Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rivas, C. I.
Right arrow Articles by Golde, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rivas, C. I.
Right arrow Articles by Golde, D. W.
Related Collections
Right arrow Neoplasia
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 91 No. 3 (February 1), 1998: pp. 1037-1043

Expression of Granulocyte-Macrophage Colony-Stimulating Factor Receptors in Human Prostate Cancer

By Coralia I. Rivas, Juan Carlos Vera, Fernando Delgado-López, Mark L. Heaney, Victor H. Guaiquil, Rong H. Zhang, Howard I. Scher, Ilona I. Concha, Francisco Nualart, Carlos Cordon-Cardo, and David W. Golde

From the Program in Molecular Pharmacology and Therapeutics, Departments of Medicine and Pathology, Memorial Sloan-Kettering Cancer Center, New York, NY; Instituto de Bioquímica, Facultad de Ciencias, Universidad Austral de Chile, Valdivia, Chile; and Departamento de Histología y Embriología, Facultad de Ciencias Biológicas, Universidad de Concepción, Concepción, Chile.


    ABSTRACT
Abstract
Introduction
Methods
Results
Discussion
References

We studied the expression and function of the granulocyte-macrophage colony-stimulating factor (GM-CSF) receptor in the human prostate carcinoma cell line LNCaP and looked for its presence in normal and neoplastic human prostatic tissue. The GM-CSF receptor is composed of two subunits, alpha  and beta . While the isolated alpha  subunit binds GM-CSF at low-affinity, the isolated beta  subunit does not bind GM-CSF by itself; but complexes with the alpha  subunit to form a high-affinity receptor. Quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) showed expression of mRNAs encoding the alpha  and beta  subunits of the GM-CSF receptor in LNCaP cells, and the presence of the alpha  and beta  proteins was confirmed by immunolocalization with anti-alpha and anti-beta antibodies. Receptor binding studies using radiolabeled GM-CSF showed that LNCaP cells have about 150 high-affinity sites with a kd of 40 pmol/L and approximately 750 low-affinity sites with a kd of 2 nmol/L. GM-CSF signaled, in a time- and dose-dependent manner, for protein tyrosine phosphorylation and induced the proliferation of the LNCaP cells. Immunolocalization studies showed low level expression of GM-CSF alpha  and beta  subunits in normal prostate tissue, with substantial expression in benign prostatic hyperplasia and prominent expression in neoplastic prostate tissue. Maximal expression of both subunits was observed in prostatic carcinomas metastatic to lymph node and bone. Tumor cells that stained positively with anti-alpha subunit antibodies were also reactive with anti-beta subunit antibodies, indicating that they express high-affinity GM-CSF receptors. Our data show that the LNCaP cells express functional GM-CSF receptors and that prostatic carcinomas have prominent GM-CSF receptor expression. These findings imply that both hyperplastic and neoplastic prostatic tissues may be responsive to GM-CSF.

    INTRODUCTION
Abstract
Introduction
Methods
Results
Discussion
References

GRANULOCYTE-MACROPHAGE colony-stimulating factor (GM-CSF) is an important regulator of the proliferation and differentiation of myeloid precursor cells and enhances the function of mature granulocytes and mononuclear phagocytes.1 Receptors for GM-CSF are expressed on myeloid progenitors and mature mononuclear phagocytes, monocytes, eosinophils and neutrophils.1-4 The GM-CSF receptor is composed of two subunits, alpha  and beta .5,6 The isolated alpha  subunit binds GM-CSF at low affinity (kd, 1 to 7 nmol/L). The isolated beta  subunit does not bind GM-CSF by itself; however, in a complex with the alpha  subunit forms a high-affinity receptor (kd, 20 to 100 pmol/L). The binding of GM-CSF to its cognate receptor triggers a number of cellular responses.7-12 In human neutrophils, GM-CSF induces increased protein tyrosine phosphorylation through the activation of specific protein tyrosine cascades9,13-15 and transcriptional activation of early genes such as c-fos, c-jun, and c-myc.16 Signaling through the GM-CSF receptor may occur via participation of both alpha  and beta  subunits5,10,17,18 and also through the isolated alpha  subunit.19,20

Receptors for GM-CSF are also present in nonhematopoietic cells such as placental trophoblasts, endothelial cells, and oligodendrocytes in the central nervous system.21-24 Some primary neoplasms and tumor cell lines such as melanoma, small cell lung cancer, colon, pancreatic, renal, and ovarian carcinomas have also been reported to express GM-CSF receptors.25-29

Although there is evidence indicating that GM-CSF may stimulate the growth of some nonhematopoietic tumor cell lines,29-34 the physiologic role of the GM-CSF receptors expressed in normal or neoplastic nonhematopoietic tissue is unknown. In these studies, we provide evidence that human LNCaP prostate cancer cells express functional high-affinity GM-CSF receptors that transduce signals involving protein tyrosine phosphorylation and cell proliferation. We also show that the alpha  and beta  subunits of the GM-CSF receptor are expressed at low level in normal human prostatic tissue, with substantial expression in benign prostatic hyperplasia and prominent expression in prostatic carcinoma.

    MATERIALS AND METHODS
Abstract
Introduction
Methods
Results
Discussion
References

Cell culture.   The human prostatic cell line LNCaP35 was cultured in RPMI-1640 supplemented with 6% heat-inactivated fetal bovine serum, 1% L-glutamine, and antibiotics. The human leukemia cell line HL-6036 was maintained in Iscove's modified Dulbecco's medium (IMDM) supplemented with 10% heat-inactivated fetal bovine serum, 1% L-glutamine, and antibiotics.

Proliferation assay.   Cell proliferation was assessed by [3H]-thymidine37 and [125I]-deoxyuridine incorporation. Briefly, 40,000 cells per well were plated in sextuplicate in 6-well plates (Costar, Cambridge, MA), and bacterial recombinant human GM-CSF (0.01 to 100 mmol/L) (a gift from Amgen, Thousand Oaks, CA) was added at the beginning of the culture. Every day for 6 days of culture, 2 µCi of [3H]-thymidine (DuPont NEN, Boston, MA) or 0.45 µCi of [125I]-dUridine (DuPont NEN) was added to each well. The cells were harvested after 20 hours using a cell harvester (Skatron, Sterling, VA) or extracted with 1 N NaOH. The radioactivity incorporated into DNA was quantitated by liquid scintillation or gamma  spectrometry.

Reverse transcription-polymerase chain reaction (RT-PCR).   Total RNA was isolated from LNCaP and HL-60 cells using guanidinium thiocyanate (RNAzol B, Cinna/Biotecx Laboratories, Houston, TX). Single-stranded cDNA synthesis and quantitative PCR were performed as previously described.38 The primers used were: alpha -subunit primer: 5':AGCCCGAGCAAAACACA, position 1009-1026 and 3':CCATGCCA TTCCTACACCCT, position 1360-1379; beta -subunit primer: 5':CTACAAGCCCAGCCC AGATGC, position 859-879 and 3':ACCCGTAGATGCCACAGAAGC, position 1390-1410. The PCR conditions were 94°C for 1 minute and 65°C for 2 minutes for 35 cycles. For quantitation of the beta  subunit, the GM-CSF receptor beta  cDNA subcloned into pBluescript (Stratagene, La Jolla, CA) was transcribed in vitro (Megascript, Ambion, Austin, TX) and the RNA was digested with DNase and quantitated spectrophotometrically and by the addition of trace levels of [alpha 32P] uridine triphosphate (UTP) (DuPont NEN). RT-PCR of serial dilutions was performed in the presence of 1 µg of RNA derived from HeLa cells, a cell line that does not express the beta  subunit.

Binding assays.   For binding assays, 7 × 106 cells were suspended in RPMI-1640 containing 0.2% bovine serum albumin (BSA) and increasing concentrations of 125I-labeled human GM-CSF (DuPont NEN) with or without excess unlabeled human GM-CSF. After incubation for 20 hours at 4°C, the cells were centrifuged for 5 minutes at 4°C through a cushion of fetal bovine serum and the cell pellets were washed with cold phosphate-buffered saline (PBS) pH 7.4. Bound GM-CSF was quantitated by gamma  spectrometry.

Immunoblotting.   Cells were serum starved in RPMI-1640 containing 0.2% BSA for 18 hours, washed, resuspended at 1 × 107 cells/mL and incubated in the absence or in the presence of increasing concentrations of GM-CSF (0.01 nmol/L to 1 µmol/L) for different periods of time (2 seconds to 20 minutes) at 37°C. The cells were washed with cold PBS and the cell pellets were resuspended in 100 µL of lysis buffer14 and disrupted by sonication. The soluble proteins were resolved by SDS-PAGE (100 µg of cell lysate per lane) in a 10% polyacrylamide gel and transferred to immobilon (Millipore, Bedford, MA). Proteins phosphorylated on tyrosine residues were detected using an antiphosphotyrosine antibody (UBI, Lake Placid, NY). Phosphorylated mitogen-activated protein (MAP) kinase was localized using an antiphosphoMAP kinase antibody (New England Biolabs, Beverly, MA). Anti-JAK2 antibody was purchased from UBI. The antibody blots were developed by chemiluminescence (New England Biolabs).

Immunocytochemistry.   For immunoperoxidase localization,39 LNCaP cells cultured in 6-chamber microscopic slides were fixed in buffered paraformaldehyde-acetone, treated with 0.3% H2O2 for 5 minutes and incubated for 30 minutes at room temperature in 4% BSA-PBS pH 7.8, followed by incubation overnight at 4°C in 1% BSA-PBS pH 7.8 and anti-alpha or anti-beta GM-CSF receptor subunit antibodies (1:500) (Alpha Diagnostics, San Antonio, TX). Cells were washed and incubated with antirabbit IgG-horseradish peroxidase (1:100) (Amersham, Arlington Heights, IL) for 2.5 hours at room temperature. Immunostaining was developed using 0.05% diaminobenzidine and 0.03% H2O2. As controls, cells were incubated with antibodies preabsorbed with the respective peptide used to generate the antibodies. Cells were counterstained with hematoxylin.

Archived, formalin fixed, and paraffin embedded human prostate tissues were obtained from the Department of Pathology at Memorial Sloan-Kettering Cancer Center. For immunostaining,39 tissue sections were rehydrated, treated with 3% hydrogen peroxide for 15 minutes at room temperature, and blocked with 4% BSA-PBS pH 7.8, followed by incubation in a humid chamber overnight at 4°C with anti-alpha or anti-beta subunit GM-CSF receptor antibodies (1:500) in 1% BSA-PBS pH 7.8. After extensive washing, sections were incubated for 2.5 hours at room temperature with antirabbit IgG-horseradish peroxidase (1:100, Amersham). The peroxidase activity was developed with 0.05% diaminobenzidine and 0.03% H2O2. Tissues were counterstained with hematoxylin.

    RESULTS
Abstract
Introduction
Methods
Results
Discussion
References

LNCaP cells express GM-CSF receptors.   A band of approximately 370 nucleotides, the expected size of the amplification product for the membrane-bound form of the alpha -subunit mRNA, was amplified by RT-PCR from LNCaP cells RNA (Fig 1A). Primers specific for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used as an internal standard for the efficacy of the RT-PCR procedure. A similar approach using primers complementary to the beta  subunit of the GM-CSF receptor showed the expected amplification product of approximately 570 nucleotides (Fig 1A). The size of the amplified bands corresponded exactly to the size of the respective bands amplified from RNA obtained from HL-60 cells, which express abundant mRNA for the alpha  and the beta  subunits of the GM-CSF receptor (Fig 1A).38 No amplification products were observed in parallel reactions in which the reverse transcriptase was omitted (Fig 1A), confirming the absence of contaminating DNA in the RNA preparations. The content of alpha  and beta  subunit mRNAs in LNCaP cells was quantitated by interpolation on a standard curve generated by performing RT-PCR with known amounts of either alpha  or beta  subunit RNA in parallel with LNCaP cell-derived RNA. LNCaP cells expressed 0.02 to 0.33 fg of alpha  subunit mRNA per 105 cells (0.24 to 4 copies per 103 cells), a value that is 60 to 200 times lower than the alpha  subunit mRNA levels expressed in HL-60 cells (Fig 1A). LNCaP cells expressed 12 to 83 fg of beta  subunit mRNA per 105 cells (80 to 550 copies per 103 cells), which is 30 to 200 times lower than the beta  subunit mRNA levels expressed in HL-60 cells (Fig 1A). LNCaP cells also expressed low levels of mRNA encoding the soluble isoform of the alpha  subunit (data not shown).


View larger version (64K):
[in this window]
[in a new window]
 
Fig 1. Expression of GM-CSF receptors in LNCaP cells. (A) RT-PCR analysis. Total RNA was isolated from LNCaP (lane 1) or HL-60 (lane 2) cells and subjected to RT-PCR using radiolabeled primers specific for the alpha  (left panel) or the beta  (right panel) subunits of the GM-CSF receptor. PCR products were size-fractionated on 5% acrylamide gels and autoradiographed. Shown are the PCR products corresponding to the alpha  (370 bp) and the beta  (570 bp) subunits of the GM-CSF receptor obtained in the presence (+) or in the absence (-) of reverse transcriptase (RT). (B) Binding analysis. Cells were incubated with radiolabeled GM-CSF at concentrations that ranged from 5 pmol/L to 10 nmol/L. GM-CSF binding was dose dependent and saturable approximately at 10 nmol/L. (C) Scatchard analysis of data from (B) showing the presence of two classes of binding sites in the LNCaP cells. (D through G) Immunostaining with antihuman GM-CSF receptor antibodies. Cells were cultured, fixed, and incubated with anti-alpha (D and F) or anti-beta subunit (E and G) antibodies in the absence (D and E) or the presence (F and G) of the peptides used to elicit them (original magnification × 160).

Radiolabeled GM-CSF bound to LNCaP cells in a dose-dependent and saturable manner (Fig 1B). Scatchard analysis of the binding data (Fig 1C) showed that the LNCaP cells expressed approximately 150 high-affinity binding sites for GM-CSF with a kd of 40 pmol/L, and 750 low-affinity binding sites. The presence of the alpha  and beta  subunits of the GM-CSF receptor in the LNCaP cells was confirmed by immunolocalization with antibodies specific for each subunit. The LNCaP cells were immunoreactive with both antibodies, with intense immunostaining in both the cytoplasm and the plasma membrane (Fig 1D and F). The LNCaP cells consistently showed enhanced immunoreactivity with the anti-alpha antibody compared with the anti-beta antibody. No immunoreactivity was observed when the primary antibodies were preabsorbed with the peptides used to generate them (Fig 1E and G).

GM-CSF signaling in LNCaP cells.   Proliferation assays, measuring the incorporation of [3H]-thymidine or [125I]-deoxyuridine in DNA, showed that GM-CSF stimulated proliferation of the LNCaP cells in a dose- and time-dependent manner (Fig 2B and C; only [3H]-thymidine incorporation is shown). An increase in [3H]-thymidine incorporation of 20% to 40% was observed after 3 or 4 days of culture in the presence of 0.3 or 100 nmol/L GM-CSF (Fig 2B). The effect of GM-CSF on [3H]-thymidine incorporation was evident during the exponential phase of cell growth and decreased at latter stages (Fig 2A and B). Dose-response studies indicated a biphasic effect of GM-CSF on [3H]-thymidine incorporation (Fig 2C). GM-CSF induced a measurable increase in [3H]-thymidine at a concentration of 0.03 nmol/L, an effect that reached saturation at 1 nmol/L GM-CSF, with no further increase observed at concentrations of GM-CSF from 1 to 30 nmol/L. However, 100 nmol/L GM-CSF induced an additional increase in [3H]-thymidine incorporation, which was also evident in the time-course experiments (Fig 2B and C).


View larger version (21K):
[in this window]
[in a new window]
 
Fig 2. GM-CSF signals for proliferation in LNCaP cells. (A) Growth curve. LNCaP cells were maintained in continuous culture with no stimulation and the cell number was determined by counting the cells every day for 6 days and the cell viability was assessed by exclusion of trypan blue. (B) Time course. Cells were incubated with 0.3 (bullet ) or 100 nmol/L (open circle ) GM-CSF for 1 to 6 days and parallel cultures were pulse-labeled with [3H]-thymidine for 20 hours every day. (C) Dose response. Cells were incubated with increased amounts of GM-CSF (0.01 to 100 nmol/L) for 3 (bullet ) or 4 days (open circle ) and pulse-labeled with [3H]-thymidine for the last 20 hours.

We next analyzed whether GM-CSF induced protein tyrosine phosphorylation in the LNCaP cells. A transient increase in tyrosine phosphorylation was observed in several proteins when LNCaP cells were treated with GM-CSF (Fig 3A). Proteins with apparent molecular weights of 160, 130, 75 to 80, 68 to 70, 60, 55, 47, and 40 kD (black arrowheads, Fig 3A) showed maximal phosphorylation during the first 30 seconds of treatment with 1 nmol/L GM-CSF and remained phosphorylated for 20 minutes, with phosphorylation returning to basal levels after 1 to 2 hours (Fig 3A). Phosphorylation of these proteins was induced at concentrations of GM-CSF ranging from 0.03 nmol/L to 1 µmol/L (Fig 3A). Interestingly, we observed the rapid dephosphorylation of proteins with an apparent molecular weight of 45 and 110 kD after incubating the cells with 1 nmol/L GM-CSF (white arrowheads, Fig 3A). These proteins were dephosphorylated after treating the cells with GM-CSF at concentrations from 0.03 nmol/L to 1 µmol/L and remained dephosphorylated for at least 18 hours (Fig 3A).


View larger version (47K):
[in this window]
[in a new window]
 
Fig 3. GM-CSF signals for protein tyrosine phosphorylation in LNCaP cells. (A) Protein tyrosine phosphorylation. Cells were incubated in the absence (-) or in the presence (+) of 1 nmol/L GM-CSF from 2 seconds to 20 minutes at 37°C (upper panel), or with 0.01 nmol/L to 1 µmol/L GM-CSF for 2 minutes at 37°C (bottom panel). Tyrosine phosphoproteins were identified by immunoblotting with antiphosphotyrosine antibodies. Black and white arrowheads indicate proteins phosphorylated and dephosphorylated in response to GM-CSF, respectively. (B) Phosphorylation of MAP kinase. Cells were incubated with 10 pmol/L to 0.3 µmol/L GM-CSF for 1 minute at 37°C, or were incubated in the absence (-) or in the presence (+) of 100 nmol/L GM-CSF from 2 seconds to 20 minutes at 37°C. Phosphorylation of MAP kinase was assessed by immunoblotting with an antiphospho MAP kinase antibody. MAP kinase was identified with an anti-MAP kinase antibody. The arrowheads indicate the positions of the p42 and p44 MAP kinases.

We did not detect tyrosine phosphorylation of MAP kinase in LNCaP cells treated with GM-CSF using antiphosphotyrosine antibodies (Fig 3A). The p42 MAP kinase was identified by reprobing the membrane with an anti-MAP kinase antibody and was found to be present at a constant level at the expected position in the blots (Fig 3B). Phosphorylation of MAP kinase, however, was evident when using a monoclonal antibody specific for tyrosine phosphorylated MAP kinase (Fig 3B). Phosphorylation of MAP kinase occurred only at concentrations of GM-CSF of 3 nmol/L or higher and reached a maximal level at 100 nmol/L GM-CSF. Maximal phosphorylation was observed at 30 seconds, with phosphorylation returning to basal levels after 20 minutes (Fig 3B). No phosphorylation of JAK2 was evident in cells treated with GM-CSF.

Increased expression of GM-CSF receptors in human prostate tumors.   We examined whether the alpha  and beta  subunits of the GM-CSF receptor were expressed in normal prostate, benign prostatic hyperplasia, and prostatic carcinomas, including primary tumors and metastatic lesions to lymph node and bone (Fig 4 and Table 1). Very weak to undetectable immunostaining was observed in the luminal epithelial cells of the acini of the normal prostate, although weak to moderate reactivity was evident in basal cells (Fig 4). Ducts exhibited a more intense immunoreactivity than acini for both antibodies. Moderate immunostaining was also found in the epithelial cells of most of the samples of benign prostatic hyperplasia analyzed with both antibodies, although moderate to strong reactivity was observed in two specimens (Fig 4). In addition, basal cell hyperplasia, a histologically different form of hyperplasia, was seen in one sample and displayed strong reactivity with both antibodies. All primary tumors analyzed, which exhibited Gleason scores from 5 to 9, were positive for both antibodies, with homogeneous and heterogeneous staining patterns of moderate to strong intensity (Fig 4 and Table 1). The metastatic tumors displayed homogeneity, as well as heterogeneity in immunostaining profiles, with moderate to strong reactivity to both antibodies and had increased staining compared with the primary tumors (Fig 4). One sample from a bone metastasis was negative for both antibodies. Tumor cells that were immunopositive for the anti-alpha antibody were also positive for the anti-beta antibody, as immunohistochemistry was conducted in consecutive sections and numerous lesions showed homogeneous staining. In addition, most of the cases studied showed a more intense anti-alpha immunoreactivity than the anti-beta immunoreaction.


View larger version (136K):
[in this window]
[in a new window]
 
Fig 4. Immunolocalization of GM-CSF receptors in benign and malignant human prostate tissues. Consecutive tissue sections were incubated with anti-alpha (left panel) or anti-beta -subunit (right panel) antibodies. (A) Low to undetectable levels in the epithelial cells of the normal gland. (B) Moderate levels of expression in the epithelial cells of benign prostatic hyperplasia. (C) Increased immunoreactive pattern in a primary tumor. (D) High levels of expression in a lymph node and a bone (E) metastases. Stars in bone metastases images indicate bone location. Two different magnifications of each immunostained tissue section are shown (160× and 400×).

 
View this table:
[in this window] [in a new window]
 
Table 1. Expression of GM-CSF Receptors in Human Prostatic Tissue

    DISCUSSION
Abstract
Introduction
Methods
Results
Discussion
References

GM-CSF is a hematopoietic growth factor and a host defense regulator used clinically to stimulate hematopoietic cell proliferation after chemotherapy, as well as autologous or allogeneic bone marrow transplantation.40-42 The physiologic role of GM-CSF receptors in nonhematopoietic tissue is unknown. Even more problematic are the implications and consequences of GM-CSF receptor expression on malignant, nonhematopoietic tissue. Distinct types of neoplastic cells have been shown to have functional GM-CSF receptors.25,30,31 Whether or not therapeutically administered hematopoietic growth factors can stimulate nonhematopoietic cell growth, including solid tumor cells, has remained a controversial issue.

We report here a detailed study addressing the issue of GM-CSF receptor expression in human prostate cancer. The presence of GM-CSF receptors in the LNCaP cells was defined by quantitative RT-PCR, ligand binding, immunolocalization, and functional assays. Quantitative RT-PCR showed that the LNCaP cells expressed mRNAs for the alpha  and beta  subunits of the GM-CSF receptor. The immunolocalization experiments confirmed the presence of the alpha  and beta  proteins in the LNCaP cells and the ligand-binding studies showed that LNCaP expressed both high- and low-affinity GM-CSF receptors. The number of high-affinity receptors present in the LNCaP cells was similar to the number present in cells of hematopoietic origin in which GM-CSF induces proliferation and differentiation43 and in nonhematopoietic cells such as mouse fibroblasts expressing the human high-affinity receptors, which respond to GM-CSF with cell proliferation and protein phosphorylation.10,44 The identification of approximately 750 low-affinity GM-CSF receptors in the LNCaP cells, compared with about 150 high-affinity sites, indicates the presence of an excess of alpha  as compared with beta  subunit in these cells. Consistent with these findings, the immunolocalization experiments showed greater immunoreactivity with the anti-alpha subunit antibodies than with the anti-beta subunit antibodies in the LNCaP cells. The RT-PCR experiments, however, indicated that LNCaP cells express a higher number of mRNA molecules per cell encoding the beta  than the alpha  subunit of the GM-CSF receptor. These data suggest that, in the LNCaP cells, the expression of the alpha  and beta  subunit proteins is regulated at the level of translation or protein stability.

Biologic response analyses confirmed the presence of functionally active GM-CSF receptors in the LNCaP cells. A previous study34 reported a 2.8-fold increase in LNCaP cell proliferation in the presence of suprapharmacologic concentrations of GM-CSF (>1 µmol/L). These concentrations of GM-CSF are at least four orders of magnitude higher than the concentrations we used here (approx 100 pmol/L) and are not compatible with the expression of high-affinity GM-CSF receptors in the LNCaP cells. On the other hand, although our data indicated that GM-CSF increased LNCaP cell proliferation at concentrations consistent with the presence of high-affinity receptors in these cells, these concentrations of GM-CSF (approx 100 pmol/L) were at least one order of magnitude higher than that necessary in cells such as HL-60 (approx 10 pmol/L), which express a similar number of high-affinity GM-CSF receptors. The origin of these discrepancies is not evident from these studies; however, the data suggest the existence of cell-specific effects that modulate the functional activity of the GM-CSF receptor.

Tyrosine phosphorylation of p42 and p44 MAP kinases is an early step in GM-CSF signal transduction.9,10,13-15,45 We found that GM-CSF induced time- and dose-dependent tyrosine phosphorylation of several proteins in the LNCaP cells and induced tyrosine phosphorylation of the p42 and p44 MAP kinases. Phosphorylation of proteins other than MAP kinase was observed at GM-CSF concentrations of 0.1 nmol/L or less, which is consistent with the presence of high-affinity GM-CSF receptors in the LNCaP cells. On the other hand, phosphorylation of MAP kinase was triggered only at GM-CSF concentrations of at least 3 nmol/L. Furthermore, we failed to observe JAK2 phosphorylation in these cells. Because the LNCaP cells express about 750 low-affinity sites that likely correspond to excess of alpha  subunits (in addition to approximately 150 high-affinity sites), the data raise the intriguing possibility that excess of alpha -subunit expression may modulate signaling through the high-affinity receptor.

The immunohistochemical analysis of human prostatic tissue using anti-alpha and -beta antibodies confirmed the presence of the alpha and the beta  subunits of the GM-CSF receptor in prostate tumors. The lack of immunoreactivity or weak pattern of staining observed in normal epithelial cells, contrasts with the substantial immunoreactivity with anti- alpha  and -beta antibodies observed in all cases of benign prostatic hyperplasia. Although primary tumors showed higher levels of expression compared with benign prostatic hyperplasia, we observed a further increase in the immunoreactivity of metastases to lymph node and bone compared with that of primary tumors. These data are compatible with increased expression of the GM-CSF receptor as the disease progresses from localized tumors to the development of metastatic disease.

Although the action of growth factors and their receptors in normal prostate physiology and progression of prostate cancer are not well understood, our results suggest that GM-CSF may have a role in maintenance of function in the normal prostate, as well as in prostate cancer progression. The presence of both subunits of the GM-CSF receptor in the tumor cells indicate that they express functional high-affinity GM-CSF receptors and therefore this hematopoietic growth factor may have an effect on prostate carcinoma cells, which have a proclivity to metastasize to bone. The increased expression of GM-CSF receptors in prostatic hypertrophy and neoplastic prostate ephitelium suggest a relationship between prostatic epithelial cell growth and GM-CSF.

    FOOTNOTES

   Submitted June 30, 1997; accepted October 2, 1997.
   Supported in part by Grants No. R01 CA30388, R01 HL42107, CA-DK-47650, and P30 CA08748 from the National Institutes of Health, Bethesda, MD; by Memorial Sloan-Kettering Institutional funds; by the Schultz Foundation, Verona, NJ; by the PepsiCo Foundation, Purchase, NY; and by the David H. Koch Charitable Foundation, Wichita, KS.
   Address reprint requests to David W. Golde, MD, Program in Molecular Pharmacology and Therapeutics, Box 451, Memorial Sloan-Kettering Cancer Center, 1275 York Ave, New York, NY 10021.
   The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

    REFERENCES
Abstract
Introduction
Methods
Results
Discussion
References

1. Gasson JC: Molecular physiology of granulocyte-macrophage colony-stimulating factor. Blood 77:1131, 1991[Free Full Text]

2. Gasson JC, Kaufman SE, Weisbart RH, Tomonaga M, Golde DW: High-affinity binding of granulocyte-macrophage colony-stimulating factor to normal and leukemic human myeloid cells. Proc Natl Acad Sci USA 83:669, 1986[Abstract/Free Full Text]

3. Park LS, Friend D, Gillis S, Urdal DL: Characterization of the cell surface receptor for human granulocyte/macrophage colony-stimulating factor. J Exp Med 164:251, 1986[Abstract/Free Full Text]

4. Cannistra SA, Koenigsmann M, DiCarlo J, Groshek P, Griffin JD: Differentiation-associated expression of two functionally distinct classes of granulocyte-macrophage colony-stimulating factor receptors by human myeloid cells. J Biol Chem 265:12656, 1990[Abstract/Free Full Text]

5. Hayashida K, Kitamura T, Gorman DM, Arai K, Yokota T, Miyajima A: Molecular cloning of a second subunit of the receptor for human granulocyte-macrophage colony-stimulating factor (GM-CSF): Reconstitution of a high-affinity GM-CSF receptor. Proc Natl Acad Sci USA 87:9655, 1990[Abstract/Free Full Text]

6. Kitamura T, Sato N, Arai K, Miyajima A: Expression cloning of the human IL-3 receptor cDNA reveals a shared beta subunit for the human IL-3 and GM-CSF receptors. Cell 66:1165, 1991[Medline] [Order article via Infotrieve]

7. Isfort RJ, Ihle JN: Multiple hematopoietic growth factors signal through tyrosine phosphorylation. Growth Factors 2:213, 1990[Medline] [Order article via Infotrieve]

8. Kanakura Y, Druker B, Cannistra SA, Furukawa Y, Torimoto Y, Griffin JD: Signal transduction of the human granulocyte-macrophage colony-stimulating factor and interleukin-3 receptors involves tyrosine phosphorylation of a common set of cytoplasmic proteins. Blood 76:706, 1990[Abstract/Free Full Text]

9. Okuda K, Sanghera JS, Pelech SL, Kanakura Y, Hallek M, Griffin JD, Druker BJ: Granulocyte-macrophage colony-stimulating factor, interleukin-3, and steel factor induce rapid tyrosine phosphorylation of p42 and p44 MAP kinase. Blood 79:2880, 1992[Abstract/Free Full Text]

10. Eder M, Griffin JD, Ernst TJ: The human granulocyte-macrophage colony-stimulating factor receptor is capable of initiating signal transduction in NIH3T3 cells. EMBO J 12:1647, 1993[Medline] [Order article via Infotrieve]

11. Hanazono Y, Chiba S, Sasaki K, Mano H, Miyajima A, Arai K, Yazaki Y, Hirai H: c-fps/fes protein-tyrosine kinase is implicated in a signaling pathway triggered by granulocyte-macrophage colony-stimulating factor and interleukin-3. EMBO J 12:1641, 1993[Medline] [Order article via Infotrieve]

12. Ihle JN: Cytokine receptor signalling. Nature 377:591, 1995[Medline] [Order article via Infotrieve]

13. Gomez-Cambronero J, Huang CK, Gomez-Cambronero TM, Waterman WH, Becker EL, Sha'afi RI: Granulocyte-macrophage colony-stimulating factor-induced protein tyrosine phosphorylation of microtubule-associated protein kinase in human neutrophils. Proc Natl Acad Sci USA 89:7551, 1992

14. Raines MA, Golde DW, Daeipour M, Nel AE: Granulocyte-macrophage colony-stimulating factor activates microtubule-associated protein 2 kinase in neutrophils via a tyrosine kinase-dependent pathway. Blood 79:3350, 1992[Abstract/Free Full Text]

15. Welham MJ, Duronio V, Sanghera JS, Pelech SL, Schrader JW: Multiple hemopoietic growth factors stimulate activation of mitogen-activated protein kinase family members. J Immunol 149:1683, 1992[Abstract]

16. Watanabe S, Muto A, Yokota T, Miyajima A, Arai K: Differential regulation of early response genes and cell proliferation through the human granulocyte macrophage colony-stimulating factor receptor: Selective activation of the c-fos promoter by genistein. Mol Biol Cell 4:983, 1993[Abstract]

17. Lopez AF, Shannon MF, Hercus T, Nicola NA, Cambareri B, Dottore M, Layton MJ, Eglinton L, Vadas MA: Residue 21 of human granulocyte-macrophage colony-stimulating factor is critical for biological activity and for high but not low affinity binding. EMBO J 11:909, 1992[Medline] [Order article via Infotrieve]

18. Sakamaki K, Miyajima I, Kitamura T, Miyajima A: Critical cytoplasmic domains of the common beta subunit of the human GM-CSF, IL-3 and IL-5 receptors for growth signal transduction and tyrosine phosphorylation. EMBO J 11:3541, 1992[Medline] [Order article via Infotrieve]

19. Ding DX, Rivas CI, Heaney ML, Raines MA, Vera JC, Golde DW: The alpha subunit of the human granulocyte-macrophage colony-stimulating factor receptor signals for glucose transport via a phosphorylation-independent pathway. Proc Natl Acad Sci USA 91:2537, 1994[Abstract/Free Full Text]

20. Spielholz C, Heaney ML, Morrison ME, Houghton AN, Vera JC, Golde DW: Granulocyte-macrophage colony-stimulating factor signals for increased glucose uptake in human melanoma cells. Blood 85:973, 1995[Abstract/Free Full Text]

21. Bussolino F, Wang JM, Defilippi P, Turrini F, Sanavio F, Edgell CJ, Aglietta M, Arese P, Mantovani A: Granulocyte- and granulocyte-macrophage-colony stimulating factors induce human endothelial cells to migrate and proliferate. Nature 337:471, 1989[Medline] [Order article via Infotrieve]

22. Gearing DP, King JA, Gough NM, Nicola NA: Expression cloning of a receptor for human granulocyte-macrophage colony-stimulating factor. EMBO J 8:3667, 1989[Medline] [Order article via Infotrieve]

23. Baldwin GC, Benveniste EN, Chung GY, Gasson JC, Golde DW: Identification and characterization of a high-affinity granulocyte-macrophage colony-stimulating factor receptor on primary rat oligodendrocytes. Blood 82:3279, 1993[Abstract/Free Full Text]

24. Brosnan CF, Shafit-Zagardo B, Aquino DA, Berman JW: Expression of monocyte/macrophage growth factors and receptors in the central nervous system. Adv Neurol 59:349, 1993[Medline] [Order article via Infotrieve]

25. Baldwin GC, Gasson JC, Kaufman SE, Quan SG, Williams RE, Avalos BR, Gazdar AF, Golde DW, DiPersio JF: Nonhematopoietic tumor cells express functional GM-CSF receptors. Blood 73:1033, 1989[Abstract/Free Full Text]

26. Metcalf D, Nicola NA, Gearing DP, Gough NM: Low-affinity placenta-derived receptors for human granulocyte-macrophage colony-stimulating factor can deliver a proliferative signal to murine hemopoietic cells. Proc Natl Acad Sci USA 87:4670, 1990[Abstract/Free Full Text]

27. Miyagawa K, Chiba S, Shibuya K, Piao YF, Matsuki S, Yokota J, Terada M, Miyazono K, Takaku F: Frequent expression of receptors for granulocyte-macrophage colony-stimulating factor on human nonhematopoietic tumor cell lines. J Cell Physiol 143:483, 1990[Medline] [Order article via Infotrieve]

28. Baldwin GC, Golde DW, Widhopf GF, Economou J, Gasson JC: Identification and characterization of a low-affinity granulocyte-macrophage colony-stimulating factor receptor on primary and cultured human melanoma cells. Blood 78:609, 1991[Abstract/Free Full Text]

29. Guillaume T, Sekhavat M, Rubinstein DB, Hamdan O, Symann ML: Transcription of genes encoding granulocyte-macrophage colony-stimulating factor, interleukin 3, and interleukin 6 receptors and lack of proliferative response to exogenous cytokines in nonhematopoietic human malignant cell lines. Cancer Res 53:3139, 1993[Abstract/Free Full Text]

30. Dedhar S, Gaboury L, Galloway P, Eaves C: Human granulocyte-macrophage colony-stimulating factor is a growth factor active on a variety of cell types of nonhemopoietic origin. Proc Natl Acad Sci USA 85:9253, 1988[Abstract/Free Full Text]

31. Berdel WE, Danhauser-Riedl S, Steinhauser G, Winton EF: Various human hematopoietic growth factors (interleukin-3, GM-CSF, G-CSF) stimulate clonal growth of nonhematopoietic tumor cells. Blood 73:80, 1989[Abstract/Free Full Text]

32. Joraschkewitz M, Depenbrock H, Freund M, Erdmann G, Meyer HJ, De Riese W, Neukam D, Hanauske U, Krumwieh M, Poliwoda H, Hanauske A-R: Effects of cytokines on in vitro colony formation of primary human tumour specimens. Eur J Cancer 26:1070, 1990

33. Nachbaur D, Denz H, Zwierzina H, Schmalzl F, Huber H: Stimulation of colony formation of various human carcinoma cell lines by rhGM-CSF and rhIL-3. Cancer Lett 50:197, 1990[Medline] [Order article via Infotrieve]

34. Lang SH, Miller WR, Duncan W, Habib FK: Production and response of human prostate cancer cell lines to granulocyte macrophage-colony stimulating factor. Int J Cancer 59:235, 1994[Medline] [Order article via Infotrieve]

35. Horoszewicz JS, Leong SS, Kawinski E, Karr JP, Rosenthal H, Chu TM, Mirand EA, Murphy GP: LNCaP model of human prostatic carcinoma. Cancer Res 43:1809, 1983[Abstract/Free Full Text]

36. Tomonaga M, Gasson JC, Quan SG, Golde DW: Establishment of eosinophilic sublines from human promyelocytic leukemia (HL-60) cells: Demonstration of multipotentiality and single-lineage commitment of HL-60 stem cells. Blood 67:1433, 1986[Abstract/Free Full Text]

37. Sherwood ER, Ford TR, Lee C, Kozlowski JM: Therapeutic efficacy of recombinant tumor necrosis factor alpha in an experimental model of human prostatic carcinoma. J Biol Res Mod 9:44, 1990

38. Heaney ML, Vera JC, Raines MA, Golde DW: Membrane-associated and soluble granulocyte/macrophage-colony-stimulating factor receptor alpha subunits are independently regulated in HL-60 cells. Proc Natl Acad Sci USA 92:2365, 1995[Abstract/Free Full Text]

39. Nualart F, Hein S, Rodriguez EM, Oksche A: Identification and partial characterization of the secretory glycoproteins of the bovine subcommissural organ-Reissner's fiber complex. Evidence for the existence of two precursor forms. Brain Res Mol Brain Res 11:227, 1991[Medline] [Order article via Infotrieve]

40. Lieschke GJ, Burgess AW: Granulocyte colony-stimulating factor and granulocyte-macrophage colony-stimulating factor (1) and (2). N Engl J Med 327:28 and 99, 1992

41. Appelbaum FR: The use of colony stimulating factors in marrow transplantation. Cancer 72:3387, 1993[Medline] [Order article via Infotrieve]

42. Vose JM, Armitage JO: Clinical applications of hematopoietic growth factors. J Clin Oncol 13:1023, 1995[Abstract]

43. Chiba S, Tojo A, Kitamura T, Urabe A, Miyazono K, Takaku F: Characterization and molecular features of the cell surface receptor for human granulocyte-macrophage colony-stimulating factor. Leukemia 4:29, 1990[Medline] [Order article via Infotrieve]

44. Watanabe S, Mui AL, Muto A, Chen JX, Hayashida K, Yokota T, Miyajima A, Arai K: Reconstituted human granulocyte-macrophage colony-stimulating factor receptor transduces growth-promoting signals in mouse NIH 3T3 cells: Comparison with signalling in BA/F3 pro-B cells. Mol Cell Biol 13:1440, 1993[Abstract/Free Full Text]

45. Polotskaya A, Zhao Y, Lilly ML, Kraft AS: A critical role for the cytoplasmic domain of the granulocyte-macrophage colony-stimulating factor alpha receptor in mediating cell growth. Cell Growth Differ 4:523, 1993[Abstract]


© 1998 by The American Society of Hematology.
 
0006-4971/98/91-0034$3.00/0

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
V. Montecinos, P. Guzman, V. Barra, M. Villagran, C. Munoz-Montesino, K. Sotomayor, E. Escobar, A. Godoy, L. Mardones, P. Sotomayor, et al.
Vitamin C Is an Essential Antioxidant That Enhances Survival of Oxidatively Stressed Human Vascular Endothelial Cells in the Presence of a Vast Molar Excess of Glutathione
J. Biol. Chem., May 25, 2007; 282(21): 15506 - 15515.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
C. Ferretti, L. Bruni, V. Dangles-Marie, A.P. Pecking, and D. Bellet
Molecular circuits shared by placental and cancer cells, and their implications in the proliferative, invasive and migratory capacities of trophoblasts
Hum. Reprod. Update, March 1, 2007; 13(2): 121 - 141.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Chen, J. M. Carcamo, and D. W. Golde
The {alpha} Subunit of the Granulocyte-Macrophage Colony-stimulating Factor Receptor Interacts with c-Kit and Inhibits c-Kit Signaling
J. Biol. Chem., August 4, 2006; 281(31): 22421 - 22426.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
P. T. Jubinsky, M. K. Short, G. Mutema, and D. P. Witte
Developmental Expression of Magmas in Murine Tissues and Its Co-expression with the GM-CSF Receptor
J. Histochem. Cytochem., May 1, 2003; 51(5): 585 - 596.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Dhar-Mascareno, J. Chen, R. H. Zhang, J. M. Carcamo, and D. W. Golde
Granulocyte-Macrophage Colony-stimulating Factor Signals for Increased Glucose Transport via Phosphatidylinositol 3-Kinase- and Hydrogen Peroxide-dependent Mechanisms
J. Biol. Chem., March 21, 2003; 278(13): 11107 - 11114.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. M. Carcamo, O. Borquez-Ojeda, and D. W. Golde
Vitamin C inhibits granulocyte macrophage-colony-stimulating factor-induced signaling pathways
Blood, May 1, 2002; 99(9): 3205 - 3212.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. S. Coles, P. Diamond, F. Occhiodoro, M. A. Vadas, and M. F. Shannon
An Ordered Array of Cold Shock Domain Repressor Elements across Tumor Necrosis Factor-responsive Elements of the Granulocyte-Macrophage Colony-stimulating Factor Promoter
J. Biol. Chem., May 5, 2000; 275(19): 14482 - 14493.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Sayani, F. A. Montero-Julian, V. Ranchin, J. M. Prevost, S. Flavetta, W. Zhu, R. C. Woodman, H. Brailly, and C. B. Brown
Identification of the soluble granulocyte-macrophage colony stimulating factor receptor protein in vivo
Blood, January 15, 2000; 95(2): 461 - 469.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
E. LEE, T. LINDO, N. JACKSON, L. MENG-CHOONG, P. REYNOLDS, A. HILL, M. HASWELL, S. JACKSON, and S. KILFEATHER
Reversal of Human Neutrophil Survival by Leukotriene B4 Receptor Blockade and 5-Lipoxygenase and 5-Lipoxygenase Activating Protein Inhibitors
Am. J. Respir. Crit. Care Med., December 1, 1999; 160(6): 2079 - 2085.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rivas, C. I.
Right arrow Articles by Golde, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rivas, C. I.
Right arrow Articles by Golde, D. W.
Related Collections
Right arrow Neoplasia
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1998 by American Society of Hematology         Online ISSN: 1528-0020