Blood, Vol. 91 No. 3 (February 1), 1998:
pp. 1095-1097
CORRESPONDENCE
In Vivo Adenoviral-Mediated Gene Transfer of Interleukin-2 in
Cutaneous Plasmacytoma
 |
LETTER |
To The Editor:
Adenovirus vectors are attractive vehicles for clinical gene transfer
as these replication-deficient vectors exhibit wide tissue tropism,
infection of both replicating and nonreplicating cell types, and
provide highly efficient expression of transgenes linked to appropriate
promoters.1-3 Consequently, such vectors are now in
widespread use in clinical gene therapy trials, particularly for cancer
immunotherapy.
Nevertheless, adenoviral vectors infect primary human lymphoid tissue
at low efficiency4,5 reflecting low levels of
adenoviral internalization receptors on the cell surface,6
thus limiting the potential for treatment of human lymphoid
malignancies. However, we and others have previously reported that
adenovirus vectors can efficiently infect myeloma cell lines and to a
lesser degree primary plasma cells.7,8 Furthermore,
Cantwell et al6 showed that, in a majority of patients,
chronic lymphocytic leukemia cells can be transfected with an
adenovirus vector, albeit using a high multiplicity of infection. In
contrast, as expected, lymphoma cell lines can only be infected at low
efficiency.7
The cytokine interleukin-2 (IL-2) can mediate antitumor activity in
vitro and in vivo by inducing lymphokine-activated killer cells and activating tumor-infiltrating lymphocytes.9
Serious side effects have proved a limitation to the clinical use of
high-dose systemic IL-2 as an antitumor agent.10 To
circumvent these side effects and to maintain high intratumoral
concentrations of IL-2, attention has turned to the use of gene
delivery systems to express IL-2 continuously within or around the
tumor.11 Previous reports from our laboratories have shown
sustained tumor regression and immune protection in mice injected with
an E1, E3-deleted adenovirus carrying the human IL-2 (hIL-2)
cDNA.12 Furthermore, others have reported regression of a
murine plasmacytoma after transfection with the IL-2
gene.13
View larger version (72K):
[in this window]
[in a new window]
| Fig 1.
Plasmacytoma biopsy samples before and after injection of
AdCAIL-2 were PCR-amplified using primers specific for AdCAIL-2 (A),
Ad5 E1 (B), or B-actin (C). PCR products were detected using internal
radiolabeled probes. Lane 1, tumor biopsy sample preinjection; lane 2, tumor biopsy sample 7 days postinjection; lane 3, tumor at autopsy;
lane 4, negative control mock DNA extraction from autopsy tumor; lanes
5 and 6, positive controls. No E1 sequences from wild-type adenovirus
were detected in the tumor. In contrast, AdCAIL-2 was readily detected
in the postinjection biopsy samples.
|
|
Encouraged by these findings we injected a patient with subcutaneous
plasmacytomas with a clinical grade adenovirus expressing hIL-2
(AdCAIL-2) as part of an ongoing phase 1 trial of AdCAIL-2 in
subcutaneous malignancy.14 Here we report the first example of successful in vivo adenovirus-mediated gene transfer into
primary malignant plasma cells and demonstrate expression of the gene product for at least two weeks after infection.
A 46-year-old woman with chemotherapy refractory relapsed multiple
myeloma developed cutaneous tumor metastases 5 months after autologous
peripheral blood stem cell transplantation. Biopsy of an
occipital tumor mass revealed malignant plasma cells consistent with a plasmacytoma. The patient was enrolled on a compassionate basis
on a phase I study of direct injection of AdCAIL-2 into subcutaneous
tumor metastases.
Construction of the adenoviral vector AdCAIL-2 and the clinical
protocol have been described elsewhere.12,14 Briefly, a recombinant E1, E3-deleted Ad5 vector expressing hIL-2 was constructed in which the E1 region was substituted with an expression cassette containing the human cytomegalovirus immediate early promoter (HCMV),
an hIL-2 cDNA (a gift of Dr Robert Ralston, Chiron Corp, Emeryville,
CA), and the SV40 polyadenylation signal.
A baseline tumor biopsy sample was obtained from the patient following
which a total of 1 × 1010 Plaque-forming units
(pfu) of AdCAIL-2 in 1 mL of saline was administered in
split dose via fine needle into the cutaneous occipital tumor, two
other cutaneous lesions, and a left supraclavicular lymph node. A
biopsy of the cutaneous occipital tumor mass was performed 1 week after
the inoculation. We examined the biopsy specimens for evidence of the
viral vector using sensitive polymerase chain reaction (PCR)-based
indicators of viral sequences. Oligonucleotide primers from the CMV
promoter (5
TTGCGAGTACATCAATGGGCGTGG3) and from the hIL-2 mini
cassette (5 TGAGCATCCTGGTGAGTTTGGG3) were used to detect the presence
of AdCAIL-2. To detect wild-type adenovirus, primers spanning the
deleted Ad5 E1 region were used (5 TTATCTGCCACGGAGGTGT3 and
5CGGCGAGCGCCTTCTGGCGG3). PCR products were run on ethidium gels and
after Southern transfer were detected with radiolabeled internal
probes. These PCR assays can detect 1.5 × 103 pfu
(1.5 × 104 particles) of AdCAIL-2 and as few as 10 pfu
of wild-type adenovirus respectively (not shown).
No Ad5 E1 sequence was detected in either the preinjection or
postinjection tumor biopsy specimens (Fig 1). Saliva and
blood screened by PCR for E1 sequences were also negative (not shown). No virus could be recovered by 7-day culture of lysed tumor cells on
A549 cells (a cell line permissive for replication of wild-type adenovirus but not replication defective vectors). In contrast AdCAIL-2
sequences were readily detected in the postinjection biopsy specimen
and in a second injected tumor site at autopsy 12 days after injection
(Fig 1). By reverse transcriptase-PCR (RT-PCR) analysis, we next
demonstrated that the tumor cells expressed hIL-2 mRNA, as shown in Fig
2. The naturally occurring hIL-2 gene contains an Mwo I restriction enzyme site at bp 163 that
the vector derived hIL-2 gene lacks because of a silent guanine to
thymidine substitution. Thus, while PCR amplified IL-2 from normal
donor T lymphocytes is digested by Mwo I the hIL-2 cDNA derived
from the tumor and plasmid DNA control is not cut, confirming that IL-2
present in the tumor is primarily derived from the adenovirus.
View larger version (73K):
[in this window]
[in a new window]
| Fig 2.
RT-PCR for hIL-2 mRNA was performed and the products
detected by ethidium gel. The PCR product was isolated (Geneclean) and Mwo I restriction enzyme digestion shows that the hIL-2
amplified from the tumor is predominantly derived from the AdCAIL-2
vector. (A) RT-PCR for hIL-2. Lanes 1, 3, 5, and 6: negative controls; lane 2: tumor biopsy sample 7 days postinjection; lane 4: normal donor
phytohemagglutinin-activated T lymphocytes; lane 7: AdCAIL-2 plasmid
positive control. (B) PCR products from (A) were digested with
Mwo I. Lane 1: PCR product from tumor biopsy sample; lane 2:
normal donor activated T cells; lane 3: plasmid control. The IL-2 in
the tumor post injection is predominantly derived from AdCAIL-2 and
does not digest with Mwo I.
|
|
Although successful adenoviral-mediated hIL-2 gene transfer into the
plasmacytoma was observed, no regression of the lesion was seen
clinically and, in contrast to our findings in other patients on this
trial, no evidence for T-cell infiltration of the tumor nor of enhanced
autologous lymphocyte proliferation to AdCAIL-2-transfected cells
in vitro was observed (A.K. Stewart, unpublished results,
December 1997). This most likely reflects the
immunosuppressed state and steroid-dependent condition of the
myeloma patient (absolute CD4 count 65 × 106/L).
We conclude that adenovirus vectors can successfully mediate gene
transfer in human plasmacytoma cells in vivo. Furthermore, vector-specific DNA can be detected for at least 12 days and expression of the adenovirus-derived transgene persists for at least 7 days postinjection. These results encourage further examination of the role
of adenovirus vectors for genetic immunotherapy in patients with
multiple myeloma.
A. Keith Stewart
Aaron D. Schimmer
Dennis J. Bailey
Ian D. Dubé
Darrin Cappe
The Toronto Hospital Oncology Gene Therapy
Program
Toronto, Ontario, Canada
Robert C. Moen
Baxter
Health Care Corp
Gene Therapy Unit
Round Lake, IL
Jack Gauldie
Frank L. Graham
McMaster University
Hamilton,
Ontario, Canada
| |
REFERENCES |
1. Graham FL, Prevec L: Adenovirus expression vectors and
recominant vaccines, in Ellis RW (ed): Vaccines: New Approaches to Immunological Problems. Boston, MA, Butterworth-Heinemann, 1992, p
364
2.
Graham FL:
Adenovirus vectors for gene expression and gene therapy.
Transfus Sci
17:15,
1996
3.
Ruben M,
Bacchetti S,
Graham FL:
Integration and expression of viral DNA in cells transformed by host range mutants of adenovirus type 5.
J Virol
41:674,
1982[Abstract/Free Full Text]
4.
Karlsson S,
Humphries RK,
Gluzman Y,
Nienhuis AW:
Transfer of genes into hematopoietic cells with recombinant DNA viruses.
Proc Natl Acad Sci USA
82:158,
1985[Abstract/Free Full Text]
5.
Silver L,
Anderson CW:
Interaction of human adenovirus serotype 2 with human lymphoid cells.
Virology
165:377,
1988[Medline]
[Order article via Infotrieve]
6.
Cantwell MJ,
Sharma S,
Friedmann T,
Kipps TJ:
Adenovirus vector infection of chronic lymphocytic leukemia B cells.
Blood
88:4676,
1996[Abstract/Free Full Text]
7. Prince HM, Dessureault S, Gallinger S, Krajden M, Sutherland DR,
Addison C, Zhang Y, Graham FL, Stewart AK: Efficient adenoviral
mediated gene expression in malignant human plasma cells: Relative
lymphoid cell resistance. Exp Hematol 1998 (in press)
8.
Wattel E,
Vanrumbeke M,
Abina MA,
Cambier N,
Preudhomme C,
Haddada H,
Fenaux P:
Differential efficacy of adenoviral mediated gene transfer into cells from hematological cell lines and fresh hematological malignancies.
Leukemia
10:171,
1996[Medline]
[Order article via Infotrieve]
9.
Rosenberg SA,
Lotze MT,
Yang JC,
Aebersold PA,
Lineham WM,
Siepp CA,
White DE:
Experience with the use of high-dose interleukin 2 in the treatment of 652 patients with cancer.
Ann Surg
21:474,
1989
10.
Siegel JP,
Puri RK:
Interleukin-2 toxicity.
J Clin Oncol
9:694,
1991[Abstract]
11.
Fearon E,
Pardoll D,
Itaya T,
Golumbek P,
Levitsky H,
Simons J,
Karasuyama H,
Vogelstein B,
Frost P:
Interleukin-2 production by tumor cells bypasses T helper function in the generation of an antitumor response.
Cell
60:397,
1990[Medline]
[Order article via Infotrieve]
12.
Addison CL,
Braciak T,
Ralston R,
Muller WJ,
Gauldie J,
Graham FL:
Intratumoral injection of an adenovirus expressing interleukin 2 induces regression and immunity in a murine breast cancer model.
Proc Natl Acad Sci USA
92:8522,
1995[Abstract/Free Full Text]
13.
Bubenik J,
Simova J,
Zeuthen J,
Diamant M,
Jandlova T,
Bubenikova D:
Gene therapy of plasmacytoma: Comparison of the therapeutic efficacy of tumour cells transduced with the interleukin-2, interleukin 4, or interleukin-6 genes.
Folia Biologica
40:29,
1994
14.
Stewart AK,
Lassam NJ,
Graham FL,
Gauldie J,
Addison CL,
Bailey DJ,
Desureault S,
Dubé ID,
Gallinger S,
Krajden M,
Rotstein LE,
Quirt IC,
Moen R:
A phase I study of adenovirus mediated gene transfer of interleukin 2 cDNA into metastatic breast cancer or melanoma.
Hum Gene Ther
8:1403,
1997[Medline]
[Order article via Infotrieve]
