|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 2 (January 15), 1998:
pp. 570-576
Interferon- Resistance in a Cutaneous T-Cell Lymphoma Cell
Line Is Associated With Lack of STAT1 Expression
By
Wenn H. Sun,
Carlos Pabon,
Yazan Alsayed,
Paul P. Huang,
Sara Jandeska,
Shahab Uddin,
Leonidas C. Platanias, and
Steven T. Rosen
From the Division of Dermatology, Department of Pediatrics,
Northwestern University Medical School, Chicago, IL; Robert Lurie
Cancer Center, Northwestern University Medical School, Chicago, IL; and
the Section of Hematology/Oncology, University of Illinois at Chicago,
Chicago, IL.
 |
ABSTRACT |
Interferon-alpha (IFN ) mediates its biological effects through
activation of the JAK-STAT signaling pathway and it has been shown to
be one of most effective therapeutic agents for a number of
hematological malignancies, including cutaneous T-cell lymphoma (CTCL).
Nevertheless, its efficacy is limited by the development of clinical
resistance but the reasons for resistance in CTCL are unknown. Here, we
report the development of an IFN -resistant CTCL cell line (HUT78R),
characterized by its ability to proliferate in high concentration of
recombinant IFN , which can be used as a model system to study IFN
resistance. The levels of IFN receptor expression and binding affinity
were found to be comparable between the parental sensitive (HUT78S) and
resistant (HUT78R) cells. However, IFN stimulation failed to induce
interferon-stimulated gene factor 3 (ISGF3) complex formation in HUT78R
cells. In addition, the expression of the IFN-inducible 2-5 OAS gene
was significantly reduced in HUT78R cells, suggesting the presence of a
defect in the Jak-STAT signaling pathway. Our results showed that the
IFN -activated form of a latent transcriptional factor STAT1 was not
found in HUT78R cells, whereas activated STAT2 and STAT3 were clearly
detectable. By Western blotting and reverse transcriptase-polymerase
chain reaction (RT-PCR) analyses, we found that HUT78R cells do not express any STAT1 protein or mRNA, suggesting the possibility of a null
mutation in the STAT1 gene. Resistance to the growth inhibitory effect
of IFN in CTCL cells may result from lack of STAT1 expression.
 |
INTRODUCTION |
INTERFERONS (IFN) ARE A group of
cytokines whose biological activities include antiviral,
antiproliferative, and immunomodulatory effects.1,2 There
are two classes of IFNs, Type-I and II, and IFN belongs to the
Type-I family. All the Type-I IFNs bind to the Type-I IFN receptor
(IFNR) that is expressed in a number of neoplastic cell lines, as well
as in normal monocytes and lymphocytes.2,3 IFN mediates
its signal transduction by binding to its receptor, which rapidly
become tyrosine phosphorylated.4,5 Phosphorylation of the
receptor is regulated by two Janus kinases, Tyk2 and Jak1, which become
activated upon stimulation of IFN .6,7 The activated Tyk2
and Jak1 then phosphorylate three STAT proteins.4,8 Activated STAT1 and 2 associate with a 48 kD protein (p48) to form the
interferon-stimulated gene factor-3 (ISGF-3) complex, which binds
specifically to the IFN -stimulated response element (ISRE),
resulting in gene transcription.9-11 In addition, IFN treatment induces STAT3 phosphorylation, and activated STAT3 can bind
to the interferon responsive element (IRE) sequence, forming a
protein-DNA complex distinct from the ISGF3-ISRE complex.12
IFN has emerged as an important therapeutic cytokine that exerts
potent antineoplastic effects involving regulation of cell cycle,
suppression of oncogenes, and modulation of cell adhesion and
angiogenesis.13 It has been shown to be effective against hematological malignancies including hairy cell leukemia (HCL), chronic
myelogenous leukemia (CML), and cutaneous T-cell lymphoma (CTCL).13-14 Nevertheless, development of resistance to
IFN therapy has often been observed in patients15-17 and
the molecular basis of clinical resistance is not known. We have
developed an IFN-resistant tumor cell variant (HUT78R) from a human
CTCL cell line (HUT78). In characterizing the IFN -sensitive (HUT78S)
and resistant cells, we noted that IFN-inducible 2 ,5 -oligoadenylate
synthetase (2,5-OAS)18 gene expression and ISGF3 complex
formation was significantly reduced in HUT78R cells. Further analysis
showed that there was no STAT1 protein expressed in HUT78R cells. On
the other hand, IFN treatment induced both STAT2 and STAT3
phosphorylation in the HUT78R cells, indicating that the signaling
defect is solely due to absence of STAT1. RT-PCR analysis also failed
to detect any STAT1 transcript in HUT78R cells, suggesting the
possibility of a null mutation in the STAT1 gene.
 |
MATERIALS AND METHODS |
Tumor cell lines.
HUT78 cells were obtained from the American Type Culture Collection
(ATCC, Rockville, MD). Cells were maintained in RPMI 1640 medium
(GIBCO, Grand Island, NY) supplemented with 10% heat-inactivated fetal
calf serum (FCS; GIBCO), 100 U/mL penicillin, and 0.1 mg/mL streptomycin. The IFN -resistant (HUT78R) cells were generated by
culturing the HUT78 cells in increasing concentrations of IFN -2a (recombinant IFN -2a was kindly provided by Hoffman-LaRoche Inc, Nutley, NJ) beginning with 100 U/mL. The cells were
passaged once a week and the viability was determined by trypan blue
exclusion. The concentration of IFN -2a was increased incrementally
until it reached 1 × 106 U/mL over a period of several
months. Both parental and IFN-resistant HUT78 cells were plated on
0.5% noble agar containing 20% FCS, penicillin (100 U/mL), and
streptomycin (100 ng/mL) and incubated for an additional 14 days.
Individual colonies were picked and seeded in the 96-well microtitier
plates in 200 µL of RPMI-1640 with 20% FCS. Two IFN -resistant
(HUT78R1 and R2) and two sensitive (HUT78S1 and HUT78S2) clones were
isolated. The sensitivity of the cells to IFN treatment was
determined by colorimetric cell proliferation assay (CellTiter96TM,
AQueous Plate, Promega, Madison, WI). The resistant
phenotype of HUT78R cells was confirmed after removing the cells from
IFN treatment for as long as 1 year.
IFN -2a binding assay.
Recombinant IFN -2a was labeled with [125I] diiodinated
Bolton-Hunter reagent (New England Nuclear, Boston, MA) following
manufacturer's instructions. The labeled protein was purified by
chromatography using a BioGel P-6DG column (BioRad, Richmond, CA). The
cells (1.5 × 106) were incubated with 5 pmol/L of
[125I] IFN -2a in one mL of RPMI medium/1% bovine
serum albumin (BSA), with increasing amounts of unlabeled IFN -2a for
2 hours at 4°C. The mixture was then centrifuged in dibutyl phthalate
oil (Sigma, St Louis, MO) briefly to pellet the cells and counted in a
gamma counter. The levels of IFN -2a binding to the HUT78 variants
were determined by Scatchard analysis.
Slot blot analysis of IFNR and 2,5-OAS mRNA.
Total poly A+ RNA was isolated from HUT78R and HUT78S cell
lines with the Ribosep kit (Collaborative Research, Bedford, MA) and
diluted with 6.25 mol/L formaldehyde/10× SSPE (1.8 mol/L
NaCl, 0.1 mol/L sodium phosphate, pH 7.7, and 0.1 mol/L
Na2EDTA) at 65°C for 5 minutes. The treated RNA (10 µg)
was transferred onto nylon filters, UV-cross-linked, and probed with
human IFNR19 or 2,5-OAS (kindly provided by Dr Bryan
Williams) cDNA probe. The autoradiograph was scanned on a densitometer
and the levels of either IFNR or 2,5-OAS mRNA were normalized to the
levels of -actin mRNA.
Electromobility shift assay (EMSA).
The HUT78 cells were treated with or without IFN -2a (10,000 U/mL)
for 15 minutes. Briefly, cells were washed with ice-cold phosphate-buffered saline (PBS) and resuspended in lysis buffer (20 mmol/L HEPES, 1 mmol/L vanadate, 150 mmol/L NaCl, 1% Triton X-100, 1 mmol/L phenylmethylsulfonic acid, 1 mmol/L dithiothreitol). Nuclear
extracts were obtained by agitating the cell lysates in hypertonic
buffer (350 mmol/L NaCl, 10 mmol/L HEPES [pH 8.0], 25% glycerol, 1 mmol/L EDTA, 10 µg/mL aprotinin, 5 mmol/L spermidine, 1 mmol/L PMSF)
for 1 hour at 4°C and centrifuging at 1,500 × g for 15 minutes at 4°C. The nuclear extracts were aliquoted and stored at
20°C for future use. The sequence of the ISRE probe is derived
from the 5 translation initiation site of the 2,5-OAS gene
(TGGACTGCTGTTGGTTTCGTTTCCTCAGAAGGGAGGAG), containing the consensus
ISRE sequence in bold.18 The sequence of the second ISRE
probe contains the first 26 nucleotides of the first ISRE probe
(TTGGACTGCTGTTGGTTTCGTTTCCT). The oligo probes were synthesized at the
Northwestern University Biotech DNA Synthesis Facility (Chicago, IL) and 5 -end labeled with [32P]. The nuclear
extract (10 µg) was incubated with the [32P]-labeled
ISRE probe (50,000 cpm) for 15 minutes at 30°C in binding buffer (40 mmol/L KCl, 20 mmol/L HEPES, pH 7.9, 1 mmol/L MgCl2, 0.1 mmol/L EDTA, 0.5 mmol/L DTT, 0.1% NP-40, 10% glycerol) in a total
volume of 20 µL. The binding mixtures were subjected to electrophoresis followed by autoradiography.
Immunoprecipitation and immunoblotting.
The HUT78R or HUT78S cells (2 × 107 cells) were
stimulated with IFN -2a (10,000 U/mL) for 5 minutes and then lysed
with lysis buffer (50 mmol/L HEPES, pH 7.3, 150 mmol/L NaCl, 1.5 mmol/L
MgCl2, 1 mmol/L EDTA, pH 7.4, 10 mmol/L NaF, 10 µmol/L
Na-pyrophosphate, 200 µmol/L Na-orthovanadate, 0.5% Triton-X) on ice
in a total volume of one mL. The whole cell lysates were incubated with
agarose-protein G beads (Pharmacia, Uppsala, Sweden; 40 µL) and with either nonimmune serum, anti-STAT1, anti-STAT2,
anti-STAT3, anti-Tyk2, or anti-Jak1 polyclonal antibody (Santa Cruz
Biotech, CA) for 5 hours at 4°C with constant agitation. The
immunoprecipitates were washed extensively in lysis buffer containing
0.1% Triton-X and separated by sodium dodecyl sulfate-polyacrylamide
gel electrophoresis (SDS-PAGE) (8% acrylamide gel). The proteins were
then transferred to Immobilon membranes and blotted with
antiphosphotyrosine antibody (1 µg/mL; UBI). Bands of
protein phosphorylation were detected by enhanced chemiluminescence
(ECL kit; Amersham, Arlington Heights, IL). The same blots were
stripped and reprobed with either anti-STAT1, anti-STAT2, anti-STAT3,
anti-Tyk2, or anti-Jak1 antibody to determine the levels of STAT
proteins loaded in each lane.
RT-PCR for STAT1 transcript detection.
The primers were designed based on the STAT1 cDNA
sequence10 (GenBank Accession # M97935), with the OLIGO 4.0 software (National Biosciences, Plymouth, MN). Primer 1 (5 AAGGTGGCAGGATGTCTCGTG-3 ) spans the STAT1 translational initiation
site and is complementary to nucleotides 186-207. Primer 2 (5 TGGTCTCGTGTTCTTCTGTTCTG-3 ) covers the junction of exon 5 and 6 and
is complementary to bases 728-749. The expected PCR product corresponds
to a 564 bp fragment that represents the first five exons of the STAT1
coding sequence. Total RNA was extracted with Trizol reagent (GIBCO),
treated with DNase I (Promega, Madison, WI) and diluted in
DEPC-treated water (1 µg/mL). RT-PCR reactions were
performed with the Access RT-PCR kit (Promega). The reverse
transcription was performed at 48°C for 45 minutes after a 2 minute
94°C AMV RT inactivation and RNA/cDNA/primer denaturation step. The parameters for the PCR are: denaturation at
94°C for 2 minutes, 40 cycles of 94°C for 30 seconds, annealing for
1 minute, 2 minute extension at 68°C, and a final 7 minute extension
at 68°C. The actin mRNA was amplified with primers that are
commercially available (Clonetech, San Diego, CA).
 |
RESULTS |
Development of IFN -resistant HUT78 cells.
HUT78 cells were originally derived from a CTCL patient with Sezary
syndrome.20 IFN-resistant HUT78R cells were developed by
culturing the HUT78 cells over several months in increasing concentrations of IFN beginning with 100 U/mL. The cells were passaged once a week and examined for their viability by trypan blue
exclusion. When cell viability exceeded 85%, a higher concentration of
IFN was added to the medium. Cells growing in 1 × 106
U/mL of IFN were plated on soft agar for subcloning, and two clones
(HUT78R1, HUT78R2) were isolated and compared with two clones of the
IFN-sensitive HUT78 cells (HUT78S1 and HUT78S2). To confirm the
resistant phenotype, HUT78R cells were cultured in IFN -free medium
for up to 1 year and were shown to retain resistance to IFN as
determined by the MTS cell proliferation assay. The LD50
(the concentration of IFN required for 50% growth inhibition in 4 days) of HUT78S cells was determined to be between 2500 U/mL to 3000 U/mL. As shown in Figure 1, IFN (3000 U/mL to 30,000 U/mL) exerted cytostatic effects on HUT78S cells ( ). In contrast, HUT78R cells ( ) grew at a faster rate in the
presence of IFN , in a dose-dependent manner.

View larger version (30K):
[in this window]
[in a new window]
| Fig 1.
Antiproliferative effect of IFN on HUT78 variants. The
anti-proliferative effect of IFN on HUT78 cells was determined by colorimetric cell proliferation assay. Cells were serum-starved overnight (in 1% BSA with RPMI) and seeded in a 96-well plate (3000 cell/well). Cells were treated with three different concentrations of
IFN (0, 3,000, and 30,000 U/mL) for 4 days and cell proliferation was determined. Numbers of HUT78S and HUT78R cells are represented by
-- and , respectively. Results in figure 1 represent one of three
independent experiments.
|
|
HUT78R cells express comparable levels of IFNR.
We first sought to determine if HUT78R cells have reduced number of
IFNR or express receptors with lower ligand affinity by binding assay.
The Scatchard analyses showed no significant differences in
dissociation constants (Kd) or receptor numbers between the HUT78
variants (Table 1). At the transcriptional
level, Northern blot showed the presence of a single 2.5 Kb band in all
variants (data not shown) and slot blot analysis showed no significant differences in the levels of IFNR mRNA between HUT78R and HUT78S cells
before or after 48 hours of IFN treatment (Fig
2).

View larger version (113K):
[in this window]
[in a new window]
| Fig 2.
Levels of IFNR mRNA expression in HUT78 variants. The
levels of IFNR mRNA were assessed by slot blot analysis. Total poly A+ RNA was isolated from HUT78R and HUT78S cells treated
with (+) or without ( ) IFN and diluted with 6.25 mol/L
formaldehyde/10X SSPE at 65°C. The treated RNA (10 µg) was
transferred to nylon filters, UV-cross-linked and probed with human
IFNR cDNA probe labeled with 32[P], followed by
autoradiography.
|
|
IFN fails to induce ISGF-3 formation in HUT78R cells.
Activation of transcriptional factors by IFN in the HUT78 variants
was assessed by performing EMSA assays with two oligo probes containing the consensus ISRE sequence found in the promoter region of the 2,5-OAS gene. Our results showed that IFN treatment failed to induce the ISGF-3 complex formation in HUT78R cells (Fig
3). In addition, slot blot analysis showed
that IFN stimulation induced a 15-fold to 20-fold increase in
2,5-OAS mRNA level in the HUT78S cells, compared to only
fourfold to sixfold increase in HUT78R cells (Fig
4). However, expression of the
metallothionein-II and HLA-B7 genes, which is not mediated by ISGF-3
binding to the ISRE sequence,21 was found to be similar
between HUT78R and HUT78S cells (data not shown). These results support
the notion that activation of the JAK-STAT pathway is defective in
HUT78R cells.

View larger version (64K):
[in this window]
[in a new window]
| Fig 3.
IFN treatment fails to induce ISGF3 formation in
HUT78R cells. IFN -induced-ISGF3 complex formation was analyzed by
gel shift assays using oligo probes. ISRE probe I:
TTGGACTGCTGTTGGTTTCGTTTCCTC (left panel) and a longer version of the
ISRE probe II: TTGGACTGCTGTTGGTTTCGTTTCCTCAGAAGGGAGGAG (right panel).
HUT78R and HUT78S cells were treated with (+) or without ( ) IFN
(10,000 U/mL) for 5 minutes. Nuclear extracts were prepared and
incubated with 32[P]-labeled probes for 15 minutes at
30°C and the binding mixture was subjected to electrophoresis
followed by autoradiography. The arrows indicate the location of ISGF-3
complexes.
|
|

View larger version (63K):
[in this window]
[in a new window]
| Fig 4.
IFN -induced 2,5-OAS gene expression is reduced in
HUT78R cells. The levels of 2,5-OAS mRNA were determined in two clones of the resistant (HUT78R1 and HUT78R2) and sensitive (HUT78S1 and
HUT78S2) cells treated with (+) or without ( ) IFN by slot blot
analysis with a 32[P]-labeled cDNA probe for the human
2,5-OAS gene.
|
|
IFN induces Tyk2 and Jak1 activation in both HUT78S
and HUT78R cells.
To determine if IFN stimulation induces activation of Janus kinases
associated with the IFNR, immunoprecipitation and Western blot were
performed. Our results showed that IFN induced comparable levels of
Tyk2 and Jak1 phosphorylation in both HUT78S and HUT78R cells (Fig 5A
and B), indicating that the defect in IFN
signaling is not related to the Janus kinases.

View larger version (39K):
[in this window]
[in a new window]
| Fig 5.
IFN -induced Janus kinases activation HUT78 cells. The
cells were treated with (+) or without ( ) IFN (10,000 U/mL for
5 minutes) and whole cell extracts were prepared for
immunoprecipitation with anti-Tyk2 (Fig 5A) or anti-Jak1 (Fig 5B)
antibody. The immunocomplex was then analyzed by Western blot using
anti-phosphotyrosine (anti-pY) antibody (upper panels). The same blot
was stripped and reprobed with anti-Tyk2 or Jak1 antibody to determine
the levels of protein in each lane (lower panels).
|
|
HUT78R cells do not express STAT1.
To assess STAT protein activation induced by IFN treatment in both
HUT78R and HUT78S cells, we immunoprecipitated STAT1, -2, or -3 and
performed Western blots of the immunoprecipitates using
antiphosphotyrosine antibody. We found that IFN treatment-induced STAT1 phosphorylation in the HUT78S cells but not in HUT78R cells (Fig
6A, upper panel). When the same blot was
stripped and reprobed with anti-STAT1 antibody, we failed to detect any
STAT1 protein present in the lysates of HUT78R cells (Fig 6A, lower
panel), which explains the lack of phosphorylation signal.

View larger version (42K):
[in this window]
[in a new window]

View larger version (45K):
[in this window]
[in a new window]

View larger version (45K):
[in this window]
[in a new window]
| Fig 6.
Phosphorylation of STAT proteins in HUT78 cells. The
cells were treated with (+) or without ( ) IFN (10,000 U/mL for
5 minutes) and whole cell extracts were prepared for
immunoprecipitation with anti-STAT antibody. The immunocomplex was then
analyzed by Western blot using anti-phosphotyrosine (anti-pY) antibody
(upper panel). The same blot was stripped and reprobed with anti-STAT antibody to determine the levels of protein in each lane (lower panel).
STAT1 immunoprecipitation is shown in Figure 6A, STAT2 in Figure 6B,
and STAT3 in Figure 6C. The arrow in Figure 6B indicates the location
of STAT2 and activated STAT1 (doublet) was coprecipitated with STAT2 in
HUT78S cells only (Fig 6B, upper panel).
|
|
On the other hand, STAT2 phosphorylation was comparable in both HUT78R
and HUT78S cells (Fig 6B, upper panel), indicating that signaling from
ligand binding through Tyk2/Jak1 kinase activation is not affected.
IFN stimulation also augmented the level of STAT3 phosphorylation in
both cell lines (Fig 6C, upper panel). Similar levels of STAT proteins
loaded in each lane were confirmed by reprobing the same blot with the
respective anti-STAT antibody, as shown in the lower panels of Figure
6B and C.
HUT78R cells do not express STAT1 transcript.
To determine whether inhibition of STAT1 protein expression in HUT78R
cells is caused by translational or transcriptional defect(s), RT-PCR
analysis was employed to detect the presence of STAT1 transcript in
HUT78 cells. The primers were designed to amplify a 564 bp that
represents the first five exons of the STAT1 coding sequence. As
expected, we detected a PCR product of 564 bp fragment from HUT78S
cells and HeLa cells, (which is known to express STAT1
protein)10 but no amplification was detected in HUT78R
cells (Fig 7).

View larger version (48K):
[in this window]
[in a new window]
| Fig 7.
RT-PCR of STAT1 transcript. Three cell lines were subject
to RT-PCR, including HUT78R, HUT78S, and HeLa cells. Primer 1 (5 AAGGTGGCAGGATGTCTCGTG-3 ) spans the STAT1 translational initiation
site and is complementary to nucleotides 186-207. Primer 2 (5 TGGTCTCGTGTTCTTCTGTTCTG-3 ) covers the junction of exon 5 and 6 and
is complementary to bases 728-749. The actin mRNA was amplified using
primers that are commercially available.
|
|
 |
DISCUSSION |
In this report we describe the development and characterization of an
IFN -resistant human CTCL cell line (HUT78R) that may be used as a
model system for study of clinical resistance to IFN therapy. We
first sought to determine if IFN -binding and INFR expression are
altered in HUT78R cells. Our results showed that the levels of IFNR
mRNA were similar between HUT78S and HUT78R cells. In addition,
Scatchard analysis of the IFN -binding assay showed that dissociation
constants of IFNR between HUT78R and HUT78S cells were comparable.
Next, we examined if IFN -induced transcriptional activation was
affected in HUT78R cells. With oligo probes containing the ISRE
consensus sequence in gel shift assays, we found that IFN
stimulation failed to induce ISGF3 complex formation in HUT78R cells.
In addition, IFN -induced 2,5-OAS gene expression was inhibited
significantly in HUT78R cells, compared with HUT78S cells. The fourfold
to sixfold increase in 2,5-OAS gene expression observed in HUT78R cells
(in contrast to 20-fold increase in HUT78S cells) may be due to
activation of IFN response sequence (IRS)21 found in the
2,5-OAS promoter region. The IFN -induced gene
expression of histocompatibility locus antigen (HLA)-B7 and metallothionein-II gene, which both contain IRS element, was found to
be comparable between HUT78R and HUT78S cells (unpublished results).
Taken together, these results suggest a defect(s) in the activation of
JAK-STAT signaling pathway in HUT78R cells, resulting in inhibition of
ISGF3 formation (ie, ISRE binding), 2,5-OAS gene induction
and resistance to the growth inhibitory effect of IFN .
To identify and characterize such a defect(s), we first determined if
type-I IFNR-associated Janus kinases Tyk2 and Jak1 were activated on
IFN stimulation in the resistant cells. Our results showed that
IFN treatment induced in comparable levels of Tyk2 and Jak1 tyrosine
phosphorylation, suggesting that the IFN signaling defect in HUT78R
cells is probably not a result of Tyk2 or Jak1 dysfunction. We then
sought to determine the status of STAT protein activation by IFN
treatment in HUT78 cells. We failed to detect any STAT1 activation in
HUT78R cells. In contrast, IFN -induced similar levels of STAT2 and
STAT3 activation in HUT78R cells, compared with HUT78S cells. This
result suggests that the signaling defect in HUT78R cells is associated
only with STAT1. Immunoprecipitation and Western analyses failed to
detect any STAT1 ( and ) protein expressed in HUT78R cells,
explaining the lack of detection of STAT1 phosphorylation on IFN
treatment.
A number of IFN-( or ) resistant human tumor cell lines have been
reported previously.22-28 One was shown to lack expression of one IFNR component27 and the U3A cell line (U3A),
derived from high-frequency mutagenesis of the 2fTGH
cells,28 was shown to lack STAT1 expression. U3A cells were
unresponsive to the growth inhibitory effects of IFN and IFN . It
was shown that transfection of STAT1 cDNA into the U3A cells can
restore the cells' sensitivity to the growth inhibitory effect of
IFNs.29 More recently, STAT1 was shown to regulate the
expression of cyclin-dependent kinase (cdk2) inhibitor p21 at the
transcriptional level,30 indicating that STAT1 negatively
regulates the cell cycle progression. Taken together, STAT1 appears to
play a significant role in mediating cytokine signaling and regulation
of cell cycle.
IFN is the only known cytokine that activates STAT2, and STAT2
phosphorylation has been shown to be a prerequisite for STAT1 activation.31-32 However, lack of STAT1 activation did not
affect STAT2 phosphorylation induced by IFN in HUT78R cells, as
previously shown in U3A cells.33 Similarly, IFN
stimulation-induced STAT3 activation in both HUT78R and HUT78S cells.
Hence, absence of STAT1 in the HUT78R cells did not have any
significant effect on STAT3 activation, as shown previously in
STAT1 / embryonic stem cells.34 Tyk2
activation was shown to be obligatory to activation of Jak1, STAT1, and
STAT2 in IFN -mediated signaling.35 Our result showed
that IFN treatment-induced Tyk2 and Jak1 phosphorylation in both
HUT78R and HUT78S cells, showing the independence of STAT2 and STAT3
activation to STAT1.
In contrast to the antiproliferative effect of IFN on HUT78S cells,
increasing concentrations of IFN caused a marked stimulation of
growth in HUT78R cells (Fig 1). It is conceivable that lack of STAT1
may alter the balance of STAT complex formation, resulting in
inappropriate signaling and gene transcription. Whether IFN -induced activation of STAT3 and/or STAT2 in the absence of STAT1 is
associated with this accelerated growth of HUT78R cells, is a topic
which warrants future investigation. We also noted that STAT3 was
constitutively activated in both HUT78R and HUT78S cells (Fig 6C).
Others have reported constitutive activation of STAT3 in anaplastic
large T-cell lymphoma (ALTL), Sezary syndrome,36
leukemia,37 and to contribute to oncogenesis
by Src oncoprotein.38 Therefore, constitutive activation of
STAT3 in HUT78 cells may be associated with their neoplastic
characteristics.
The lack of STAT1 protein expression in HUT78R cells raises the
possibility of a null mutation in the STAT1 gene. Our RT-PCR analysis
failed to detect any STAT1 transcript in HUT78R cells, indicating that
the putative mutation results in inhibition of transcription or
expression of highly unstable mRNA. Comparative Southern blot analysis
of genomic DNA obtained from HUT78S and HUT78R cells revealed distinct
patterns of hybridization with a STAT1 cDNA probe (unpublished
results). This result supports the notion that HUT78R cells harbor a
STAT1 gene mutation(s) that results in lack of STAT1 expression.
Additional experiments are needed to define the nature of this mutation
in HUT78R cells. Because acquisition of clinical resistance to IFN
is commonly observed in CTCL, it will be of great significance to
determine if tumor cells isolated from patients with IFN resistance
lack STAT1 or have other defects in the IFN -signaling pathway.
Understanding the mechanism of clinical resistance to IFN at a
molecular level may lead to development of innovative treatment
strategies or alternative therapies.
 |
FOOTNOTES |
Submitted April 2, 1997;
accepted September 11, 1997.
Supported by a Leukemia Research Foundation grant (W.H.S.) and the NCI
Lurie Cancer Center Support Grant No. CA 60553-03.
Address correspondence to Wenn H. Sun, MD, PhD, Division
of Dermatology, Department of Pediatrics, Northwestern University Medical School; Children's Memorial Hospital, 2300 Children's Plaza/#203, Chicago, IL 60614.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section 1734 solely
to indicate this fact.
 |
ACKNOWLEDGMENT |
We thank Dr Amy Paller for her support.
 |
REFERENCES |
1.
Petska S,
Langer JA,
Zoon KC,
Samuel CE:
Interferons and their actions.
Annu Rev Biochem
56:727,
1987[Medline]
[Order article via Infotrieve]
2.
Platanias LC:
Interferons: Laboratory to clinic investigations.
Curr Opin Oncol
7:560,
1995[Medline]
[Order article via Infotrieve]
3.
Uze G,
Lutfalla G,
Mongensen KE:
And interferons and their receptor and their friends and relations.
J Interferon Res
15:3,
1995
4.
Darnell J,
Kerr IM,
Stark GR:
Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins.
Science
264:1415,
1994[Abstract/Free Full Text]
5.
Ihle JN,
Witthuhn BA,
Quelle FW,
Yamamoto K,
Thierfelder WE,
Kreider B,
Silvenoinen O:
Signaling by the cytokine receptor superfamily: JAKs and STATs.
Trends Biochem Sci
19:222,
1994[Medline]
[Order article via Infotrieve]
6.
Platanias LC,
Uddin S,
Colamonici OR:
Tyrosine phosphorylation of the alpha and beta subunits of the type I interferon receptor. Interferon-beta selectively induces tyrosine phosphorylation of an alpha subunit-associated protein.
J Biol Chem
269:17761,
1994[Abstract/Free Full Text]
7.
Platanias LC,
Colamonici OR:
Interferon alpha induces rapid tyrosine phosphorylation of the alpha subunit of its receptor.
J Biol Chem
267:24053,
1992[Abstract/Free Full Text]
8.
Meraz MA,
White JM,
Sheehan KCF,
Bach EA,
Rodig SJ,
Dighe AS,
Kaplan DH,
Riley JK,
Greenlund AC,
Campbell D,
Carver-Moore K,
DuBois RN,
Clark R,
Aguet M,
Schreiber RD:
Targeted disruption of the Stat1 gene in mice reveals unexpected physiological specificity in the JAK-STAT signaling pathway.
Cell
84:431,
1996[Medline]
[Order article via Infotrieve]
9.
Fu X-Y,
Schindler C,
Improta T,
Aebersold R,
Darnell JD:
The proteins of ISGF-3, the interferon alpha-induced transcriptional activator, define a gene family involved in signal transduction.
Biochemistry
89:7840,
1992
10.
Schindler C,
Fu X-Y,
Improta T,
Aebersold R,
Darnell JD:
Proteins of transcription factor ISGF-3: One gene encodes the 91- and 84-kDa ISGF-3 proteins that are activated by interferon alpha.
Proc Natl Acad Sci USA
89:7836,
1992[Abstract/Free Full Text]
11.
Qureshi SA,
Leung S,
Kerr IM,
Stark GR,
Darnell JE:
Function of Stat2 protein in transcriptional activation by alpha interferon.
Mol Cell Biol
16:288,
1996[Abstract]
12. The genomic structure of the murine ICSBP gene reveals the
presence of the gamma interferon-responsive element, to which an ISGF3
alpha subunit or similar molecule binds. Mol Cell Biol 13:3951, 1993
13.
Gutterman JU:
Cytokine therapeutics: Lessons from interferon .
Proc Natl Acad Sci USA
91:1198,
1994[Abstract/Free Full Text]
14.
Ross C,
Tingsgaard P,
Jorgensen H,
Veilsgaard GL:
Interferon treatment of cutaneous T cell lymphoma.
Eur J Haematol
51:63,
1993[Medline]
[Order article via Infotrieve]
15.
Kuzel TM,
Roenigk HH,
Samuelson E,
Herrmann JJ,
Hurria A,
Rademaker AW,
Rosen ST:
Effectiveness of interferon alpha-2a combined with phototherapy for mycosis fungoides and the Sezary syndrome.
J Clinic Oncol
13:257,
1995[Abstract/Free Full Text]
16. Steis RG, Smith II JW, Urba WJ, Venzon DJ, Longo DL, Barney R,
Evans LM, Itri LM, Ewel CH: Loss of interferon antibodies during
prolonged continuous interferon- 2a therapy in hairy cell leukemia.
Blood 77:792, 1991
17.
Del Mel WCP,
Hoffbrand AV,
Giles FJ,
Goldstone AH,
Mehta AB,
Ganeshaguru K:
Alpha interferon therapy for haematological malignancies: Correlation between in vivo induction of 2 5 oligoadenylate synthetase and clinical response.
Brit J Haematol
74:452,
1990[Medline]
[Order article via Infotrieve]
18.
Rutherford MN,
Hannigan GE,
Williams BRG:
Interferon-induced binding of nuclear factors to promoter elements of the 2-5A synthetase gene.
EMBO J
7:751,
1988[Medline]
[Order article via Infotrieve]
19.
Uze G,
Lutfalla G,
Gresser I:
Genetic transfer of a functional human interferon alpha receptor into mouse cells: Cloning and expression of its cDNA.
Cell
60:225,
1990[Medline]
[Order article via Infotrieve]
20.
Gazdar AF,
Carney DN,
Bunn PA,
Russel EK,
Jaffe ES,
Schechter GP,
Guccion JG:
Mitogen requirements for the in vitro propagation of cutaneous T cell lymphoma.
Blood
55:409,
1980[Free Full Text]
21.
Friedman RL,
Stark GR:
Alpha-interferon-induced transcription of HLA and metallothionein genes containing homologous upstream sequences.
Nature
314:637,
1985[Medline]
[Order article via Infotrieve]
22.
Verhaegen M,
Divizia M,
Vandenbussche P,
Kuwata T,
Content J:
Abnormal behavior of interferon-induced enzymatic activities in an interferon-resistant cell line.
Proc Natl Acad Sci USA
77:4479,
1980[Abstract/Free Full Text]
23.
Tovey MG,
Dron M,
Mogensen KE,
Lebleu B,
Mechti N,
Begonlours-Guymarho J:
Isolation of Daudi cells with reduced sensitivity to interferon II. On the mechanism of resistance.
J Gen Virol
64:2649,
1983[Abstract/Free Full Text]
24.
Morikawa K,
Morikawa R,
Killion JJ,
Fan D,
Fidler IJ:
Isolation of human colon carcinoma cells for resistance to a single interferon associated with cross-resistance to multiple recombinant interferons: Alpha, beta, and gamma.
J Natl Cancer Inst
82:517,
1990[Abstract/Free Full Text]
25.
Gomi K,
Akinaga S,
Oka T,
Morimoto M:
Analysis of receptors, cell surface antigens, and proteins in human melanoma cell lines resistant to human recombinant beta- or gamma-interferon.
Cancer Res
46:6211,
1986[Abstract/Free Full Text]
26.
Colamonici OR,
Porterfield B,
Domanski P,
Constantinescu S,
Pfeffer LM:
Complementation of the interferon response in resistant cells by expression of the cloned subunit of the interferon receptor.
J Biol Chem
13:9598,
1994
27.
Abramovich C,
Shulman LM,
Ratovitski E,
Harroch S,
Tovey M,
Eid P,
Revel M:
Differential tyrosine phosphorylation of the IFNR chain of the type I interferon receptor and of an associated surface protein in response to IFN and IFN .
EMBO J
13:5871,
1994[Medline]
[Order article via Infotrieve]
28.
McKendry R,
John J,
Flavell D,
Muller M,
Kerr IM,
Stark GR:
High frequency mutagenesis of human cells and characterization of a mutant unresponsive to both and interferons.
Proc Natl Acad Sci USA
88:11455,
1991[Abstract/Free Full Text]
29. Bromberg JF, Horvath CM, Wen Z, Schreiber RD, Darnell JE, Jr:
Transcriptionally active STAT1 is required for the antiproliferative
effects of both interferon and interferon . Proc Natl Acad Sci USA
93:7673, 1996
30.
Chin YE,
Kitagawa M,
Su W-US,
You Z-H,
Iwamoto Y,
Fu X-Y:
Cell growth arrest and induction of cyclin-dependent kinase inhibitor p21waf1/cipi mediated by STAT1.
Science
272:719,
1996[Abstract]
31.
Leung S,
Qureshi SA,
Kerr IM,
Darnell JE,
Stark GR:
Role of STAT2 in the alpha interferon signaling pathway.
Mol Cell Biol
15:1312,
1995[Abstract]
32. Qureshi SA, Leung S, Kerr IM, Stark GR, Darnell JE, Jr: Function
of STAT2 protein in transcriptional activation by alpha interferon. Mol
Cell Biol 16:288, 1996
33.
Improta T,
Schindler C,
Horvath CM,
Kerr IM,
Stark GR,
Darnell JE:
Transcription factor ISGF3 formation requires phosphorylated STAT91 protein, but STAT113 protein is phosphorylated independently of STAT91 protein.
Proc Natl Acad Sci USA
91:4776,
1994[Abstract/Free Full Text]
34.
Durbin JE,
Hackenmiller R,
Celeste Simon M,
Levy DE:
Targeted disruption of the mouse STAT1 gene results in compromised innate immunity to viral disease.
Cell
84:443,
1996[Medline]
[Order article via Infotrieve]
35.
Velazquez L,
Mogensen KE,
Barbieri G,
Fellous M,
Uze G,
Pellegrini S:
Distinct domains of the protein tyrosine kinase tyk2 required for binding of interferon- / and for signal transduction.
J Biol Chem
270:3327,
1995[Abstract/Free Full Text]
36.
Zhang Q,
Nowak I,
Vondeerheid EC,
Rook AH,
Kadin ME,
Nowell PC,
Shaw LM,
Wasik MA:
Activation of Jak/STAT proteins involved in signal transduction pathway mediated by receptor for interleukin-2 in malignant T lymphocytes derived from cutaneous anaplastic large T-cell lymphoma and Sezary syndrome.
Proc Natl Acad Sci USA
93:9148,
1996[Abstract/Free Full Text]
37.
Gouilleux-Gruart V,
Gouilleux F,
Desaint C,
Claisse J-F,
Capiod J-C,
Delobel J,
Weber-Nordt R,
Dusanter-Fourt I,
Dreyfus F,
Groner B,
Prin L:
STAT-related transcription factors are constitutively activated in peripheral blood cells from acute leukemia patients.
Blood
87:1692,
1996[Abstract/Free Full Text]
38.
Yu C-L,
Meyer DJ,
Campbell GS,
Larner AC,
Carter-Su C,
Schwartz J,
Jove R:
Enhanced DNA-binding activity of a Stat3-related protein in cells transformed by the Src oncoprotein.
Science
269:81,
1995[Abstract/Free Full Text]

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
P. Devaux, G. Hodge, M. B. McChesney, and R. Cattaneo
Attenuation of V- or C-Defective Measles Viruses: Infection Control by the Inflammatory and Interferon Responses of Rhesus Monkeys
J. Virol.,
June 1, 2008;
82(11):
5359 - 5367.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Dedieu, B. Langlois, J. Devy, B. Sid, P. Henriet, H. Sartelet, G. Bellon, H. Emonard, and L. Martiny
LRP-1 Silencing Prevents Malignant Cell Invasion despite Increased Pericellular Proteolytic Activities
Mol. Cell. Biol.,
May 1, 2008;
28(9):
2980 - 2995.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. B. Lesinski, J. Trefry, M. Brasdovich, S. V. Kondadasula, K. Sackey, J. M. Zimmerer, A. R. Chaudhury, L. Yu, X. Zhang, T. R. Crespin, et al.
Melanoma Cells Exhibit Variable Signal Transducer and Activator of Transcription 1 Phosphorylation and a Reduced Response to IFN-{alpha} Compared with Immune Effector Cells
Clin. Cancer Res.,
September 1, 2007;
13(17):
5010 - 5019.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Ramos, P. Ruiz Jr, L. Ratner, I. M. Reis, C. Brites, C. Pedroso, G. E. Byrne Jr, N. L. Toomey, V. Andela, E. W. Harhaj, et al.
IRF-4 and c-Rel expression in antiviral-resistant adult T-cell leukemia/lymphoma
Blood,
April 1, 2007;
109(7):
3060 - 3068.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Krishnamurthy, T. Takimoto, R. A. Scroggs, and A. Portner
Differentially regulated interferon response determines the outcome of newcastle disease virus infection in normal and tumor cell lines.
J. Virol.,
June 1, 2006;
80(11):
5145 - 5155.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Heinzerling, V. Kunzi, P. A. Oberholzer, T. Kundig, H. Naim, and R. Dummer
Oncolytic measles virus in cutaneous T-cell lymphomas mounts antitumor immune responses in vivo and targets interferon-resistant tumor cells
Blood,
October 1, 2005;
106(7):
2287 - 2294.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Benekli, M. R. Baer, H. Baumann, and M. Wetzler
Signal transducer and activator of transcription proteins in leukemias
Blood,
April 15, 2003;
101(8):
2940 - 2954.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Tracey, R. Villuendas, P. Ortiz, A. Dopazo, I. Spiteri, L. Lombardia, J. L. Rodriguez-Peralto, J. Fernandez-Herrera, A. Hernandez, J. Fraga, et al.
Identification of Genes Involved in Resistance to Interferon-{alpha} in Cutaneous T-Cell Lymphoma
Am. J. Pathol.,
November 1, 2002;
161(5):
1825 - 1837.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Lindner, X. Ma, J. Hu, S. Karra, and D. V. Kalvakolanu
Thioredoxin Reductase Plays a Critical Role in IFN Retinoid-mediated Tumor-Growth Control in Vivo
Clin. Cancer Res.,
October 1, 2002;
8(10):
3210 - 3218.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. H. Wong, H. Sim, M. Chatterjee-Kishore, I. Hatzinisiriou, R. J. Devenish, G. Stark, and S. J. Ralph
Isolation and Characterization of a Human STAT1 Gene Regulatory Element. INDUCIBILITY BY INTERFERON (IFN) TYPES I AND II AND ROLE OF IFN REGULATORY FACTOR-1
J. Biol. Chem.,
May 24, 2002;
277(22):
19408 - 19417.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Bergmann, I. Romirer, M. Sachet, R. Fleischhacker, A. Garcia-Sastre, P. Palese, K. Wolff, H. Pehamberger, R. Jakesz, and T. Muster
A Genetically Engineered Influenza A Virus with ras-Dependent Oncolytic Properties
Cancer Res.,
November 1, 2001;
61(22):
8188 - 8193.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. D. Eason and G. Blanck
High Level Class II trans-Activator Induction Does Not Occur with Transient Activation of the IFN-{{gamma}} Signaling Pathway
J. Immunol.,
January 15, 2001;
166(2):
1041 - 1048.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Dummer, U. Dobbeling, R. Geertsen, J. Willers, G. Burg, and J. Pavlovic
Interferon resistance of cutaneous T-cell lymphoma-derived clonal T-helper 2 cells allows selective viral replication
Blood,
January 15, 2001;
97(2):
523 - 527.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. S. Siegel, T. Pandolfino, J. Guitart, S. Rosen, and T. M. Kuzel
Primary Cutaneous T-Cell Lymphoma: Review and Current Concepts
J. Clin. Oncol.,
August 15, 2000;
18(15):
2908 - 2925.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Takane, S. Ohdo, T. Yamada, E. Yukawa, and S. Higuchi
Chronopharmacology of Antitumor Effect Induced by Interferon-beta in Tumor-Bearing Mice
J. Pharmacol. Exp. Ther.,
August 1, 2000;
294(2):
746 - 752.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
D. Zella, F. Romerio, S. Curreli, P. Secchiero, C. Cicala, D. Zagury, and R. C. Gallo
IFN-{alpha}2b Reduces IL-2 Production and IL-2 Receptor Function in Primary CD4+ T Cells
J. Immunol.,
March 1, 2000;
164(5):
2296 - 2302.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. C. Ward, I. Touw, and A. Yoshimura
The Jak-Stat pathway in normal and perturbed hematopoiesis
Blood,
January 1, 2000;
95(1):
19 - 29.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. R. Karpf, P. W. Peterson, J. T. Rawlins, B. K. Dalley, Q. Yang, H. Albertsen, and D. A. Jones
Inhibition of DNA methyltransferase stimulates the expression of signal transducer and activator of transcription 1, 2, and 3 genes in colon tumor cells
PNAS,
November 23, 1999;
96(24):
14007 - 14012.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Gupta, M. Jiang, and A. B. Pernis
IFN-{alpha} Activates Stat6 and Leads to the Formation of Stat2:Stat6 Complexes in B Cells
J. Immunol.,
October 1, 1999;
163(7):
3834 - 3841.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|