Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chan, W.P.
Right arrow Articles by Liang, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chan, W.P.
Right arrow Articles by Liang, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 91 No. 4 (February 15), 1998: pp. 1135-1139

A Novel Mutation of Arg306 of Factor V Gene in Hong Kong Chinese

By W.P. Chan, C.K. Lee, Y.L. Kwong, C.K. Lam, and Raymond Liang

From the Departments of Medicine and Pathology, University of Hong Kong, Queen Mary Hospital, Hong Kong.


    ABSTRACT
Abstract
Introduction
Methods
Results
Discussion
References

We have analyzed 83 unrelated Hong Kong Chinese for the presence of genetic variants of factor V gene. Forty-three of them had a history of deep vein thrombosis. The DNA sequence variations of exons 7, 10, and 13, where the codons for Arg306, Arg506, and Arg679 are located, respectively, were studied by denaturing gradient gel electrophoresis. The G1691A (Arg 506Gln) mutation in exon 10 was not detectable in any of the 83 subjects. However, a high allelic frequency for the G1628A (Arg 485Lys) substitution was detectable in the same exon. We have also identified a novel DNA sequence mutation (A1090G) in exon 7 that resulted in Arg 306Gly substitution in 2 thrombotic patients and 1 nonthrombotic subject. Fresh blood samples were available from one of them for analysis of activated protein C resistance and the result was negative. Variation of DNA sequence was not found in exon 13 in any of our 83 subjects. The results of this study showed that, although the Arg 506Gln mutation was rarely found in the Hong Kong Chinese population, a different mutation site such as A 1090G in exon 7 of the factor V gene (Arg 306) may be of clinical importance.

    INTRODUCTION
Abstract
Introduction
Methods
Results
Discussion
References

HUMAN COAGULATION factor V acts as a cofactor in the conversion of prothrombin to thrombin in the coagulation process. In plasma, this high molecular weight glycoprotein is converted first to its active form, factor Va, by factor Xa and/or alpha -thrombin. Factor Va is then quickly inactivated by activated protein C (APC) for maintenance of hemostasis. This mechanism of factor Va inactivation is an ordered event.1 Factor Va is first cleaved at Arg 506 and then at Arg 306 and Arg 679. The peptide bond cleavage at Arg506 is essential for the subsequent optimal exposure of cleavage sites at Arg 306 and Arg 679. Peptide bond cleavage at Arg 306 appears to occur in a membrane-bound fashion and only accounts for the initial 70% loss of activity. The subsequent peptide bond cleavage at Arg 679 is responsible for the loss of remaining activity. Therefore, any defect on one or more of these three cleavage sites can potentially affect the APC inactivation process even though the factor V procoagulation activity may remain normal.

It has been reported that the most common defect among patients with deep vein thrombosis (DVT) is related to APC resistance.2-4 A molecular defect resulting in APC resistance was identified as a single point mutation (G1691right-arrowA) in the factor V gene. It causes a single amino acid substitution (Arg 506right-arrowGln) in the factor V molecule.5-7 This results in the loss of APC cleavage site at Arg 506 and subsequent ineffective peptide bond cleavage processes at Arg 306 and Arg 679. The rate of inactivation of mutant factor Va is diminished resulting in a higher level of thrombin. Patients with this genetic defect may develop a hypercoagulable state. It is well aware that the heterozygous state for this factor V gene mutation is associated with a fivefold to 10-fold increase in the risk of thrombosis and a 50- to 100-fold for the homozygous state.5,8,9 This genetic defect is found predominantly in Caucasian populations.5,8,10,11 This mutation and APC resistance is extremely rare in Asian populations.12

The effects of protein S and factor Xa on APC-catalyzed factor Va inactivation have also been studied. Protein S accelerates factor Va inactivation by selectively promoting the slow cleavage at Arg 306. Factor Xa protects factor Va from inactivation by APC by selectively blocking peptide bond cleavage at Arg 506. Inactivation of factor Va R506Q, which was isolated from the plasma of homozygous APC-resistant patient lacking the Arg 506 cleavage site, was stimulated by protein S but not affected by factor Xa. This confirms that the target sites of protein S and factor Xa involve Arg 306 and Arg 506, respectively. It has been observed that the large difference between the rates of APC-catalyzed inactivation of normal factor Va and factor Va R506Q were almost completely abolished in the presence of factor Xa and protein S. This may explain why, in the absence of other risk factors, APC resistance only results in a weak prothrombotic state.13 There is further evidence to suggest that factor V gene abnormality responsible for the APC resistance may be not be a risk factor in the majority of some populations, but that it is a genetic risk factor in a significant minority and that it favors the clinical expression of protein C deficiency.14

So far, G1691right-arrowA mutation is the only genetic abnormality reported for the factor V gene resulting in APC resistance. In this study, we examined the whole exon 10 of factor V gene, in which the coding sequence for Arg 506 was located, of Hong Kong Chinese patients with or without DVT by denaturing gradient gel electrophoresis (DGGE) for detection of novel gene mutation. Also, the analysis was extended to exon 7 and 13, where Arg 306 and Arg 679 were respectively located.

    MATERIALS AND METHODS
Abstract
Introduction
Methods
Results
Discussion
References

Forty-three unrelated Hong Kong Chinese patients with a definite history of DVT and 40 nonthrombotic patients were recruited for this study. High molecular weight DNA was extracted from peripheral blood of these 83 subjects.

Polymerase chain reaction (PCR) and Mnl/I restrictive enzyme digest.   The entire exon 10 containing the coding sequence of Arg 506 was amplified from genomic DNA by PCR. The two primers used were identical to those described by Ridker et al15 (5' primer, acccacagaaatgatgccag; 3' primer, tgcccattattagccaggag). The PCR product was a 233-bp fragment. In a total volume of 100 µL, the PCR reagents contained 1 µg genomic DNA, 50 pmol of each primer, 200 µmol/L of each deoxynucleoide triphosphate (Pharmacia), 1× Tag buffer (10 mmol/L Tris-HCl, pH 8.3, 50 mmol/L KCl, 1.5 mmol/L MgCl2, and 0.01% [wt/vol] gelatin), and 2.5 U of Tag polymerase (Perkin Elmer, Cetus, Norwalk, CT). The reaction was performed in a 0.6-mL microcentrifuge tube and a thermal cycler (Perkin Elmer, Cetus). The thermal cycle profile was 94°C for 5 minutes; 30 cycles of 94°C for 60 seconds, 50°C for 30 seconds, and 72°C for 90 seconds; followed by a final extension of 10 minutes at 72°C.

Ten microliters of PCR product was digested with 2 U of Mnl/I (New England Biolabs) at 37°C for 16 hours. The digestion was terminated by incubation at 65°C and the fragments were separated on a 6% polyacrylamide gel and visualized with ethidium bromide.

DGGE.   Sequence variations were detected by PCR and DGGE. For each segment of the coding exons 7, 10, and 13, a set of oligonucleotides composed of an upstream primer with an additional 40-bp G+C-rich sequence (GC-clamp) and a 20-mer downstream primer was used for PCR amplification. This G-C clamp allowed better resolution of the amplified fragments and more discriminating screening for sequence variations by DGGE.

The thermal profile consisted of 5 minutes of denaturation at 94°C and 30 cycles of 1 minute of denaturation at 94°C, 1 minute of annealing at 58°C for exon 7 (58°C for exon 10 and 56°C for exon 13), and 1 minute of extension at 72°C, followed by a final extension at 72°C for 5 minutes. The specificity and the size of the amplified fragments were checked on a 6% polyacrylamide gel.

Amplified PCR products were denatured at 94°C for 10 minutes and were allowed to reanneal at 37°C slowly over 30 minutes to form homoduplex and heteroduplex. The reannealed PCR products were then subjected to electrophoresis for 3 hours at 160 V, 60°C on a 6.5% polyacrylamide gel containing a 20% to 70% denaturing gradient (100% denaturant = 7 mol/L urea and 40% formamide in TEA buffer [40 mmol/L Tris, 20 mmol/L sodium acetate, 1 mmol/L EDTA, pH 7.6]).

DNA sequencing.   Direct PCR DNA sequencing was performed using the same primer sets. The amplified PCR fragment was purified from the polyacrylamide gel and used as template for sequencing reaction using a standard DNA sequencing kit (US Biochemical, Cleveland, OH).

The functional coagulation assay for APC resistance.   Resistance to APC was tested on platelet-poor plasma using commercial test kit from Chromogenix (Molnsal, Sweden), following the manufacturer's instructions. Activated partial thromboplastin time (APTT) was performed on the plasma samples with or without added APC and the sensitivity ration was calculated as APTT with APC/APTT without APC (normal, >2.1).12

    RESULTS
Abstract
Introduction
Methods
Results
Discussion
References

DNA samples from 43 thrombotic and 40 nonthrombotic patients were studied for the presence of the G1691right-arrowA mutation of factor V gene by Mnl/I restriction enzyme digestion of the amplified gene. The mutation was not detectable in any of the samples. The same samples were also analyzed by DGGE. Abnormal patterns suggesting the presence of a genetic abnormality at exon 10 of the factor V gene was found in 41 of the 83 (49.3%) samples being studied. The results are shown in Fig 1. DNA sequencing of the normal fragments showed normal DNA sequences of exon 10 that was identical to those previously reported in the gene bank. The abnormal DNA fragments identified were found to have a Gright-arrowA mutation at nucleotide 1628, which resulted in a change of the peptide sequence from Arg 485 to Lys. Among the 83 subjects, 8 (9.6%) were homozygous for the 1628 G right-arrow A mutation and 33 (39.8%) were heterozygous. The frequency distribution of this mutation was similar between the 43 thrombotic (4 homozygous and 17 heterozygous) and the 40 nonthrombotic (4 homozygous and 16 heterozygous) patients. Identical mutation has been previously reported by Gandrille et al14 in European populations but at a much lower frequency.


View larger version (51K):
[in this window]
[in a new window]
 
Fig 1. DGGE of the amplified exon 10 of factor V gene. Lanes 1 and 3, contol with a homozygosity for G1691A mutation. Lane 2, control with a heterozygosity for G1691A mutation. Lane 8, normal control. Lanes 9 and 11, homozygous for G1628A mutation. Lanes 4 through 7, 10, and 12, heterozygous for G1628A mutation. (Upstream primer, GC40-TCAGG CAGGA ACAAC ACCAT; downstream primer, GGTTA CTTCA AGGAC AAAAT.).

The PCR and DGGE technique were also applied to study the exons 7 of factor V gene, where the coding sequence of Arg306 was located. Abnormal patterns suggesting the presence of a genetic abnormality at exon 7 of the factor V gene were found in 3 of the 83 (3.6%) samples being studied. There were 2 positive cases in the thrombotic group and 1 in the nonthrombotic group. The results are shown in Fig 2. DNA sequencing of the normal fragments showed normal DNA sequences of exon 7 of factor V gene that were identical to those previously reported in the gene bank. DNA sequence analysis of the abnormal amplified fragment of exon 7 from these 3 patients showed a heterozygous A1090right-arrowG mutation (Fig 3). To confirm the mutation, a restriction enzyme digest of the amplified exon 7 of factor V gene with BstNI (New England Biolabs), which has a restriction site of CC∇AGG, were performed. The DNA fragments were studied by 6% polyacrylamide gel electrophoresis. The undigested DNA fragment was a 240-bp PCR product. A complete digestion of this 240-bp DNA fragment with BstNI was expected to yield two shorter fragments of 100 and 140 bp in length (Fig 4). The presence of an A1090right-arrowG mutation resulted in the loss of the cleavage site for BstNI. A BstNI-digested sample from a normal control on lane 1 produced the two fragments of 100 and 140 bp in length as expected. A BstNI-digested sample from a thrombotic patient on lane 2 yielded three DNA fragments (100, 140, and 240 bp), confirming heterozygosity for the A1090right-arrowG mutation. The additional 240-bp fragment represented the complete undigested PCR product, as the result of the loss of the enzyme cleavage site of BstNI. Similar to the normal control one lane 1, a BstNI-digested sample from another thrombotic patient on lane 3 produced two DNA fragments of 100 and 140 bp in length, confirming the absence of A1090right-arrowG mutation. Fresh blood sample was available only from 1 of the 3 subjects with the mutation and the patient had history of DVT. The sample was taken while the patient was not on any anticoagulant. Functional coagulation assay for APC resistance was performed on the sample available and the APC sensitivity ratio was 3.2, which was normal. Other tests, including antithrombin III, protein C, protein S, and lupus anticoagulant, were also determined on the same blood sample and were all normal.


View larger version (68K):
[in this window]
[in a new window]
 
Fig 2. DGGE of the amplified exon 7 of factor V gene. Lane 1, normal control. Lanes 2 through 7, thrombotic patients. Lane 2 shows the heteroduplexes as the result of a heterozygous A1090right-arrowG mutation. (Upstream primer, [GC-40]-TGTCC TAACT CAGCT GGGAT; downstream primer, gtatg aaccc caaca actca.)


View larger version (33K):
[in this window]
[in a new window]
 
Fig 3. DNA sequence analysis of an abnormal amplified fragment of exon 7 of factor V gene. A heterozygous A1090G mutation was identified.


View larger version (57K):
[in this window]
[in a new window]
 
Fig 4. Polyacrylamide gel electrophoresis following the BstNI restriction enzyme digest of a 240-bp DNA fragment of exon 7 of factor V gene. Lane M, molecular weight marker. Lane 1, BstNI-digested sample from a normal control showing the two DNA fragments, 100 and 140 bp. Lane 2, BstNI-digested sample from a thrombotic patient heterozygous for A1090right-arrowG mutation. It shows three DNA fragments: 100, 140, and 240 bp. Lane 3, BstNI-digested sample from a thrombotic patient without the A1090G mutation. Similar to lane 1, it shows only 2 DNA fragments, 100 and 140 bp. (Upstream primer, [GC-40]-TGTCC TAACT CAGCT GGGAT; downstream primer, gtatg aaccc caaca actca.)

The PCR and DGGE analysis was finally used to study exon 13 of the factor V gene. It is the location of the codon of Arg 679. No abnormality was found in the samples from all 83 subjects being studied.

    DISCUSSION
Abstract
Introduction
Methods
Results
Discussion
References

Factor V Leiden (Arg 506right-arrowGln mutation) is known to be an important risk factor for venous thrombo-embolism. Its prevalence is known to vary widely among different populations. The mutation in heterozygous or homozygous state is relatively more common in some European populations. The allele frequency in European is estimated to be 4.4%, with the highest prevalence among Greeks (7%). However, it was only 0.6% in Asia Minor and the mutation was not found in Africa and Southeast Asia.11,12,16 This may partly explain the rarity of thrombo-embolic diseases in these populations, although other factors may also contribute. A previous study has demonstrated the lack of APC resistance and Arg 506right-arrowGln mutation in healthy Hong Kong Chinese blood donors.12 None of our 43 thrombotic and 40 nonthrombotic Hong Kong patients in this study had the factor V Leiden mutation. Our result supports the findings of previous studies.12

An Arg 485right-arrowLys mutation at exon 10 of the factor V gene was first described by Gandrille et al.14 They have found this sequence variation in 3 of 104 (2.9%) normal subjects and 7 of 113 (6.4%) patients with protein C deficiency. This mutation was not associated APC resistance in their healthy subjects and its allelic frequency in their protein C-deficient patients was not significantly different form that observed in healthy subjects. The Arg 485 to Lys substitution is apparently a neutral polymorphism in terms of procoagulant activity or susceptibility to APC. In this study, nearly half of our 83 subjects, including both thrombotic and nonthrombotic patients, were found to have this sequence variation, suggesting a much higher allelic frequency of this mutation in Hong Kong Chinese. Like many other polymorphism, this Arg 485 to Lys substitution appears to have a highly variable allelic frequency in different ethnic populations. This mutation was seen at similar frequency in our thrombotic and nonthrombotic subjects, supporting the hypothesis of a neutral polymorphism in terms of procoagulant activity as originally proposed by Gandille et al.14

We have detected in this study a previously unreported mutation (A1090right-arrowG) of the factor V gene at exon 7. This mutation results in a Arg 306 to Gly substitution. Among our 84 subjects, 2 thrombotic patients and 1 nonthrombotic patient were found to possess this mutation in heterozygous state. This A1090right-arrowG mutation in the codon AGG of Arg306 is a missense point mutation predicting a replacement of arginine by a glycine residue.17 The substitution may potentially affect APC cleavage at the Arg 306 site of the factor V molecule. As the inactivation of factor Va is a sequential event, initial peptide bond cleavage of residue Arg 506 results in the exposure of other cleavage sites. The subsequent cleavage of at residues Arg 306 and Arg 679 completes the factor Va inactivation process. With a normal Arg 506 in these subjects, the effect of a defect at Arg 306 is uncertain. Nevertheless, cleavage of Arg306 is required for complete inactivation of the factor Va molecule. An Arg 306 defect may result in a protein that is cleaved at Arg506 and Arg679 only but still possesses about 60% cofactor activity.14-18 Fresh plasma samples are only available from 1 of the 3 subjects with the mutation. The patient had history of DVT and the APC resistance assay on the sample was within normal limits. At this stage, the clinical significance of the substitution at Arg306 is not certain as the number of positive cases in our series is small and the defect is found in both thrombotic and nonthrombotic subjects. It is not yet possible to assess the thrombotic risk of subjects with this defect. Large-scale epidemiologic studies on this Arg306 mutation are warranted. The true allelic frequency distribution of this defect in Chinese and other populations remains to be determined. Further functional and clinical correlation is also required.

    FOOTNOTES

   Submitted July 7, 1997; accepted November 10, 1997.
   Supported by a Conference and Research Grant (CRCG) of the University Research Committee of the University of Hong Kong.
   Address reprint requests to Raymond Liang, MD, Department of Medicine, Queen Mary Hospital, Hong Kong.
   The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

    REFERENCES
Abstract
Introduction
Methods
Results
Discussion
References

1. Kalafatis M, Bertina RM, Rand MD, Mann KG: Characterization of the molecular defect in the FV R506Q. J Biol Chem 270:4053, 1995[Abstract/Free Full Text]

2. Dahlback B, Carlsson M, Svensson PJ: Familial thrombophilia due to a previously unrecognized mechanism characterized by poor anticoagulant response to activated protein C: Prediction of a cofactor to activated protein C.  Proc Natl Acad Sci USA 90:1004, 1993[Abstract/Free Full Text]

3. Koster T, Rosendaal FR, de Ronde H, Briet E, Vandenbroucke JP, Bertina RM: Venous thrombosis due to poor anticoagulant response to activated protein C: Leiden thrombophilia study. Lancet 342:1503, 1993[Medline] [Order article via Infotrieve]

4. Griffin JH, Evatt B, Wideman C, Fernandez JA: Anticoagulant protein C pathway defective in majority of thrombophilic patients. Blood 82:1989, 1993[Abstract/Free Full Text]

5. Bertina RM, Koeleman BPC, Koster T, Rosendaal FR, Dirven RJ, de Ronde H, van der Velden PA, Reitsma PH: Mutation in blood coagulation factor associated with resistance to activated protein C.  Nature 369:64, 1994[Medline] [Order article via Infotrieve]

6. Greengard JS, Sun X, Xu X, Fernandez JA, Griffin JH, Evatt B: Activated protein C resistance caused by Arg506 Gln mutation in factor Va. Lancet 343:1361, 1994[Medline] [Order article via Infotrieve]

7. Voorberg J, Roelse J, Koopman R, Buller H, Berends F, ten Cate JW, Mertens K, Van Mourik JA: Association of idiopathic venous thromboembolism with single point mutation at Arg506 of factor V.  Lancet 343:1535, 1994[Medline] [Order article via Infotrieve]

8. Svensson PJ, Dahlback B: Resistance to activated protein C as a basis for venous thrombosis. N Engl J Med 330:517, 1994[Abstract/Free Full Text]

9. Dahlback B: Physiological anticoagulation. Inherited resistance to activated protein C and venous thromboembolism. J Clin Invest 94:923, 1994

10. Beauchamp NJ, Daly ME, Hampto KK, Cooper PC, Preston E, Peake IR: High prevalence of a mutation in the factor V gene within the UK population: Relationship to activated protein C resistance and familial thrombosis. Br J Haematol 88:219, 1994[Medline] [Order article via Infotrieve]

11. Rees DC, Cox M, Clegg JB: World distribution of factor V Leiden. Lancet 346:1133, 1995[Medline] [Order article via Infotrieve]

12. Chan LC, Bourke C, Lam CK, Liu HW, Brookes S, Jenkins V, Pasi J: Lack of activated protein C resistance in healthy Hong Kong Chinese blood donors---Correlation with absence of Arg506-Gln mutation of factor V gene (letter). Thromb Haemost 75:522, 1996[Medline] [Order article via Infotrieve]

13. Rosing J, Hoekema L, Nicolaes GA, Thomassen MC, Hemker HC, Varadi K, Schwarz HP, Tans G: Effects of protein S and factor Xa on peptide bond cleavages during inactivation of factor Va and factor VaR506Q by activated protein C.  J Biol Chem 270:27852, 1995[Abstract/Free Full Text]

14. Gandrille S, Greengard JS, Alhenc-Gelas M, Juan-Vague I, Abgrall JF, Jude B, Griffin JH, Aiach M, and the French Network on the behalf of INSERM: Incidence of activated protein C resistance caused by the Arg 506 Gln mutation in factor V in 113 unrelated symptomatic protein C-deficient patients. Blood 86:219, 1995

15. Ridker PM, Hennekens CH, Lindpaintner K, Stampfer MJ, Eisenberg PR, Miletich JP: Mutation in the gene coding for coagulation factor V and the risk of myocardial infarction, stroke and venous thrombosis in apparently healthy men. N Engl J Med 332:912, 1995[Abstract/Free Full Text]

16. Fujimura H, Kambayashi J, Monden M, Kato H, Miyata T: Coagulation factor V Leiden may have racial background. Thromb Haemostas 74:1379, 1995[Medline] [Order article via Infotrieve]

17. Kane WH, Ichinose A, Hagen FS, Davie FW: Cloning of cDNAs coding for the heavy chain region and connecting region of human factor V, a blood coagulation factor with four types of internal repeats. Biochemistry 26:6508, 1987[Medline] [Order article via Infotrieve]

18. Lu D, Kalafatis M, Mann KG, Long GL: Loss of membrane-dependent factor Va cleavage: A mechanistic interpretation of the pathology of protein C Vermont. Blood 84:687, 1994[Abstract/Free Full Text]


© 1998 by The American Society of Hematology.
 
0006-4971/98/91-0038$3.00/0

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
S. Tran, E. Norstrom, and B. Dahlback
Effects of Prothrombin on the Individual Activated Protein C-mediated Cleavages of Coagulation Factor Va
J. Biol. Chem., March 14, 2008; 283(11): 6648 - 6655.
[Abstract] [Full Text] [PDF]


Home page
CLIN APPL THROMB HEMOSTHome page
B. Dolek, S. Eraslan, S. Eroglu, B. E. Kesim, T. Ulutin, A. Yalciner, Y. R. Laleli, and N. Gozukirmizi
Molecular Analysis of Factor V Leiden, Factor V Hong Kong, Factor II G20210A, Methylenetetrahydrofolate Reductase C677T, and A1298C Mutations Related to Turkish Thrombosis Patients
Clinical and Applied Thrombosis/Hemostasis, October 1, 2007; 13(4): 435 - 438.
[Abstract] [PDF]


Home page
Hum ReprodHome page
F. Dawood, R. Mountford, R. Farquharson, and S. Quenby
Genetic polymorphisms on the factor V gene in women with recurrent miscarriage and acquired APCR
Hum. Reprod., September 1, 2007; 22(9): 2546 - 2553.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. A. Norstrom, S. Tran, M. Steen, and B. Dahlback
Effects of Factor Xa and Protein S on the Individual Activated Protein C-mediated Cleavages of Coagulation Factor Va
J. Biol. Chem., October 20, 2006; 281(42): 31486 - 31494.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
H. Sun
The interaction between pathogens and the host coagulation system.
Physiology, August 1, 2006; 21: 281 - 288.
[Abstract] [Full Text] [PDF]


Home page
ANGIOLOGYHome page
S. Kalkanli, O. Ayyildiz, N. Tiftik, S. Batun, A. Isikdogan, H. Ince, S. Tekes, and E. Muftuoglu
Factor V Leiden Mutation in Venous Thrombosis in Southeast Turkey
Angiology, March 1, 2006; 57(2): 193 - 196.
[Abstract] [PDF]


Home page
BloodHome page
E. Castoldi, J. M. Brugge, G. A. F. Nicolaes, D. Girelli, G. Tans, and J. Rosing
Impaired APC cofactor activity of factor V plays a major role in the APC resistance associated with the factor V Leiden (R506Q) and R2 (H1299R) mutations
Blood, June 1, 2004; 103(11): 4173 - 4179.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Steen, E. A. Norstrom, A.-L. Tholander, P. H. B. Bolton-Maggs, A. Mumford, J. H. McVey, E. G. D. Tuddenham, and B. Dahlback
Functional characterization of factor V-Ile359Thr: a novel mutation associated with thrombosis
Blood, May 1, 2004; 103(9): 3381 - 3387.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. van der Neut Kolfschoten, R. J. Dirven, H. L. Vos, G. Tans, J. Rosing, and R. M. Bertina
Factor Va Is Inactivated by Activated Protein C in the Absence of Cleavage Sites at Arg-306, Arg-506, and Arg-679
J. Biol. Chem., February 20, 2004; 279(8): 6567 - 6575.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
D. Scanavini, D. Girelli, B. Lunghi, N. Martinelli, C. Legnani, M. Pinotti, G. Palareti, and F. Bernardi
Modulation of Factor V Levels in Plasma by Polymorphisms in the C2 Domain
Arterioscler Thromb Vasc Biol, January 1, 2004; 24(1): 200 - 206.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. A. Kerlin, S. B. Yan, B. H. Isermann, J. T. Brandt, R. Sood, B. R. Basson, D. E. Joyce, H. Weiler, and J.-F. Dhainaut
Survival advantage associated with heterozygous factor V Leiden mutation in patients with severe sepsis and in mouse endotoxemia
Blood, November 1, 2003; 102(9): 3085 - 3092.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. G. Mann and M. Kalafatis
Factor V: a combination of Dr Jekyll and Mr Hyde
Blood, January 1, 2003; 101(1): 20 - 30.
[Full Text] [PDF]


Home page
BloodHome page
J. M. Soria, L. Almasy, J. C. Souto, A. Buil, E. Martinez-Sanchez, J. Mateo, M. Borrell, W. H. Stone, M. Lathrop, J. Fontcuberta, et al.
A new locus on chromosome 18 that influences normal variation in activated protein C resistance phenotype and factor VIII activity and its relation to thrombosis susceptibility
Blood, January 1, 2003; 101(1): 163 - 167.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. Norstrom, E. Thorelli, and B. Dahlback
Functional characterization of recombinant FV Hong Kong and FV Cambridge
Blood, June 28, 2002; 100(2): 524 - 530.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
G. A.F. Nicolaes and B. Dahlback
Factor V and Thrombotic Disease: Description of a Janus-Faced Protein
Arterioscler Thromb Vasc Biol, April 1, 2002; 22(4): 530 - 538.
[Abstract] [Full Text] [PDF]


Home page
Arch Intern MedHome page
R. H. Thomas
Hypercoagulability Syndromes
Arch Intern Med, November 12, 2001; 161(20): 2433 - 2439.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. A. Lane and P. J. Grant
Role of hemostatic gene polymorphisms in venous and arterial thrombotic disease
Blood, March 1, 2000; 95(5): 1517 - 1532.
[Full Text] [PDF]


Home page
ANN INTERN MEDHome page
F. Rodeghiero and A. Tosetto
Activated Protein C Resistance and Factor V Leiden Mutation Are Independent Risk Factors for Venous Thromboembolism
Ann Intern Med, April 20, 1999; 130(8): 643 - 650.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. C.H. de Visser, F. R. Rosendaal, and R. M. Bertina
A Reduced Sensitivity for Activated Protein C in the Absence of Factor V Leiden Increases the Risk of Venous Thrombosis
Blood, February 15, 1999; 93(4): 1271 - 1276.
[Abstract] [Full Text] [PDF]


Home page
HeartHome page
M A LAFFAN
Activated protein C resistance and myocardial infarction
Heart, October 1, 1998; 80(4): 319 - 321.
[Full Text]


Home page
BloodHome page
R. Liang, C.K. Lee, M.S. Wat, Y.L. Kwong, C.K. Lam, and H.W. Liu
Clinical Significance of Arg306 Mutations of Factor V Gene
Blood, October 1, 1998; 92(7): 2599 - 2600.
[Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
G. A.F. Nicolaes and B. Dahlback
Factor V and Thrombotic Disease: Description of a Janus-Faced Protein
Arterioscler Thromb Vasc Biol, April 1, 2002; 22(4): 530 - 538.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chan, W.P.
Right arrow Articles by Liang, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chan, W.P.
Right arrow Articles by Liang, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 1998 by American Society of Hematology         Online ISSN: 1528-0020