SEARCH:   Advanced

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Sun, W. H. Articles by Rosen, S. T. Search for Related Content PubMed PubMed Citation Articles by Sun, W. H. Articles by Rosen, S. T. Related Collections Immunobiology Social Bookmarking                   What's this?  Previous Article  |  Table of Contents  |  Next Article  Blood, Vol. 91 No. 2 (January 15), 1998: pp. 570-576 Interferon- Resistance in a Cutaneous T-Cell Lymphoma Cell Line Is Associated With Lack of STAT1 Expression By Wenn H. Sun, Carlos Pabon, Yazan Alsayed, Paul P. Huang, Sara Jandeska, Shahab Uddin, Leonidas C. Platanias, and Steven T. Rosen From the Division of Dermatology, Department of Pediatrics, Northwestern University Medical School, Chicago, IL; Robert Lurie Cancer Center, Northwestern University Medical School, Chicago, IL; and the Section of Hematology/Oncology, University of Illinois at Chicago, Chicago, IL.     ABSTRACT Abstract Introduction Methods Results Discussion References Interferon-alpha (IFN) mediates its biological effects through activation of the JAK-STAT signaling pathway and it has been shown to be one of most effective therapeutic agents for a number of hematological malignancies, including cutaneous T-cell lymphoma (CTCL). Nevertheless, its efficacy is limited by the development of clinical resistance but the reasons for resistance in CTCL are unknown. Here, we report the development of an IFN-resistant CTCL cell line (HUT78R), characterized by its ability to proliferate in high concentration of recombinant IFN, which can be used as a model system to study IFN resistance. The levels of IFN receptor expression and binding affinity were found to be comparable between the parental sensitive (HUT78S) and resistant (HUT78R) cells. However, IFN stimulation failed to induce interferon-stimulated gene factor 3 (ISGF3) complex formation in HUT78R cells. In addition, the expression of the IFN-inducible 2-5 OAS gene was significantly reduced in HUT78R cells, suggesting the presence of a defect in the Jak-STAT signaling pathway. Our results showed that the IFN-activated form of a latent transcriptional factor STAT1 was not found in HUT78R cells, whereas activated STAT2 and STAT3 were clearly detectable. By Western blotting and reverse transcriptase-polymerase chain reaction (RT-PCR) analyses, we found that HUT78R cells do not express any STAT1 protein or mRNA, suggesting the possibility of a null mutation in the STAT1 gene. Resistance to the growth inhibitory effect of IFN in CTCL cells may result from lack of STAT1 expression.     INTRODUCTION Abstract Introduction Methods Results Discussion References INTERFERONS (IFN) ARE A group of cytokines whose biological activities include antiviral, antiproliferative, and immunomodulatory effects.1,2 There are two classes of IFNs, Type-I and II, and IFN belongs to the Type-I family. All the Type-I IFNs bind to the Type-I IFN receptor (IFNR) that is expressed in a number of neoplastic cell lines, as well as in normal monocytes and lymphocytes.2,3 IFN mediates its signal transduction by binding to its receptor, which rapidly become tyrosine phosphorylated.4,5 Phosphorylation of the receptor is regulated by two Janus kinases, Tyk2 and Jak1, which become activated upon stimulation of IFN.6,7 The activated Tyk2 and Jak1 then phosphorylate three STAT proteins.4,8 Activated STAT1 and 2 associate with a 48 kD protein (p48) to form the interferon-stimulated gene factor-3 (ISGF-3) complex, which binds specifically to the IFN-stimulated response element (ISRE), resulting in gene transcription.9-11 In addition, IFN treatment induces STAT3 phosphorylation, and activated STAT3 can bind to the interferon responsive element (IRE) sequence, forming a protein-DNA complex distinct from the ISGF3-ISRE complex.12 IFN has emerged as an important therapeutic cytokine that exerts potent antineoplastic effects involving regulation of cell cycle, suppression of oncogenes, and modulation of cell adhesion and angiogenesis.13 It has been shown to be effective against hematological malignancies including hairy cell leukemia (HCL), chronic myelogenous leukemia (CML), and cutaneous T-cell lymphoma (CTCL).13-14 Nevertheless, development of resistance to IFN therapy has often been observed in patients15-17 and the molecular basis of clinical resistance is not known. We have developed an IFN-resistant tumor cell variant (HUT78R) from a human CTCL cell line (HUT78). In characterizing the IFN-sensitive (HUT78S) and resistant cells, we noted that IFN-inducible 2,5-oligoadenylate synthetase (2,5-OAS)18 gene expression and ISGF3 complex formation was significantly reduced in HUT78R cells. Further analysis showed that there was no STAT1 protein expressed in HUT78R cells. On the other hand, IFN treatment induced both STAT2 and STAT3 phosphorylation in the HUT78R cells, indicating that the signaling defect is solely due to absence of STAT1. RT-PCR analysis also failed to detect any STAT1 transcript in HUT78R cells, suggesting the possibility of a null mutation in the STAT1 gene.     MATERIALS AND METHODS Abstract Introduction Methods Results Discussion References Tumor cell lines.   HUT78 cells were obtained from the American Type Culture Collection (ATCC, Rockville, MD). Cells were maintained in RPMI 1640 medium (GIBCO, Grand Island, NY) supplemented with 10% heat-inactivated fetal calf serum (FCS; GIBCO), 100 U/mL penicillin, and 0.1 mg/mL streptomycin. The IFN-resistant (HUT78R) cells were generated by culturing the HUT78 cells in increasing concentrations of IFN-2a (recombinant IFN-2a was kindly provided by Hoffman-LaRoche Inc, Nutley, NJ) beginning with 100 U/mL. The cells were passaged once a week and the viability was determined by trypan blue exclusion. The concentration of IFN-2a was increased incrementally until it reached 1 × 106 U/mL over a period of several months. Both parental and IFN-resistant HUT78 cells were plated on 0.5% noble agar containing 20% FCS, penicillin (100 U/mL), and streptomycin (100 ng/mL) and incubated for an additional 14 days. Individual colonies were picked and seeded in the 96-well microtitier plates in 200 µL of RPMI-1640 with 20% FCS. Two IFN-resistant (HUT78R1 and R2) and two sensitive (HUT78S1 and HUT78S2) clones were isolated. The sensitivity of the cells to IFN treatment was determined by colorimetric cell proliferation assay (CellTiter96TM, AQueous Plate, Promega, Madison, WI). The resistant phenotype of HUT78R cells was confirmed after removing the cells from IFN treatment for as long as 1 year. IFN-2a binding assay.   Recombinant IFN-2a was labeled with [125I] diiodinated Bolton-Hunter reagent (New England Nuclear, Boston, MA) following manufacturer's instructions. The labeled protein was purified by chromatography using a BioGel P-6DG column (BioRad, Richmond, CA). The cells (1.5 × 106) were incubated with 5 pmol/L of [125I] IFN-2a in one mL of RPMI medium/1% bovine serum albumin (BSA), with increasing amounts of unlabeled IFN-2a for 2 hours at 4°C. The mixture was then centrifuged in dibutyl phthalate oil (Sigma, St Louis, MO) briefly to pellet the cells and counted in a gamma counter. The levels of IFN-2a binding to the HUT78 variants were determined by Scatchard analysis. Slot blot analysis of IFNR and 2,5-OAS mRNA.   Total poly A+ RNA was isolated from HUT78R and HUT78S cell lines with the Ribosep kit (Collaborative Research, Bedford, MA) and diluted with 6.25 mol/L formaldehyde/10× SSPE (1.8 mol/L NaCl, 0.1 mol/L sodium phosphate, pH 7.7, and 0.1 mol/L Na2EDTA) at 65°C for 5 minutes. The treated RNA (10 µg) was transferred onto nylon filters, UV-cross-linked, and probed with human IFNR19 or 2,5-OAS (kindly provided by Dr Bryan Williams) cDNA probe. The autoradiograph was scanned on a densitometer and the levels of either IFNR or 2,5-OAS mRNA were normalized to the levels of -actin mRNA. Electromobility shift assay (EMSA).   The HUT78 cells were treated with or without IFN-2a (10,000 U/mL) for 15 minutes. Briefly, cells were washed with ice-cold phosphate-buffered saline (PBS) and resuspended in lysis buffer (20 mmol/L HEPES, 1 mmol/L vanadate, 150 mmol/L NaCl, 1% Triton X-100, 1 mmol/L phenylmethylsulfonic acid, 1 mmol/L dithiothreitol). Nuclear extracts were obtained by agitating the cell lysates in hypertonic buffer (350 mmol/L NaCl, 10 mmol/L HEPES [pH 8.0], 25% glycerol, 1 mmol/L EDTA, 10 µg/mL aprotinin, 5 mmol/L spermidine, 1 mmol/L PMSF) for 1 hour at 4°C and centrifuging at 1,500 × g for 15 minutes at 4°C. The nuclear extracts were aliquoted and stored at 20°C for future use. The sequence of the ISRE probe is derived from the 5 translation initiation site of the 2,5-OAS gene (TGGACTGCTGTTGGTTTCGTTTCCTCAGAAGGGAGGAG), containing the consensus ISRE sequence in bold.18 The sequence of the second ISRE probe contains the first 26 nucleotides of the first ISRE probe (TTGGACTGCTGTTGGTTTCGTTTCCT). The oligo probes were synthesized at the Northwestern University Biotech DNA Synthesis Facility (Chicago, IL) and 5-end labeled with [32P]. The nuclear extract (10 µg) was incubated with the [32P]-labeled ISRE probe (50,000 cpm) for 15 minutes at 30°C in binding buffer (40 mmol/L KCl, 20 mmol/L HEPES, pH 7.9, 1 mmol/L MgCl2, 0.1 mmol/L EDTA, 0.5 mmol/L DTT, 0.1% NP-40, 10% glycerol) in a total volume of 20 µL. The binding mixtures were subjected to electrophoresis followed by autoradiography. Immunoprecipitation and immunoblotting.   The HUT78R or HUT78S cells (2 × 107 cells) were stimulated with IFN-2a (10,000 U/mL) for 5 minutes and then lysed with lysis buffer (50 mmol/L HEPES, pH 7.3, 150 mmol/L NaCl, 1.5 mmol/L MgCl2, 1 mmol/L EDTA, pH 7.4, 10 mmol/L NaF, 10 µmol/L Na-pyrophosphate, 200 µmol/L Na-orthovanadate, 0.5% Triton-X) on ice in a total volume of one mL. The whole cell lysates were incubated with agarose-protein G beads (Pharmacia, Uppsala, Sweden; 40 µL) and with either nonimmune serum, anti-STAT1, anti-STAT2, anti-STAT3, anti-Tyk2, or anti-Jak1 polyclonal antibody (Santa Cruz Biotech, CA) for 5 hours at 4°C with constant agitation. The immunoprecipitates were washed extensively in lysis buffer containing 0.1% Triton-X and separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (8% acrylamide gel). The proteins were then transferred to Immobilon membranes and blotted with antiphosphotyrosine antibody (1 µg/mL; UBI). Bands of protein phosphorylation were detected by enhanced chemiluminescence (ECL kit; Amersham, Arlington Heights, IL). The same blots were stripped and reprobed with either anti-STAT1, anti-STAT2, anti-STAT3, anti-Tyk2, or anti-Jak1 antibody to determine the levels of STAT proteins loaded in each lane. RT-PCR for STAT1 transcript detection.   The primers were designed based on the STAT1 cDNA sequence10 (GenBank Accession # M97935), with the OLIGO 4.0 software (National Biosciences, Plymouth, MN). Primer 1 (5AAGGTGGCAGGATGTCTCGTG-3) spans the STAT1 translational initiation site and is complementary to nucleotides 186-207. Primer 2 (5TGGTCTCGTGTTCTTCTGTTCTG-3) covers the junction of exon 5 and 6 and is complementary to bases 728-749. The expected PCR product corresponds to a 564 bp fragment that represents the first five exons of the STAT1 coding sequence. Total RNA was extracted with Trizol reagent (GIBCO), treated with DNase I (Promega, Madison, WI) and diluted in DEPC-treated water (1 µg/mL). RT-PCR reactions were performed with the Access RT-PCR kit (Promega). The reverse transcription was performed at 48°C for 45 minutes after a 2 minute 94°C AMV RT inactivation and RNA/cDNA/primer denaturation step. The parameters for the PCR are: denaturation at 94°C for 2 minutes, 40 cycles of 94°C for 30 seconds, annealing for 1 minute, 2 minute extension at 68°C, and a final 7 minute extension at 68°C. The actin mRNA was amplified with primers that are commercially available (Clonetech, San Diego, CA).     RESULTS Abstract Introduction Methods Results Discussion References Development of IFN-resistant HUT78 cells.   HUT78 cells were originally derived from a CTCL patient with Sezary syndrome.20 IFN-resistant HUT78R cells were developed by culturing the HUT78 cells over several months in increasing concentrations of IFN beginning with 100 U/mL. The cells were passaged once a week and examined for their viability by trypan blue exclusion. When cell viability exceeded 85%, a higher concentration of IFN was added to the medium. Cells growing in 1 × 106 U/mL of IFN were plated on soft agar for subcloning, and two clones (HUT78R1, HUT78R2) were isolated and compared with two clones of the IFN-sensitive HUT78 cells (HUT78S1 and HUT78S2). To confirm the resistant phenotype, HUT78R cells were cultured in IFN-free medium for up to 1 year and were shown to retain resistance to IFN as determined by the MTS cell proliferation assay. The LD50 (the concentration of IFN required for 50% growth inhibition in 4 days) of HUT78S cells was determined to be between 2500 U/mL to 3000 U/mL. As shown in Figure 1, IFN (3000 U/mL to 30,000 U/mL) exerted cytostatic effects on HUT78S cells (). In contrast, HUT78R cells () grew at a faster rate in the presence of IFN, in a dose-dependent manner. View larger version (30K): [in this window] [in a new window]   Fig 1. Antiproliferative effect of IFN on HUT78 variants. The anti-proliferative effect of IFN on HUT78 cells was determined by colorimetric cell proliferation assay. Cells were serum-starved overnight (in 1% BSA with RPMI) and seeded in a 96-well plate (3000 cell/well). Cells were treated with three different concentrations of IFN (0, 3,000, and 30,000 U/mL) for 4 days and cell proliferation was determined. Numbers of HUT78S and HUT78R cells are represented by -- and , respectively. Results in figure 1 represent one of three independent experiments. HUT78R cells express comparable levels of IFNR.   We first sought to determine if HUT78R cells have reduced number of IFNR or express receptors with lower ligand affinity by binding assay. The Scatchard analyses showed no significant differences in dissociation constants (Kd) or receptor numbers between the HUT78 variants (Table 1). At the transcriptional level, Northern blot showed the presence of a single 2.5 Kb band in all variants (data not shown) and slot blot analysis showed no significant differences in the levels of IFNR mRNA between HUT78R and HUT78S cells before or after 48 hours of IFN treatment (Fig 2).   View this table: [in this window] [in a new window]   Table 1. IFN Receptor Binding in HUT78 Variants View larger version (113K): [in this window] [in a new window]   Fig 2. Levels of IFNR mRNA expression in HUT78 variants. The levels of IFNR mRNA were assessed by slot blot analysis. Total poly A+ RNA was isolated from HUT78R and HUT78S cells treated with (+) or without () IFN and diluted with 6.25 mol/L formaldehyde/10X SSPE at 65°C. The treated RNA (10 µg) was transferred to nylon filters, UV-cross-linked and probed with human IFNR cDNA probe labeled with 32[P], followed by autoradiography. IFN fails to induce ISGF-3 formation in HUT78R cells.   Activation of transcriptional factors by IFN in the HUT78 variants was assessed by performing EMSA assays with two oligo probes containing the consensus ISRE sequence found in the promoter region of the 2,5-OAS gene. Our results showed that IFN treatment failed to induce the ISGF-3 complex formation in HUT78R cells (Fig 3). In addition, slot blot analysis showed that IFN stimulation induced a 15-fold to 20-fold increase in 2,5-OAS mRNA level in the HUT78S cells, compared to only fourfold to sixfold increase in HUT78R cells (Fig 4). However, expression of the metallothionein-II and HLA-B7 genes, which is not mediated by ISGF-3 binding to the ISRE sequence,21 was found to be similar between HUT78R and HUT78S cells (data not shown). These results support the notion that activation of the JAK-STAT pathway is defective in HUT78R cells. View larger version (64K): [in this window] [in a new window]   Fig 3. IFN treatment fails to induce ISGF3 formation in HUT78R cells. IFN-induced-ISGF3 complex formation was analyzed by gel shift assays using oligo probes. ISRE probe I: TTGGACTGCTGTTGGTTTCGTTTCCTC (left panel) and a longer version of the ISRE probe II: TTGGACTGCTGTTGGTTTCGTTTCCTCAGAAGGGAGGAG (right panel). HUT78R and HUT78S cells were treated with (+) or without () IFN (10,000 U/mL) for 5 minutes. Nuclear extracts were prepared and incubated with 32[P]-labeled probes for 15 minutes at 30°C and the binding mixture was subjected to electrophoresis followed by autoradiography. The arrows indicate the location of ISGF-3 complexes. View larger version (63K): [in this window] [in a new window]   Fig 4. IFN-induced 2,5-OAS gene expression is reduced in HUT78R cells. The levels of 2,5-OAS mRNA were determined in two clones of the resistant (HUT78R1 and HUT78R2) and sensitive (HUT78S1 and HUT78S2) cells treated with (+) or without () IFN by slot blot analysis with a 32[P]-labeled cDNA probe for the human 2,5-OAS gene. IFN induces Tyk2 and Jak1 activation in both HUT78S and HUT78R cells.   To determine if IFN stimulation induces activation of Janus kinases associated with the IFNR, immunoprecipitation and Western blot were performed. Our results showed that IFN induced comparable levels of Tyk2 and Jak1 phosphorylation in both HUT78S and HUT78R cells (Fig 5A and B), indicating that the defect in IFN signaling is not related to the Janus kinases. View larger version (39K): [in this window] [in a new window]   Fig 5. IFN-induced Janus kinases activation HUT78 cells. The cells were treated with (+) or without () IFN (10,000 U/mL for 5 minutes) and whole cell extracts were prepared for immunoprecipitation with anti-Tyk2 (Fig 5A) or anti-Jak1 (Fig 5B) antibody. The immunocomplex was then analyzed by Western blot using anti-phosphotyrosine (anti-pY) antibody (upper panels). The same blot was stripped and reprobed with anti-Tyk2 or Jak1 antibody to determine the levels of protein in each lane (lower panels). HUT78R cells do not express STAT1.   To assess STAT protein activation induced by IFN treatment in both HUT78R and HUT78S cells, we immunoprecipitated STAT1, -2, or -3 and performed Western blots of the immunoprecipitates using antiphosphotyrosine antibody. We found that IFN treatment-induced STAT1 phosphorylation in the HUT78S cells but not in HUT78R cells (Fig 6A, upper panel). When the same blot was stripped and reprobed with anti-STAT1 antibody, we failed to detect any STAT1 protein present in the lysates of HUT78R cells (Fig 6A, lower panel), which explains the lack of phosphorylation signal. View larger version (42K): [in this window] [in a new window]   View larger version (45K): [in this window] [in a new window]   View larger version (45K): [in this window] [in a new window]   Fig 6. Phosphorylation of STAT proteins in HUT78 cells. The cells were treated with (+) or without () IFN (10,000 U/mL for 5 minutes) and whole cell extracts were prepared for immunoprecipitation with anti-STAT antibody. The immunocomplex was then analyzed by Western blot using anti-phosphotyrosine (anti-pY) antibody (upper panel). The same blot was stripped and reprobed with anti-STAT antibody to determine the levels of protein in each lane (lower panel). STAT1 immunoprecipitation is shown in Figure 6A, STAT2 in Figure 6B, and STAT3 in Figure 6C. The arrow in Figure 6B indicates the location of STAT2 and activated STAT1 (doublet) was coprecipitated with STAT2 in HUT78S cells only (Fig 6B, upper panel). On the other hand, STAT2 phosphorylation was comparable in both HUT78R and HUT78S cells (Fig 6B, upper panel), indicating that signaling from ligand binding through Tyk2/Jak1 kinase activation is not affected. IFN stimulation also augmented the level of STAT3 phosphorylation in both cell lines (Fig 6C, upper panel). Similar levels of STAT proteins loaded in each lane were confirmed by reprobing the same blot with the respective anti-STAT antibody, as shown in the lower panels of Figure 6B and C. HUT78R cells do not express STAT1 transcript.   To determine whether inhibition of STAT1 protein expression in HUT78R cells is caused by translational or transcriptional defect(s), RT-PCR analysis was employed to detect the presence of STAT1 transcript in HUT78 cells. The primers were designed to amplify a 564 bp that represents the first five exons of the STAT1 coding sequence. As expected, we detected a PCR product of 564 bp fragment from HUT78S cells and HeLa cells, (which is known to express STAT1 protein)10 but no amplification was detected in HUT78R cells (Fig 7). View larger version (48K): [in this window] [in a new window]   Fig 7. RT-PCR of STAT1 transcript. Three cell lines were subject to RT-PCR, including HUT78R, HUT78S, and HeLa cells. Primer 1 (5AAGGTGGCAGGATGTCTCGTG-3) spans the STAT1 translational initiation site and is complementary to nucleotides 186-207. Primer 2 (5TGGTCTCGTGTTCTTCTGTTCTG-3) covers the junction of exon 5 and 6 and is complementary to bases 728-749. The actin mRNA was amplified using primers that are commercially available.     DISCUSSION Abstract Introduction Methods Results Discussion References In this report we describe the development and characterization of an IFN-resistant human CTCL cell line (HUT78R) that may be used as a model system for study of clinical resistance to IFN therapy. We first sought to determine if IFN-binding and INFR expression are altered in HUT78R cells. Our results showed that the levels of IFNR mRNA were similar between HUT78S and HUT78R cells. In addition, Scatchard analysis of the IFN-binding assay showed that dissociation constants of IFNR between HUT78R and HUT78S cells were comparable. Next, we examined if IFN-induced transcriptional activation was affected in HUT78R cells. With oligo probes containing the ISRE consensus sequence in gel shift assays, we found that IFN stimulation failed to induce ISGF3 complex formation in HUT78R cells. In addition, IFN-induced 2,5-OAS gene expression was inhibited significantly in HUT78R cells, compared with HUT78S cells. The fourfold to sixfold increase in 2,5-OAS gene expression observed in HUT78R cells (in contrast to 20-fold increase in HUT78S cells) may be due to activation of IFN response sequence (IRS)21 found in the 2,5-OAS promoter region. The IFN-induced gene expression of histocompatibility locus antigen (HLA)-B7 and metallothionein-II gene, which both contain IRS element, was found to be comparable between HUT78R and HUT78S cells (unpublished results). Taken together, these results suggest a defect(s) in the activation of JAK-STAT signaling pathway in HUT78R cells, resulting in inhibition of ISGF3 formation (ie, ISRE binding), 2,5-OAS gene induction and resistance to the growth inhibitory effect of IFN. To identify and characterize such a defect(s), we first determined if type-I IFNR-associated Janus kinases Tyk2 and Jak1 were activated on IFN stimulation in the resistant cells. Our results showed that IFN treatment induced in comparable levels of Tyk2 and Jak1 tyrosine phosphorylation, suggesting that the IFN signaling defect in HUT78R cells is probably not a result of Tyk2 or Jak1 dysfunction. We then sought to determine the status of STAT protein activation by IFN treatment in HUT78 cells. We failed to detect any STAT1 activation in HUT78R cells. In contrast, IFN-induced similar levels of STAT2 and STAT3 activation in HUT78R cells, compared with HUT78S cells. This result suggests that the signaling defect in HUT78R cells is associated only with STAT1. Immunoprecipitation and Western analyses failed to detect any STAT1 ( and ) protein expressed in HUT78R cells, explaining the lack of detection of STAT1 phosphorylation on IFN treatment. A number of IFN-( or ) resistant human tumor cell lines have been reported previously.22-28 One was shown to lack expression of one IFNR component27 and the U3A cell line (U3A), derived from high-frequency mutagenesis of the 2fTGH cells,28 was shown to lack STAT1 expression. U3A cells were unresponsive to the growth inhibitory effects of IFN and IFN. It was shown that transfection of STAT1 cDNA into the U3A cells can restore the cells' sensitivity to the growth inhibitory effect of IFNs.29 More recently, STAT1 was shown to regulate the expression of cyclin-dependent kinase (cdk2) inhibitor p21 at the transcriptional level,30 indicating that STAT1 negatively regulates the cell cycle progression. Taken together, STAT1 appears to play a significant role in mediating cytokine signaling and regulation of cell cycle. IFN is the only known cytokine that activates STAT2, and STAT2 phosphorylation has been shown to be a prerequisite for STAT1 activation.31-32 However, lack of STAT1 activation did not affect STAT2 phosphorylation induced by IFN in HUT78R cells, as previously shown in U3A cells.33 Similarly, IFN stimulation-induced STAT3 activation in both HUT78R and HUT78S cells. Hence, absence of STAT1 in the HUT78R cells did not have any significant effect on STAT3 activation, as shown previously in STAT1/ embryonic stem cells.34 Tyk2 activation was shown to be obligatory to activation of Jak1, STAT1, and STAT2 in IFN-mediated signaling.35 Our result showed that IFN treatment-induced Tyk2 and Jak1 phosphorylation in both HUT78R and HUT78S cells, showing the independence of STAT2 and STAT3 activation to STAT1. In contrast to the antiproliferative effect of IFN on HUT78S cells, increasing concentrations of IFN caused a marked stimulation of growth in HUT78R cells (Fig 1). It is conceivable that lack of STAT1 may alter the balance of STAT complex formation, resulting in inappropriate signaling and gene transcription. Whether IFN-induced activation of STAT3 and/or STAT2 in the absence of STAT1 is associated with this accelerated growth of HUT78R cells, is a topic which warrants future investigation. We also noted that STAT3 was constitutively activated in both HUT78R and HUT78S cells (Fig 6C). Others have reported constitutive activation of STAT3 in anaplastic large T-cell lymphoma (ALTL), Sezary syndrome,36 leukemia,37 and to contribute to oncogenesis by Src oncoprotein.38 Therefore, constitutive activation of STAT3 in HUT78 cells may be associated with their neoplastic characteristics. The lack of STAT1 protein expression in HUT78R cells raises the possibility of a null mutation in the STAT1 gene. Our RT-PCR analysis failed to detect any STAT1 transcript in HUT78R cells, indicating that the putative mutation results in inhibition of transcription or expression of highly unstable mRNA. Comparative Southern blot analysis of genomic DNA obtained from HUT78S and HUT78R cells revealed distinct patterns of hybridization with a STAT1 cDNA probe (unpublished results). This result supports the notion that HUT78R cells harbor a STAT1 gene mutation(s) that results in lack of STAT1 expression. Additional experiments are needed to define the nature of this mutation in HUT78R cells. Because acquisition of clinical resistance to IFN is commonly observed in CTCL, it will be of great significance to determine if tumor cells isolated from patients with IFN resistance lack STAT1 or have other defects in the IFN-signaling pathway. Understanding the mechanism of clinical resistance to IFN at a molecular level may lead to development of innovative treatment strategies or alternative therapies.     FOOTNOTES    Submitted April 2, 1997; accepted September 11, 1997.    Supported by a Leukemia Research Foundation grant (W.H.S.) and the NCI Lurie Cancer Center Support Grant No. CA 60553-03.    Address correspondence to Wenn H. Sun, MD, PhD, Division of Dermatology, Department of Pediatrics, Northwestern University Medical School; Children's Memorial Hospital, 2300 Children's Plaza/#203, Chicago, IL 60614.    The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact.     ACKNOWLEDGMENT We thank Dr Amy Paller for her support.     REFERENCES Abstract Introduction Methods Results Discussion References 1. Petska S, Langer JA, Zoon KC, Samuel CE: Interferons and their actions. Annu Rev Biochem 56:727, 1987[Medline] [Order article via Infotrieve] 2. Platanias LC: Interferons: Laboratory to clinic investigations. Curr Opin Oncol 7:560, 1995[Medline] [Order article via Infotrieve] 3. Uze G, Lutfalla G, Mongensen KE: And  interferons and their receptor and their friends and relations. J Interferon Res 15:3, 1995 4. Darnell J, Kerr IM, Stark GR: Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 264:1415, 1994[Abstract/Free Full Text] 5. Ihle JN, Witthuhn BA, Quelle FW, Yamamoto K, Thierfelder WE, Kreider B, Silvenoinen O: Signaling by the cytokine receptor superfamily: JAKs and STATs. Trends Biochem Sci 19:222, 1994[Medline] [Order article via Infotrieve] 6. Platanias LC, Uddin S, Colamonici OR: Tyrosine phosphorylation of the alpha and beta subunits of the type I interferon receptor. Interferon-beta selectively induces tyrosine phosphorylation of an alpha subunit-associated protein. J Biol Chem 269:17761, 1994[Abstract/Free Full Text] 7. Platanias LC, Colamonici OR: Interferon alpha induces rapid tyrosine phosphorylation of the alpha subunit of its receptor. J Biol Chem 267:24053, 1992[Abstract/Free Full Text] 8. Meraz MA, White JM, Sheehan KCF, Bach EA, Rodig SJ, Dighe AS, Kaplan DH, Riley JK, Greenlund AC, Campbell D, Carver-Moore K, DuBois RN, Clark R, Aguet M, Schreiber RD: Targeted disruption of the Stat1 gene in mice reveals unexpected physiological specificity in the JAK-STAT signaling pathway. Cell 84:431, 1996[Medline] [Order article via Infotrieve] 9. Fu X-Y, Schindler C, Improta T, Aebersold R, Darnell JD: The proteins of ISGF-3, the interferon alpha-induced transcriptional activator, define a gene family involved in signal transduction. Biochemistry 89:7840, 1992 10. Schindler C, Fu X-Y, Improta T, Aebersold R, Darnell JD: Proteins of transcription factor ISGF-3: One gene encodes the 91- and 84-kDa ISGF-3 proteins that are activated by interferon alpha. Proc Natl Acad Sci USA 89:7836, 1992[Abstract/Free Full Text] 11. Qureshi SA, Leung S, Kerr IM, Stark GR, Darnell JE: Function of Stat2 protein in transcriptional activation by alpha interferon. Mol Cell Biol 16:288, 1996[Abstract] 12. The genomic structure of the murine ICSBP gene reveals the presence of the gamma interferon-responsive element, to which an ISGF3 alpha subunit or similar molecule binds. Mol Cell Biol 13:3951, 1993 13. Gutterman JU: Cytokine therapeutics: Lessons from interferon . Proc Natl Acad Sci USA 91:1198, 1994[Abstract/Free Full Text] 14. Ross C, Tingsgaard P, Jorgensen H, Veilsgaard GL: Interferon treatment of cutaneous T cell lymphoma. Eur J Haematol 51:63, 1993[Medline] [Order article via Infotrieve] 15. Kuzel TM, Roenigk HH, Samuelson E, Herrmann JJ, Hurria A, Rademaker AW, Rosen ST: Effectiveness of interferon alpha-2a combined with phototherapy for mycosis fungoides and the Sezary syndrome. J Clinic Oncol 13:257, 1995[Abstract/Free Full Text] 16. Steis RG, Smith II JW, Urba WJ, Venzon DJ, Longo DL, Barney R, Evans LM, Itri LM, Ewel CH: Loss of interferon antibodies during prolonged continuous interferon-2a therapy in hairy cell leukemia. Blood 77:792, 1991 17. Del Mel WCP, Hoffbrand AV, Giles FJ, Goldstone AH, Mehta AB, Ganeshaguru K: Alpha interferon therapy for haematological malignancies: Correlation between in vivo induction of 25 oligoadenylate synthetase and clinical response. Brit J Haematol 74:452, 1990[Medline] [Order article via Infotrieve] 18. Rutherford MN, Hannigan GE, Williams BRG: Interferon-induced binding of nuclear factors to promoter elements of the 2-5A synthetase gene. EMBO J 7:751, 1988[Medline] [Order article via Infotrieve] 19. Uze G, Lutfalla G, Gresser I: Genetic transfer of a functional human interferon alpha receptor into mouse cells: Cloning and expression of its cDNA. Cell 60:225, 1990[Medline] [Order article via Infotrieve] 20. Gazdar AF, Carney DN, Bunn PA, Russel EK, Jaffe ES, Schechter GP, Guccion JG: Mitogen requirements for the in vitro propagation of cutaneous T cell lymphoma. Blood 55:409, 1980[Free Full Text] 21. Friedman RL, Stark GR: Alpha-interferon-induced transcription of HLA and metallothionein genes containing homologous upstream sequences. Nature 314:637, 1985[Medline] [Order article via Infotrieve] 22. Verhaegen M, Divizia M, Vandenbussche P, Kuwata T, Content J: Abnormal behavior of interferon-induced enzymatic activities in an interferon-resistant cell line. Proc Natl Acad Sci USA 77:4479, 1980[Abstract/Free Full Text] 23. Tovey MG, Dron M, Mogensen KE, Lebleu B, Mechti N, Begonlours-Guymarho J: Isolation of Daudi cells with reduced sensitivity to interferon II. On the mechanism of resistance. J Gen Virol 64:2649, 1983[Abstract/Free Full Text] 24. Morikawa K, Morikawa R, Killion JJ, Fan D, Fidler IJ: Isolation of human colon carcinoma cells for resistance to a single interferon associated with cross-resistance to multiple recombinant interferons: Alpha, beta, and gamma. J Natl Cancer Inst 82:517, 1990[Abstract/Free Full Text] 25. Gomi K, Akinaga S, Oka T, Morimoto M: Analysis of receptors, cell surface antigens, and proteins in human melanoma cell lines resistant to human recombinant beta- or gamma-interferon. Cancer Res 46:6211, 1986[Abstract/Free Full Text] 26. Colamonici OR, Porterfield B, Domanski P, Constantinescu S, Pfeffer LM: Complementation of the interferon response in resistant cells by expression of the cloned subunit of the interferon receptor. J Biol Chem 13:9598, 1994 27. Abramovich C, Shulman LM, Ratovitski E, Harroch S, Tovey M, Eid P, Revel M: Differential tyrosine phosphorylation of the IFNR chain of the type I interferon receptor and of an associated surface protein in response to IFN and IFN. EMBO J 13:5871, 1994[Medline] [Order article via Infotrieve] 28. McKendry R, John J, Flavell D, Muller M, Kerr IM, Stark GR: High frequency mutagenesis of human cells and characterization of a mutant unresponsive to both  and  interferons. Proc Natl Acad Sci USA 88:11455, 1991[Abstract/Free Full Text] 29. Bromberg JF, Horvath CM, Wen Z, Schreiber RD, Darnell JE, Jr: Transcriptionally active STAT1 is required for the antiproliferative effects of both interferon and interferon. Proc Natl Acad Sci USA 93:7673, 1996 30. Chin YE, Kitagawa M, Su W-US, You Z-H, Iwamoto Y, Fu X-Y: Cell growth arrest and induction of cyclin-dependent kinase inhibitor p21waf1/cipi mediated by STAT1. Science 272:719, 1996[Abstract] 31. Leung S, Qureshi SA, Kerr IM, Darnell JE, Stark GR: Role of STAT2 in the alpha interferon signaling pathway. Mol Cell Biol 15:1312, 1995[Abstract] 32. Qureshi SA, Leung S, Kerr IM, Stark GR, Darnell JE, Jr: Function of STAT2 protein in transcriptional activation by alpha interferon. Mol Cell Biol 16:288, 1996 33. Improta T, Schindler C, Horvath CM, Kerr IM, Stark GR, Darnell JE: Transcription factor ISGF3 formation requires phosphorylated STAT91 protein, but STAT113 protein is phosphorylated independently of STAT91 protein. Proc Natl Acad Sci USA 91:4776, 1994[Abstract/Free Full Text] 34. Durbin JE, Hackenmiller R, Celeste Simon M, Levy DE: Targeted disruption of the mouse STAT1 gene results in compromised innate immunity to viral disease. Cell 84:443, 1996[Medline] [Order article via Infotrieve] 35. Velazquez L, Mogensen KE, Barbieri G, Fellous M, Uze G, Pellegrini S: Distinct domains of the protein tyrosine kinase tyk2 required for binding of interferon-/ and for signal transduction. J Biol Chem 270:3327, 1995[Abstract/Free Full Text] 36. Zhang Q, Nowak I, Vondeerheid EC, Rook AH, Kadin ME, Nowell PC, Shaw LM, Wasik MA: Activation of Jak/STAT proteins involved in signal transduction pathway mediated by receptor for interleukin-2 in malignant T lymphocytes derived from cutaneous anaplastic large T-cell lymphoma and Sezary syndrome. Proc Natl Acad Sci USA 93:9148, 1996[Abstract/Free Full Text] 37. Gouilleux-Gruart V, Gouilleux F, Desaint C, Claisse J-F, Capiod J-C, Delobel J, Weber-Nordt R, Dusanter-Fourt I, Dreyfus F, Groner B, Prin L: STAT-related transcription factors are constitutively activated in peripheral blood cells from acute leukemia patients. Blood 87:1692, 1996[Abstract/Free Full Text] 38. Yu C-L, Meyer DJ, Campbell GS, Larner AC, Carter-Su C, Schwartz J, Jove R: Enhanced DNA-binding activity of a Stat3-related protein in cells transformed by the Src oncoprotein. Science 269:81, 1995[Abstract/Free Full Text] © 1998 by The American Society of Hematology.   0006-4971/98/91-0039$3.00/0 CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this? This article has been cited by other articles: M. Hiroi, K. Mori, K. Sekine, Y. Sakaeda, J. Shimada, and Y. Ohmori Mechanisms of Resistance to Interferon-{gamma}-mediated Cell Growth Arrest in Human Oral Squamous Carcinoma Cells J. Biol. Chem., September 11, 2009; 284(37): 24869 - 24880. [Abstract] [Full Text] [PDF] P. Devaux, G. Hodge, M. B. McChesney, and R. Cattaneo Attenuation of V- or C-Defective Measles Viruses: Infection Control by the Inflammatory and Interferon Responses of Rhesus Monkeys J. Virol., June 1, 2008; 82(11): 5359 - 5367. [Abstract] [Full Text] [PDF] S. Dedieu, B. Langlois, J. Devy, B. Sid, P. Henriet, H. Sartelet, G. Bellon, H. Emonard, and L. Martiny LRP-1 Silencing Prevents Malignant Cell Invasion despite Increased Pericellular Proteolytic Activities Mol. Cell. Biol., May 1, 2008; 28(9): 2980 - 2995. [Abstract] [Full Text] [PDF] G. B. Lesinski, J. Trefry, M. Brasdovich, S. V. Kondadasula, K. Sackey, J. M. Zimmerer, A. R. Chaudhury, L. Yu, X. Zhang, T. R. Crespin, et al. Melanoma Cells Exhibit Variable Signal Transducer and Activator of Transcription 1 Phosphorylation and a Reduced Response to IFN-{alpha} Compared with Immune Effector Cells Clin. Cancer Res., September 1, 2007; 13(17): 5010 - 5019. [Abstract] [Full Text] [PDF] J. C. Ramos, P. Ruiz Jr, L. Ratner, I. M. Reis, C. Brites, C. Pedroso, G. E. Byrne Jr, N. L. Toomey, V. Andela, E. W. Harhaj, et al. IRF-4 and c-Rel expression in antiviral-resistant adult T-cell leukemia/lymphoma Blood, April 1, 2007; 109(7): 3060 - 3068. [Abstract] [Full Text] [PDF] S. Krishnamurthy, T. Takimoto, R. A. Scroggs, and A. Portner Differentially regulated interferon response determines the outcome of newcastle disease virus infection in normal and tumor cell lines. J. Virol., June 1, 2006; 80(11): 5145 - 5155. [Abstract] [Full Text] [PDF] L. Heinzerling, V. Kunzi, P. A. Oberholzer, T. Kundig, H. Naim, and R. Dummer Oncolytic measles virus in cutaneous T-cell lymphomas mounts antitumor immune responses in vivo and targets interferon-resistant tumor cells Blood, October 1, 2005; 106(7): 2287 - 2294. [Abstract] [Full Text] [PDF] M. Benekli, M. R. Baer, H. Baumann, and M. Wetzler Signal transducer and activator of transcription proteins in leukemias Blood, April 15, 2003; 101(8): 2940 - 2954. [Abstract] [Full Text] [PDF] L. Tracey, R. Villuendas, P. Ortiz, A. Dopazo, I. Spiteri, L. Lombardia, J. L. Rodriguez-Peralto, J. Fernandez-Herrera, A. Hernandez, J. Fraga, et al. Identification of Genes Involved in Resistance to Interferon-{alpha} in Cutaneous T-Cell Lymphoma Am. J. Pathol., November 1, 2002; 161(5): 1825 - 1837. [Abstract] [Full Text] [PDF] D. J. Lindner, X. Ma, J. Hu, S. Karra, and D. V. Kalvakolanu Thioredoxin Reductase Plays a Critical Role in IFN Retinoid-mediated Tumor-Growth Control in Vivo Clin. Cancer Res., October 1, 2002; 8(10): 3210 - 3218. [Abstract] [Full Text] [PDF] L. H. Wong, H. Sim, M. Chatterjee-Kishore, I. Hatzinisiriou, R. J. Devenish, G. Stark, and S. J. Ralph Isolation and Characterization of a Human STAT1 Gene Regulatory Element. INDUCIBILITY BY INTERFERON (IFN) TYPES I AND II AND ROLE OF IFN REGULATORY FACTOR-1 J. Biol. Chem., May 24, 2002; 277(22): 19408 - 19417. [Abstract] [Full Text] [PDF] M. Bergmann, I. Romirer, M. Sachet, R. Fleischhacker, A. Garcia-Sastre, P. Palese, K. Wolff, H. Pehamberger, R. Jakesz, and T. Muster A Genetically Engineered Influenza A Virus with ras-Dependent Oncolytic Properties Cancer Res., November 1, 2001; 61(22): 8188 - 8193. [Abstract] [Full Text] [PDF] D. D. Eason and G. Blanck High Level Class II trans-Activator Induction Does Not Occur with Transient Activation of the IFN-{{gamma}} Signaling Pathway J. Immunol., January 15, 2001; 166(2): 1041 - 1048. [Abstract] [Full Text] [PDF] R. Dummer, U. Dobbeling, R. Geertsen, J. Willers, G. Burg, and J. Pavlovic Interferon resistance of cutaneous T-cell lymphoma-derived clonal T-helper 2 cells allows selective viral replication Blood, January 15, 2001; 97(2): 523 - 527. [Abstract] [Full Text] [PDF] R. S. Siegel, T. Pandolfino, J. Guitart, S. Rosen, and T. M. Kuzel Primary Cutaneous T-Cell Lymphoma: Review and Current Concepts J. Clin. Oncol., August 15, 2000; 18(15): 2908 - 2925. [Abstract] [Full Text] [PDF] H. Takane, S. Ohdo, T. Yamada, E. Yukawa, and S. Higuchi Chronopharmacology of Antitumor Effect Induced by Interferon-beta in Tumor-Bearing Mice J. Pharmacol. Exp. Ther., August 1, 2000; 294(2): 746 - 752. [Abstract] [Full Text] D. Zella, F. Romerio, S. Curreli, P. Secchiero, C. Cicala, D. Zagury, and R. C. Gallo IFN-{alpha}2b Reduces IL-2 Production and IL-2 Receptor Function in Primary CD4+ T Cells J. Immunol., March 1, 2000; 164(5): 2296 - 2302. [Abstract] [Full Text] [PDF] A. C. Ward, I. Touw, and A. Yoshimura The Jak-Stat pathway in normal and perturbed hematopoiesis Blood, January 1, 2000; 95(1): 19 - 29. [Full Text] [PDF] A. R. Karpf, P. W. Peterson, J. T. Rawlins, B. K. Dalley, Q. Yang, H. Albertsen, and D. A. Jones Inhibition of DNA methyltransferase stimulates the expression of signal transducer and activator of transcription 1, 2, and 3 genes in colon tumor cells PNAS, November 23, 1999; 96(24): 14007 - 14012. [Abstract] [Full Text] [PDF] S. Gupta, M. Jiang, and A. B. Pernis IFN-{alpha} Activates Stat6 and Leads to the Formation of Stat2:Stat6 Complexes in B Cells J. Immunol., October 1, 1999; 163(7): 3834 - 3841. [Abstract] [Full Text] [PDF] This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Sun, W. H. Articles by Rosen, S. T. Search for Related Content PubMed PubMed Citation Articles by Sun, W. H. Articles by Rosen, S. T. Related Collections Immunobiology Social Bookmarking                   What's this?

	Copyright © 1998 by American Society of Hematology         Online ISSN: 1528-0020