman ES,
Ono M,
Khanam D,
Hayday AC,
Frohman LA,
Koff A:
Enhanced growth of mice lacking the cyclin-dependent kinase inhibitor function of p27Kip1.
Cell
85:721,
1996[Medline]
[Order article via Infotrieve]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A. Gorshtein, H. Rubinfeld, E. Kendler, M. Theodoropoulou, V. Cerovac, G. K Stalla, Z. R Cohen, M. Hadani, and I. Shimon
Mammalian target of rapamycin inhibitors rapamycin and RAD001 (everolimus) induce anti-proliferative effects in GH-secreting pituitary tumor cells in vitro
Endocr. Relat. Cancer,
September 1, 2009;
16(3):
1017 - 1027.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. R. Geest, F. J. Zwartkruis, E. Vellenga, P. J. Coffer, and M. Buitenhuis
Mammalian target of rapamycin activity is required for expansion of CD34+ hematopoietic progenitor cells
Haematologica,
July 1, 2009;
94(7):
901 - 910.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. S. Kushwaha, E. Raichlin, Y. Sheinin, W. K. Kremers, K. Chandrasekaran, G. J. Brunn, and J. L. Platt
Sirolimus affects cardiomyocytes to reduce left ventricular mass in heart transplant recipients
Eur. Heart J.,
November 2, 2008;
29(22):
2742 - 2750.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. G. Crespo-Leiro and M. Hermida-Prieto
Sirolimus treatment of left ventricular hypertrophy: who, and when?
Eur. Heart J.,
November 2, 2008;
29(22):
2703 - 2704.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Oliere, M. Arguello, T. Mesplede, V. Tumilasci, P. Nakhaei, D. Stojdl, N. Sonenberg, J. Bell, and J. Hiscott
Vesicular Stomatitis Virus Oncolysis of T Lymphocytes Requires Cell Cycle Entry and Translation Initiation
J. Virol.,
June 15, 2008;
82(12):
5735 - 5749.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Lloberas, J. M. Cruzado, M. Franquesa, I. Herrero-Fresneda, J. Torras, G. Alperovich, I. Rama, A. Vidal, and J. M. Grinyo
Mammalian Target of Rapamycin Pathway Blockade Slows Progression of Diabetic Kidney Disease in Rats
J. Am. Soc. Nephrol.,
May 1, 2006;
17(5):
1395 - 1404.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Raslova, V. Baccini, L. Loussaief, B. Comba, J. Larghero, N. Debili, and W. Vainchenker
Mammalian target of rapamycin (mTOR) regulates both proliferation of megakaryocyte progenitors and late stages of megakaryocyte differentiation
Blood,
March 15, 2006;
107(6):
2303 - 2310.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. A. Adjei and M. Hidalgo
Intracellular Signal Transduction Pathway Proteins As Targets for Cancer Therapy
J. Clin. Oncol.,
August 10, 2005;
23(23):
5386 - 5403.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Koziczak and N. E. Hynes
Cooperation between Fibroblast Growth Factor Receptor-4 and ErbB2 in Regulation of Cyclin D1 Translation
J. Biol. Chem.,
November 26, 2004;
279(48):
50004 - 50011.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Hleb, S. Murphy, E. F. Wagner, N. N. Hanna, N. Sharma, J. Park, X. C. Li, T. B. Strom, J. F. Padbury, Y.-T. Tseng, et al.
Evidence for Cyclin D3 as a Novel Target of Rapamycin in Human T Lymphocytes
J. Biol. Chem.,
July 23, 2004;
279(30):
31948 - 31955.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Mayer, J. Zhao, X. Yuan, and I. Grummt
mTOR-dependent activation of the transcription factor TIF-IA links rRNA synthesis to nutrient availability
Genes & Dev.,
February 15, 2004;
18(4):
423 - 434.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W.-C. Noh, W. H. Mondesire, J. Peng, W. Jian, H. Zhang, J. Dong, G. B. Mills, M.-C. Hung, and F. Meric-Bernstam
Determinants of Rapamycin Sensitivity in Breast Cancer Cells
Clin. Cancer Res.,
February 1, 2004;
10(3):
1013 - 1023.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Slavik, D.-G. Lim, S. J. Burakoff, and D. A. Hafler
Rapamycin-resistant Proliferation of CD8+ T Cells Correlates with p27kip1 Down-regulation and bcl-xL Induction, and Is Prevented by an Inhibitor of Phosphoinositide 3-Kinase Activity
J. Biol. Chem.,
January 9, 2004;
279(2):
910 - 919.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Shao, B. M. Evers, and H. Sheng
Roles of Phosphatidylinositol 3'-Kinase and Mammalian Target of Rapamycin/p70 Ribosomal Protein S6 Kinase in K-Ras-Mediated Transformation of Intestinal Epithelial Cells
Cancer Res.,
January 1, 2004;
64(1):
229 - 235.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Decker, S. Hipp, I. Ringshausen, C. Bogner, M. Oelsner, F. Schneller, and C. Peschel
Rapamycin-induced G1 arrest in cycling B-CLL cells is associated with reduced expression of cyclin D3, cyclin E, cyclin A, and survivin
Blood,
January 1, 2003;
101(1):
278 - 285.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Quemeneur, M. Flacher, L.-M. Gerland, M. Ffrench, J.-P. Revillard, and N. Bonnefoy-Berard
Mycophenolic Acid Inhibits IL-2-Dependent T Cell Proliferation, But Not IL-2-Dependent Survival and Sensitization to Apoptosis
J. Immunol.,
September 1, 2002;
169(5):
2747 - 2755.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. B. Gutzkow, S. Naderi, and H. K. Blomhoff
Forskolin-mediated G1 arrest in acute lymphoblastic leukaemia cells: phosphorylated pRB sequesters E2Fs
J. Cell Sci.,
January 3, 2002;
115(5):
1073 - 1082.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Frost, S. Delikat, S. Al-Mehairi, and A. J. Sinclair
Regulation of p27KIP1 in Epstein-Barr virus-immortalized lymphoblastoid cell lines involves non-apoptotic caspase cleavage
J. Gen. Virol.,
December 1, 2001;
82(12):
3057 - 3066.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. A. Elsayed and E. A. Sausville
Selected Novel Anticancer Treatments Targeting Cell Signaling Proteins
Oncologist,
December 1, 2001;
6(6):
517 - 537.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. B. Cunningham
An Inositolphosphate-Binding Immunophilin, IPBP12
Blood,
October 15, 1999;
94(8):
2778 - 2789.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Taniguchi, H. Endo, N. Chikatsu, K. Uchimaru, S. Asano, T. Fujita, T. Nakahata, and T. Motokura
Expression of p21Cip1/Waf1/Sdi1 and p27Kip1 Cyclin-Dependent Kinase Inhibitors During Human Hematopoiesis
Blood,
June 15, 1999;
93(12):
4167 - 4178.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Hollsberg
Mechanisms of T-Cell Activation by Human T-Cell Lymphotropic Virus Type I
Microbiol. Mol. Biol. Rev.,
June 1, 1999;
63(2):
308 - 333.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Majewski, M. Korecka, P. Kossev, S. Li, J. Goldman, J. Moore, L. E. Silberstein, P. C. Nowell, W. Schuler, L. M. Shaw, et al.
The immunosuppressive macrolide RAD inhibits growth of human Epstein-Barr virus-transformed B lymphocytes in vitro and in vivo: A potential approach to prevention and treatment of posttransplant lymphoproliferative disorders
PNAS,
April 11, 2000;
97(8):
4285 - 4290.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|