|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 4 (February 15), 1998:
pp. 1185-1195
Embryonal Carcinoma P19 Cells Produce Erythropoietin
Constitutively But Express Lactate Dehydrogenase in an
Oxygen-Dependent Manner
By
Taiho Kambe,
Junko Tada,
Mariko Chikuma,
Seiji Masuda,
Masaya Nagao,
Terumasa Tsuchiya,
Peter J. Ratcliffe, and
Ryuzo Sasaki
From the Division of Applied Life Sciences, Graduate School of
Agriculture, Kyoto University, Kyoto, Japan.
 |
ABSTRACT |
Embryonic stem cells and embryonal carcinoma P19 cells
produce erythropoietin (Epo) in an oxygen-independent manner, although lactate dehydrogenase A (LDHA) is hypoxia-inducible. To explore this
paradox, we studied the operation of cis-acting sequences from
these genes in P19 and Hep3B cells. The Epo gene promoter and 3
enhancer from P19 cells conveyed hypoxia-inducible responses in Hep3B
cells but not in P19 cells. Together with DNA sequencing and the normal
transcription start site of P19 Epo gene, this excluded the possibility
that the noninducibility of Epo gene in P19 cells was due to mutation
in these sequences or unusual initiation of transcription. In contrast,
reporter constructs containing LDHA enhancer and promoter were hypoxia
inducible in P19 and Hep3B cells, and mutation of a hypoxia- inducible
factor 1 (HIF-1) binding site abolished the hypoxic inducibility in
both cells, indicating that HIF-1 activation operates normally in P19 cells. Neither forced expression of hepatocyte nuclear factor 4 in P19
cells nor deletion of its binding site from the Epo enhancer was
effective in restoring Epo enhancer function. P19 cells may lack an
unidentified regulator(s) required for interaction of the Epo enhancer
with Epo and LDHA promoters.
| |
INTRODUCTION |
MAMMALS RESPOND TO oxygen deficiency in
many different ways (reviewed in Bunn and Poyton1). One
strategy for survival of the individual cell under hypoxic conditions
is the induction of glycolytic enzymes, facilitating ATP production by
glycolysis rather than mitochondrial oxidative phosphorylation. Because
ATP production is vital for cell survival, such a response is
appropriate in all cell types, including undifferentiated cells. In
contrast, erythropoietin (Epo), a hypoxia-inducible growth factor, is
produced by the specialized cells in liver, kidney, and
brain.2-4 Peritubular interstitial fibroblast-like cells
have been proposed to produce Epo in kidney,5 whereas in
liver the gene is expressed in both hepatocytes and Ito
cells.6,7 Hypoxia-stimulated production of Epo in liver and
kidney increases formation of red blood cells, leading to better oxygen
supply to tissues. Astrocytes are responsible for Epo production in the
central nervous system and the hypoxic induction of brain Epo may
contribute to protect neurons from ischemia-induced cell
death.4,8
Induction of the hypoxia-inducible genes is at least in part due to
activation of gene transcription, although prolongation of mRNA
half-life may contribute in some cases. Survey of cis-acting DNA sequences required for the hypoxic activation of gene transcription has shown that most of the hypoxia-inducible genes thus far
investigated possess hypoxia-response elements (enhancer) to which
hypoxia-inducible factor 1 (HIF-1) binds.9-27 HIF-1 is a
transcription factor consisting of two basic helix-loop-helix-PAS
proteins (HIF-1 and HIF-1 ).19-21 Taken together with
the wide distribution of HIF-1-like proteins from mammalian to insect
cells, it appears that the hypoxia-stimulated transcription of specific
genes through HIF-1 activation is a highly conserved and widely
operative mechanism responding to cellular oxygen
deficiency.13,17,28
The genes encoding glycolytic enzymes, including aldolase A,
phosphoglycerate kinase 1, enolase 1, phosphofructokinase L, and
lactate dehydrogenase A (LDHA), are
hypoxia-inducible.22-25,29 Recent studies of
cis-acting sequences for genes encoding enolase 1 and LDHA
indicated that they have multiple sites for HIF-1 binding in the
5-flanking region and that binding to a single specific site is
essential for the hypoxic activation of transcription but not
sufficient for the full activation.24,25 The full
activation appears to require binding of HIF-1 to multiple sites, if
not all.25
Human hepatoma cell lines, Hep3B and HepG2, have been shown to produce
Epo in an oxygen-dependent manner and have been widely used for
investigation of the mechanism underlying the hypoxic activation of Epo
gene.30,31 An important cis-acting sequence required for the hypoxic induction of Epo gene was defined in the
3-flanking region.9-14,32,33 This enhancer is a
50-bp element consisting of three important
segments.12,14,33 The highly conserved sequence near the
5 end of the enhancer is an HIF-1 binding
site.12,15-17 The middle segment containing CA repeats in
human gene is not well conserved between human and mouse, but the
mutation of this region abolished the inducible behavior of both the
human and murine enhancers.12,18 Thus far, the specific protein that binds to this region has not been
demonstrated. The third element is the 3 segment,
which is again highly conserved and amplifies the hypoxic
signal.12,32,33 Binding of hepatocyte nuclear factor 4 (HNF-4) to this element appears to increase the hypoxic
inducibility.33 Whereas the regulatory system for Epo gene
expression in liver cells is not fully understood, even less is known
of kidney cells and astrocytes.
Mouse embryonic stem (ES) cells express Epo mRNA,34 but
oxygen-dependency of its expression is not known. If we assume that some factors required for the hypoxic induction of Epo are expressed only in the cells differentiated for Epo production but not in undifferentiated cells and that the hypoxia-inducible pathway for
glycolytic enzymes is complete in most cell types (including undifferentiated cells), we might predict that expression of Epo by ES
cells would be oxygen-independent, whereas that of glycolytic enzymes
would be hypoxia-inducible. Our finding that multipotential embryonal
carcinoma P19 cells produce Epo has made it possible to examine this
assumption and the underlying mechanisms. We show here that P19 cells
express LDHA in an oxygen-dependent manner, but produce Epo
constitutively. We also compare aspects of hypoxic transcriptional
activation in P19 cells with those in Hep3B cells (specialized for
hypoxia-inducible production of Epo), using reporter constructs that
contain promoters and enhancers of the LDHA and Epo genes. In addition,
treatment with retinoic acid differentiates P19 cells into
astrocytes,35 which is a cell type producing brain Epo in a
hypoxia-inducible manner.4 P19 cells thus may provide a
useful system for searching for a regulator(s) that is expressed in the
differentiated Epo-producing cells and needed for the hypoxic
activation of Epo gene transcription.
| |
MATERIALS AND METHODS |
Cell culture and Epo production.
Materials for cell culture were obtained from the indicated sources:
Dulbecco's modified Eagle medium (DMEM; GIBCO, Grand Island, NY),
Minimum Essential Medium without ribonucleotides and
deoxyribonucleotides (MEM; GIBCO), and fetal calf serum (FCS; Bio
Whittaker, Walkersville, MD). P19 cells were maintained in MEM
supplemented with 10% FCS (growth medium for P19 cells) in a
gelatin-coated dish. Hep3B cells were maintained in DMEM supplemented with 10% FCS (growth medium for Hep3B cells). The cells were cultured under normoxic conditions (5%CO2, 21% O2, and
74% N2 atmosphere) in a Napco Model 5100 CO2
incubator (Wakenyaku Co Ltd, Kyoto, Japan) at 37°C. In the
experiments to examine Epo production, P19 cells (5 × 104/well) and Hep3B cells (2 × 105/well)
were plated in two 6-well plates (Nunc A/S, Roskilde, Denmark) and
cultured for 24 hours in 21% oxygen. Then the medium was replaced with
the fresh growth medium. One of the two plates was incubated for a
further 24 hours in 21% oxygen, whereas the other was incubated for 24 hours in 2% oxygen. Hypoxia was generated in an oxygen-regulated incubator (MODEL 9200; Wakenyaku Co Ltd, Kyoto, Japan). Epo in the
spent medium was measured by enzyme-linked immunoassay (EIA) and its
amount was calculated from a standard curve drawn using recombinant Epo
as a standard.36 To measure the activity of LDH and the
amount of cellular proteins, the cells were washed three times with 10 mmol/L phosphate-buffered saline, pH 7.4 (PBS), and lysed by freeze and
thawing. Cell lysates were prepared by centrifugation at
10,000g for 20 minutes. LDH activity in the lysates was
measured by using the LDH assay kit following the protocol from the
manufacturer (Kyokuto Pharmaceutical Industrial Co Ltd, Tokyo, Japan).
Cellular proteins in the lysates were determined with a protein assay
kit (Bio-Rad Laboratories, Hercules, CA) using bovine Igs as a
standard.
Mouse embryonic stem (ES) cell line, TT2, was maintained on the
mitomycin C-treated feeder cells in DMEM containing 10% FCS, 104 U/mL leukemia inhibitory factor, 10 4
mol/L -mercaptoethanol, nonessential amino acid, and sodium pyruvate.37 The feeder cells were prepared from 14-day
embryos of YF4 mouse.37 All materials to maintain TT2 cells
were purchased from GIBCO. TT2 cells (8 × 105 cells)
were seeded on the feeder cells in a 60-mm dish and cultured for 12 hours in 21% oxygen. After being replaced with the fresh medium, the
cells were cultured for 24 hours in 2%, 5%, and 21% oxygen. Epo in
the spent medium was measured by EIA.
Purification and bioactivity of Epo.
Human recombinant Epo was prepared as described
previously.38 P19 cells were cultured in
175-cm2 T-flasks and Epo in the spent medium (2 L) was
partially purified with a gel (600 µL) on which Epo-directed
monoclonal antibody, R2,36 was fixed. Mouse serum Epo was
isolated from phenylhydrazine-treated anemic mice.39 Epo
from both sources was stored in PBS containing 0.1% bovine serum
albumin. Bioactivity of Epo was assayed using Epo-dependent growth of
Ep-FDC-P2 cells measured by the increased absorbance at 600 nm due to
3-(4.5-dimetyl thiazol-2-yl)-2.5-diphenyl tetrazolium bromide (MTT;
Sigma, St Louis, MO) reduction.40
Quantification of mRNAs for Epo, LDHA, and -actin by reverse
transcription-polymerase chain reaction (RT-PCR).
Total RNA was prepared from P19 cells cultured for 24 hours under
normoxic and hypoxic (5% and 2% oxygen) conditions using a total RNA
isolation kit (Promega Corp, Madison, WI). The RT reaction was
performed using a random nonamer primer and 1 µg of heat-denatured
RNA. PCR primers used in this study were as follows: Epo sense primer
(REP62F, 5-TCCTTGCTACTGATTCCTCTGG-3) and antisense primer
(REP512R, 5-AAGTATCCGCTGTGAGTGTTCG-3); LDHA sense primer
(LDHA22F, 5-GTCTCCCTGAAGTCTCTT-3) and antisense primer
(LDHA374R, 5-ATTCCCCAGAGGGTGTCT-3); -actin sense
primer (m112F, 5-ATCCTGACCCTGAAGTACCC-3) and antisense
primer (m545R, 5-ATTTCCCTCTCAGCTGTGGT-3). The primers
of Epo, LDHA, and -actin were based on Nucleotide Sequence Data
banks (accession nos. D10763, M17516, and X03765, respectively). The
PCR-amplified products derived from Epo competitor DNA, transcribed Epo
cDNA, LDHA cDNA, and -actin cDNA were the DNA fragments of 282, 451, 353, and 434 bp, respectively. We estimated Epo mRNA levels by
competitive RT-PCR, as described previously.41 To estimate
LDHA mRNA expression, semiquantitative PCR analysis was
performed.42 Briefly, 22 to 24 PCR cycles consisting of 1 minute at 94°C for denaturation, 2 minutes at 63°C for
annealing, and 3 minutes at 72°C for elongation were performed. The
amplified product at each cycle was electrophoresed on a 2.5% agarose
gel and stained with ethidium bromide. Quantification of the band
intensity was performed on a power Macintosh 7500 computer (Apple
Computer Inc, Cupertino, CA) using the public domain NIH image program
(written by Wayne Rasband at the US National Institutes of Health
[Bethesda, MD] and available from the Internet by
anonymous ftp from zippy.nimh.nih.gov). The band intensity was
proportional to PCR cycle number. To normalize the efficiency of RT,
semiquantitative PCR for -actin was also performed, using 17 to 19 cycles (1 minute at 94°C, 2 minutes at 64°C, and 3 minutes at
72°C). Because the band intensity of -actin was proportional to
PCR cycle number, the intensity of 17 cycle was used for normalization.
Transient assay of reporter gene expression.
Plasmids were transfected into P19 cells by Trans IT LT1
(PanVera Corp, Madison, WI) and Hep3B cells by LipofectAce (Life Technologies, Inc, MD) following the protocol from the manufacturer. P19 cells (5 × 104/well) and Hep3B cells (2 × 105/well) were seeded in 6-well plate 20 hours before
transfection. Cells were cotransfected with 1.5 µg of test plasmid
and 0.05 µg of pactgal,43 which carried the
-galactosidase gene under the control of the chicken -actin
promoter. For a given test plasmid, two plates were transfected at the
same time. The cells were incubated for 6 hours, and the medium was
replaced with the fresh growth medium. One of the two plates was
incubated for a further 20 hours under normoxic condition, and the
other was incubated for 20 hours under hypoxic condition (2%
O2, 5% CO2, and balance N2). For
transient expression of HNF-4, P19 cells were cotransfected by the
Trans IT LT1 reagent with three plasmids, 0.15 µg luciferase (Luc) expression plasmid under control of LDHA promoter or Epo promoter
with Epo enhancer, 0.01 µg of pactgal for normalization of
transfection efficiency, and 1.2 µg pLEn(M4)LPHNF4 or control vector.
For the Luc assay, cell extracts were prepared using PicaGene Reporter
Lysis Buffer (Toyo Ink MFG CO, LTD, Tokyo, Japan) and assayed for
transiently expressed Luc and -galactosidase. Luc activity was
measured using Lumat LB9051 (EG&G Berthold, Bad Widbad, Germany) and
Luc Assay Kit (Toyo Ink MFG CO, LTD), and -galactosidase activity
was measured by using chlorophenol red--D-galactopyranoside as a
substrate.44 Luc activity was divided by -galactosidase activity for normalization of transfection efficiency. Expression of
Luc gene was represented as the ratio of Luc/-galactosidase.
Promoter and enhancer of Epo gene in P19 cells.
The promoter and enhancer regions of Epo gene were cloned from P19
genomic DNA by PCR. The mouse Epo promoter region was first amplified
by PCR in the presence of 1 µg DNA, sense primer ( 468F, 5-AACCCTGACCCTTAGAACAA-3) and antisense primer (126R,
5-CCTGGAAGAAAGTGGTCACT-3) in a total of 20 µL. Each of
35 PCR cycles consisted of 1 minute at 94°C, 2 minutes at 60°C,
and 3 minutes at 72°C. The second PCR was performed by adding 1 µL of the first PCR product to reaction mixture containing sense
primer (433F, 5-GAAGAAAAAGCATCCGAGCC-3) and
antisense primer (53R, 5-TCGGGAACACAGTGAGACAC-3) in a
total of 100 µL. Each of 35 PCR cycles consisted of 1 minute at
94°C, 2 minutes at 60°C, and 3 minutes at 72°C. The mouse
Epo enhancer region was amplified by PCR in the presence of 1 µg DNA,
sense primer (3777F, 5-CTCACCCCATCTGGTCGCAA-3), and
antisense primer (4017R, 5-GGCTCCTGTTTCCTCAACGG-3) in a
total of 100 µL. The primer number was based on the definition of the
transcription start site as +1.45 The amplified products of
the mouse Epo promoter and enhancer region were confirmed by direct
sequencing.
Determination of the transcription start site of Epo gene.
Total RNA from P19 cells was prepared and the 5 end of Epo mRNA
was determined by Marathon cDNA Amplification Kit (Clontech Laboratories, Inc, Palo Alto, CA).
Preparation of Luc reporter plasmids under control of Epo promoter
and enhancer.
An amplified mouse Epo promoter fragment was digested by Acc I
and blunted. The resulting 0.2-kb fragment (m0.2k) was subcloned into
the HincII site of pUC19 to produce pUCm0.2k. The mouse Epo enhancer (mEn) was blunted and subcloned into the Sma I site of pUC19 to produce pUCmEn. pm0.2kLuc containing m0.2k upstream of Luc
gene was prepared by subcloning a BamHI-HindIII
fragment of pUCm0.2k into the Bgl II and HindIII sites
of basic vector 2, PGV-B2 (Toyo Ink MFG CO, LTD). pm0.2kLucmEn was
constructed by insertion of a Bgl II-Sal I fragment
from pUCmEn into the BamHI and Sal I sites of
pm0.2kLuc. The reporter plasmids containing human Epo promoter and
enhancer were described previously.46 A 55 mer
(GATCCCCCGGGCTACGTGCTGTCTCACACAGCCTGTCATAAGCTTCGACCTGCA) oligonucleotide and a 47 mer
(GGTCGAAGCTTGATGACAGGCTGTGTGAGACAGCACGTAGCCCGGGG) oligonucleotide were synthesized and annealed to prepare the
human Epo enhancer fragment that lacks HNF-4 binding site but still retains HIF-1 binding site and CA repeats. The enhancer fragment was
subcloned into the BamHI and Sse 8387I sites of
p0.2kLucEn to produce p0.2kLucEn( HNF-4).
Preparation of Luc reporter plasmids under control of LDHA promoter
preceded with the wild-type or mutant LDHA enhancer.
A Kpn I-BamHI fragment of PGV-B2 was subcloned into the
Kpn I and BamHI sites of pUC19 to produce pUCLuc.
pLEnLPLuc, pLEn(M1)LPLuc, and pLEn(M4)LPLuc were prepared by subcloning
a Sac I-Sse8387I fragment of pUCLuc into the
Sac I and EcoT22I sites of pLDHGH, pLDH(M1)GH, and
pLDH(M4)GH,24 respectively. LP, LEn, LEn(M1), and LEn(M4)
represent LDHA promoter, LDHA enhancer, LDHA enhancer mutated at the
first HIF-1 binding site, and LDHA enhancer mutated at the second
binding site, respectively (see also Fig 6).
View larger version (12K):
[in this window]
[in a new window]
| Fig 6.
DNA sequence of mouse LDHA enhancer and promoter. +1 is
the transcription start site. Sites 1 and 2 are the HIF-1 binding sites.24,25 M1 is the mutant in which ACGT was replaced
with CATG, and M4 is the mutant in which GCAC was replaced with
TACA.24 In this report, we use the following terms. LEn,
LDHA enhancer (186~Aat II fragment); LP, LDHA promoter
(Aat II~Sac I fragment); LEnLP, LDHA enhancer plus
promoter (186~Sac I fragment); LEn(M1 or M4)LP, mutant
derivatives of the 186~Sac I fragment.
|
|
Preparation of Luc reporter plasmid under control of Epo promoter
with LDHA enhancer.
pLEn0.2kLuc was generated by subcloning a blunted Aat II
fragment of pLEnLPLuc into the blunted BamHI and Apa I
sites of pEn0.2kLuc.46 A blunted Aat II fragment of
pLEnLPLuc was subcloned into the blunted HindIII site of
p0.2kLuc46 to produce p0.2kLucLEn.
Preparation of Luc reporter plasmid under control of LDHA promoter
with Epo enhancer.
An Xba I-Apa I fragment of pEpoP-Luc-E46
containing the human Epo enhancer (En) was excised and cloned into the
Xba I and Apa I sites of pcDNA3 (Invitrogen Co,
San Diego, CA) to produce pcEn1. pLEn(M4)LPLucEn
containing the mutant LDHA enhancer, LDHA promoter, Luc gene, and human
Epo enhancer, in this order, were generated by subcloning an
Xho I fragment of pcEn1 into the Sal I site of pLEn(M4)LPLuc. An Xba I-EcoRI fragment of
pEpoPLE46 containing human Epo enhancer was subcloned into
the EcoRI and Xba I sites of pcDNA3 to produce pcEn2.
pEnLEn(M4)LPLuc, which contained Epo enhancer, the mutant LDHA
enhancer, LDHA promoter, and Luc gene, in this order, was constructed
by inserting an Apa I fragment of pcEn2 into the Apa I
site of pLEn(M4)LPLuc.
Preparation of HNF-4 expression vector.
An EcoRI fragment of pCMX-HNF433 that contained the
full-length HNF-4 coding region was cloned into the EcoRI site
of pcDNA3 to produce pCMV-HNF4. pLEn(M4)LPHNF4 was generated by
subcloning a Sac I-Not I fragment of pCMV-HNF4 into the
Sac I and Eco52I sites of pLEn(M4)LPLuc. pLEn(M4)LP
that does not contain the HNF-4 gene was prepared by deletion of
the Sac I-Eco52I fragment from pLEn(M4)LPLuc and was
used as a control vector in the experiments using pLEn(M4)LPHNF4.
| |
RESULTS |
Oxygen-independent expression of Epo by ES cells and embryonal
carcinoma P19 cells.
Mouse ES cells have been shown to express Epo mRNA,34 but
whether they secrete Epo protein into the culture medium is not known.
It is also unknown whether, in these cells, the Epo mRNA level is
regulated by oxygen. We cultured ES cells in 21%, 5%, and 2% oxygen
for 24 hours and assayed Epo in the media by EIA. The amount of Epo
protein secreted into the media was similar when cultured in the
different oxygen concentrations (data not shown). Immunoreactive Epo
was undetectable in the media when the feeder cells were cultured
without ES cells, confirming that Epo was produced by ES cells.
Because the requirement for feeder cells in the maintenance of ES cells
complicates assays of gene expression by transient transfection, we
examined whether multipotential embyronal cells, that can be cultured
without feeder cells, mimic ES cells with respect to the Epo
production. We found that P19 cells, which are murine embryonal
carcinoma cells with pluripotentiality of differentiation,35 produced Epo. To confirm that the
immunoreactive Epo is bioactive, we concentrated the material in the
culture media by using a gel on which Epo-directed monoclonal antibody was fixed36 and assayed stimulatory effect of the eluted
fraction on the proliferation of an Epo-dependent erythroid precursor
cell line. As shown in Fig 1, Epo in the
concentrated P19 culture supernatant stimulates proliferation of the
cells with an efficiency similar to that of recombinant human Epo or
higher than that of Epo isolated from mouse serum. The stimulation was
completely abrogated by a soluble form of Epo receptor (sEpoR), an
extracellular domain of the receptor capable of binding with
Epo.47
View larger version (22K):
[in this window]
[in a new window]
| Fig 1.
In vitro activity of Epo produced by P19 cells. Epo
activity was assayed with Epo-dependent proliferation of Ep-FDC-P2
cells measuring the increased absorbance at 600 nm due to reduction of
MTT. ( ,  ) P19 Epo; ( ,  ) mouse serum Epo; ( ,  ) human
recombinant Epo; (, , ) in the presence of sEpoR capable of
binding with Epo. When assayed in the presence of sEpoR, Epo was
preincubated with sEpoR (100 µg/mL) for 1 hour. Each point is the
mean of duplicate assays.
|
|
We cultured P19 cells and Hep3B cells in 21% and 2% oxygen for 24 hours and assayed Epo in the culture media.
Figure 2 shows that there is only a very
small increase of Epo production by P19 cells in 2% oxygen compared
with the production in 21% oxygen (Fig 2A), whereas, in keeping with
previous results,30,31 the production of Epo by Hep3B cells
is greatly increased under the hypoxic condition (Fig 2B). Assay of Epo
mRNA with competitive RT-PCR indicated that the mRNA level was almost
unchanged when P19 cells were cultured in 21%, 5%, and 2% oxygen
(Fig 3).
View larger version (17K):
[in this window]
[in a new window]
| Fig 2.
Oxygen-independent production of Epo by P19 cells. P19
cells and Hep3B cells were cultured in 21% and 2% oxygen for 24 hours. Epo concentration in the spent medium and the total cellular
proteins were determined. Epo production is given as Epo (in picograms) per milligram of cellular protein. Inducibility (2% oxygen/21% oxygen) is indicated. Each value is the mean ± SD of triplicate experiments.
|
|
View larger version (22K):
[in this window]
[in a new window]
| Fig 3.
Oxygen-independent expression of Epo mRNA by P19 cells.
P19 cells were cultured in 21%, 5%, and 2% oxygen for 24 hours.
Total RNA was prepared and competitive RT-PCR was performed to estimate Epo mRNA. Competitor DNA in the PCR reaction mixtures was increased from 0 to 100 fg.41 The amplified products of 451 bp and
282 bp were derived from transcribed Epo cDNA and the competitor DNA, respectively. The band intensity was measured and Epo mRNA was calculated from the equivalence points of the band intensity of the
amplified products. The calculation yielded 0.69 ng Epo mRNA/mg total
RNA when the cells were cultured in 21% oxygen, 0.48 in 5% oxygen,
and 0.78 in 2% oxygen. The content of Epo mRNA relative to that in
21% oxygen is shown.
|
|
The transcription start site for the murine Epo gene in kidney has been
shown.48 It was first necessary to know the transcription start site of Epo gene in P19 cells, because unresponsiveness of P19
Epo gene to hypoxia might be due to the use of a cryptic promoter that
was unable to interact appropriately with the 3 enhancer
responsible for hypoxic induction. Determination of 5 end of P19
Epo mRNA by the use of rapid amplification cDNA ends method showed a
start site very close to that for kidney Epo gene,48 indicating that expression of Epo gene in P19 cells is under control of
the promoter functional in the kidney cells.
Transient assay of reporter gene expression to examine if
hypoxic-response elements (enhancers) function in P19 cells.
From P19 cell genomic DNA, we cloned both the minimum promoter of mouse
Epo gene (283 bp from 230 to +53, numbering nucleotides according to Galson et al45) and the enhancer (213 bp from
3805 to 4017). Sequencing of these fragments showed no mutation. We next constructed plasmids in which Luc reporter gene was under control
of the cloned mouse promoter (m0.2k, see
Fig 4) with the cloned enhancer (mEn) fused
3 to Luc gene. Plasmids containing various lengths of
5-flanking sequence from the human Epo gene fused to Luc gene
and human Epo enhancer (En; 116 bp from 3457 to 3572; see Lin et
al49), in this order, were also constructed. The plasmids
were transfected into P19 cells and Hep3B cells with pactgal (to
normalize transfection efficiency). Transfected cells were incubated
for 6 hours in 21% oxygen and then for 20 hours in either 21% or 2%
oxygen. Activities of Luc and -galactosidase were assayed in cell
lysates and the Luc/-galactosidase ratios were calculated. Results
are shown in Fig 4. Transfection of P19 cells with the plasmid
containing both mouse Epo promoter and enhancer yielded a 2.2-fold
hypoxic induction (Fig 4A). However, the similar (1.5-fold) induction
was also seen in the plasmid without the enhancer. The same was true
for plasmids constructed with elements from human source (Fig 4C). The
extent of Epo 5-flanking region (0.2 to 3.5 kb) had no influence
on the hypoxic inducibility in P19 cells. However, when Hep3B cells
were used, large hypoxic induction of Luc expression was observed in
the plasmids containing either mouse or human enhancer (Fig 4B and D),
which was in good agreement with the results reported
previously.9-11,32 Thus, the hypoxia-inducible enhancer of
mouse and human Epo genes does not function in P19 cells.
View larger version (26K):
[in this window]
[in a new window]
| Fig 4.
The hypoxia-inducible enhancer of mouse and human Epo
gene functions in Hep3B cells but not in P19 cells. Transient
expression of reporter constructs in 21% oxygen (N) and in 2% oxygen
(H) was assayed. (A and C) P19 cells; (B and D) Hep3B cells. m0.2k, 0.2-kb mouse Epo promoter; mEn, mouse Epo enhancer; En, human Epo
enhancer. 0.2k, 1.6k, and 3.5k represent 0.2-kb, 1.6-kb, and 3.5-kb
5-flanking regions of human Epo gene. Relative light units (RLU;
Luc activity) per -galactosidase activity are shown. Hypoxic inducibility (the ratio of Luc activity in 2% v 21% oxygen)
is also indicated. Each value is the mean ± SD of triplicate
experiments.
|
|
Hypoxic induction of LDHA in P19 and Hep3B cells.
Because HIF-1 is essential for hypoxia-inducible function of the Epo
enhancer, we considered the possibility that oxygen-independent production of Epo in P19 cells might be attributable to lack of HIF-1.
We examined whether LDHA, a glycolytic enzyme that has been shown to be
hypoxia-inducible in a variety of cells,22-25,29 was
induced in P19 cells upon hypoxia. P19 and Hep3B cells were cultured in
21% or 2% oxygen, and the intracellular LDH activity was assayed. As
shown in Fig 5A, LDH activity in P19 cells
increased under the low oxygen in a similar manner to Hep3B cells. LDHA mRNA was assayed by RT-PCR, varying the cycle number for PCR. The
amount of product was measured (see the Materials and Methods) and
plotted against the cycle number after normalization with the -actin
mRNA-derived product. Figure 5B shows that the amount of LDHA
mRNA-derived product is approximately proportional to the cycle number
and increases when the cells were cultured under hypoxic conditions.
These results indicate that the increase of LDH activity in P19 cells
upon hypoxia is due to an elevated LDHA mRNA level.
View larger version (31K):
[in this window]
[in a new window]
| Fig 5.
Hypoxic induction of LDH in P19 cells. (A) LDH activity;
(B) LDHA mRNA. In (A), P19 cells and Hep3B cells were cultured in 21%
and 2% oxygen for 24 hours and cellular LDH activity was determined. LDH activity (Wro units of the LDH assay kit) per milligram of cellular
protein is shown. Hypoxic inducibility (activity ratios in 2% and 21%
oxygen) is indicated. Each value is the mean ± SD of triplicate
experiments. In (B), P19 cells were cultured in 21%, 5%, and 2%
oxygen. LDHA mRNA in total RNA was amplified by RT-PCR, varying the PCR
cycle number (22, 23, and 24 cycles). LDHA mRNA-derived product of 353 bp is shown. -Actin mRNA was also amplified to use for normalization
of efficiency in RT (see the Materials and Methods). Normalized band
intensities relative to that of the product amplified (22 cycle) from
LDHA mRNA of the cells cultured in 21% oxygen were plotted against PCR
cycle number. () 21% oxygen; () 5% oxygen; () 2% oxygen.
|
|
Mutation of HIF-1 binding sites in the LDHA enhancer and hypoxic
induction of Luc.
Expression of mouse LDHA is under control of the minimum promoter
containing TATA box (46 to 1 in
Fig 6) and the enhancer (85 to
47).24 The enhancer contains two HIF-1 binding sites (domains defined by site 1 and site 2 in Fig 6). Binding of HIF-1 to
site 2 is essential for hypoxic induction but not sufficient. Binding
to site 1 is also necessary for the full induction.24,25 To
confirm that HIF-1 is present in P19 cells, plasmids in which expression of Luc gene was under control of LDHA promoter and enhancer
with or without mutations in HIF-1 binding sites (mutations M1 and M4
in Firth et al24) were constructed and the transient expression of Luc in 21% or 2% oxygen was assayed using P19 and Hep3B
cells (Fig 7). Hypoxia induced an 8.4-fold
increase of Luc expression in P19 cells (pLEnLPLuc in Fig 7A) when Luc
gene was fused to LDHA promoter and wild-type of LDHA enhancer. There
was no hypoxic induction when the LDHA enhancer was mutated at HIF-1 binding site 2 [see pLEn(M4)LPLuc]. Mutation of HIF-1 binding site 1 reduced significantly but did not completely abrogate the hypoxic
induction [pLEn(M1)LPLuc]. When Hep3B cells were used, similar
results were obtained (Fig 7B) that were consistent with the results
previously reported using human HeLa cells as host cells and human
growth hormone as a reporter.24 P19 cells and Hep3B cells
are thus equivalent with respect to the hypoxic induction of LDHA gene
through activation of HIF-1, but they were quite different in the
hypoxia-inducible response of Epo gene and its cis-acting
sequences.
View larger version (22K):
[in this window]
[in a new window]
| Fig 7.
P19 cells possess an intact hypoxia-signaling pathway
through HIF-1 activation. Transient expression of reporter constructs in 21% oxygen (N) and in 2% oxygen (H) was assayed. (A) P19 cells; (B) Hep3B cells. WT, wild type; M1, mutant in the HIF-1 binding site 1;
M4, mutant in the HIF-1 binding site 2; LEn, LDHA enhancer; LP, LDHA
promoter. Relative light units (RLU; Luc activity) per -galactosidase activity are shown. Hypoxic inducibility (the ratio
of Luc activity in 2% oxygen v 21% oxygen) is shown. Each value is the mean ± SD of triplicate experiments.
|
|
Hypoxic interaction between heterologous promoters and enhancers.
To know the interaction in hypoxia between heterologous promoters and
enhancers (Epo promoter v LDHA enhancer and LDHA promoter v Epo enhancer) in P19 and Hep3B cells, we constructed plasmids (shown in Fig 8) and transient expression
of Luc in 21% and 2% oxygen was assayed. First, interaction of Epo
promoter (0.2k) and LDHA enhancer (LEn) was examined (Fig 8A and B).
Epo promoter was activated by LDHA enhancer in the hypoxic condition in
both cells, but the hypoxic activation in P19 cells was fivefold to sevenfold lower than in Hep3B cells. Location of the enhancer upstream
of the promoter was more efficient for hypoxic induction. Next,
interaction of LDHA promoter (LP) and Epo enhancer (En) was examined
(Fig 8C and D). For this experiment, the Epo enhancer was inserted into
plasmid pLEn(M4)LPLuc (in which the LDHA enhancer was nonfunctional due
to mutation at HIF-1 binding site 2), either upstream of the mutant
LDHA enhancer or downstream of the Luc gene. In P19 cells, little
hypoxia-inducible response was regained when Epo enhancer was inserted
(Fig 8C). In contrast, insertion of Epo enhancer resulted in the full
recovery of the hypoxia- inducible response in Hep3B cells (Fig 8D).
The full retrieval was achieved even when Epo enhancer was cloned
3 to Luc gene (distant from the promoter).
View larger version (23K):
[in this window]
[in a new window]
| Fig 8.
Hypoxic interaction between heterologous promoters and
enhancers. (A and C) P19 cells; (B and D) Hep3B cells. Transient
expression of reporter constructs in 21% and 2% oxygen was assayed.
Hypoxic inducibility (the ratio of Luc activity in 2% oxygen v
21% oxygen) is indicated. pLEn(M4)LPLuc shows little hypoxic
inducibility in both P19 and Hep3B cells (see also Fig 7). Each value
is the mean ± SD of triplicate experiments.
|
|
Cotransfection of HNF-4.
In addition to HIF-1 binding site on Epo enhancer, other two sites play
an important role in the hypoxic induction.12,18,32,33 HNF-4 expressed in Hep3B cells has been shown to bind to the 3 portion of the enhancer and expression of HNF-4 in HeLa cells (which do
not express HNF-4) elevated the hypoxia-inducible response of a
reporter construct containing Epo enhancer.33 Plasmids containing an HNF-4 gene fused to LDHA promoter [LEn(M4)LP] or cytomegalovirus (CMV) promoter were cotransfected into P19
cells to examine whether HNF-4 increases Epo enhancer activity that was
otherwise inactive in P19 cells. Transient assay of Luc gene expression
in 2% oxygen showed that there was a slight activation by HNF-4 when
the ratio of the HNF-4 expression plasmid to the reporter plasmid was
increased to 8 (Fig 9). In Fig 9A,
interaction with the Epo enhancer in the context of the mutated mouse
LDHA promoter-enhancer [pLEn(M4)LPLuc] was examined. The result was very similar when reporter plasmids constructed from human Epo gene
elements (0.2k and En) were cotransfected with the HNF-4 expression
plasmid (Fig 9B).
View larger version (25K):
[in this window]
[in a new window]
| Fig 9.
Effect of HNF-4 on transient expression of reporter
constructs in P19 cells. P19 cells were cotransfected with the reporter plasmids shown in the figure and HNF-4 expression plasmid
[pLEn(M4)LPHNF-4] to determine if HNF-4 activates the Epo enhancer in
P19 cells. In (A), combination of LDHA promoter (LP) and Epo enhancer
(En); in (B), combination of human Epo promoter (0.2k) and En.
Transient expression of reporter constructs in 21% and 2% oxygen was
assayed. The ratio of HNF-4 expression plasmid versus reporter plasmid is shown. Hypoxic inducibility (the ratio of Luc activity in 2% oxygen
v 21% oxygen) is indicated. Each value is the mean ± SD of triplicate experiments.
|
|
| |
DISCUSSION |
Several cell lines have been reported to produce Epo constitutively
(see Goldberg et al30 and the references therein), but the
mechanisms underlying the constitutive expression in normoxic cells and
the absence of inducibility by hypoxia have not been investigated. We
found that multipotential embryonal carcinoma P19 cells produce Epo
mRNA and secrete bioactive Epo protein in an oxygen-independent manner.
This finding provided an opportunity to compare the operation of Epo
gene control sequences in these undifferentiated cells with Hep3B
cells, which are specialized for oxygen-dependent Epo production.
Sequencing of the Epo promoter and enhancer regions cloned from P19
cells excluded the possibility that the oxygen-independent expression
of Epo gene is due to a mutation in these sequences. Determination of
mRNA 5 end also excluded the possibility that transcription of
Epo gene in P19 cells might start using an unusual promoter incapable
of interacting with the Epo enhancer.
As summarized in Table 1, reporter
constructs containing the cloned Epo promoter and enhancer showed very
low hypoxia-inducibility in P19 cells, whereas they were highly
inducible in Hep3B cells. Similar results obtained using reporter
constructs containing varying extents of 5-flanking sequence
from the human Epo gene together with the human Epo 3 enhancer
(Fig 4C) support our conclusion that the cis-acting elements
required for the hypoxic induction of Epo gene are structurally intact
in P19 cells, but fail to function in a hypoxia-inducible manner. In
contrast, the LDHA gene was hypoxia-inducible in P19 cells. Reporter
constructs containing the LDHA enhancer were also hypoxia-inducible in
P19 cells, as in Hep3B cells. Furthermore, mutational analysis showed
the critical importance of an HIF-1 binding site in this response,
showing that the cellular components required for oxygen sensing and
the subsequent signal transduction pathway leading to HIF-1 are intact in P19 cells. It is one of the possibilities accountable for the noninducibility of the endogenous Epo gene in P19 cells that the 3 enhancer region is not open for HIF-1 to be accessible.
Nevertheless, the fact that the Epo enhancer does not interact with the
cognate or LDHA promoter in P19 cells but interacts in Hep3B cells
(Table 1) indicates that, in understanding why Epo gene expression is not inducible in P19 cells, further analysis of the Epo enhancer 3 to the HIF-1 binding site should be informative.
In hepatoma cells, the 3 region of the Epo enhancer acts to
increase the inducible response to hypoxia and enable operation at a
distance from a promoter.12,32,33 Analysis of this region has demonstrated that these functions are, at least in part, dependent on binding of HNF-4 to a directly repeated nuclear receptor binding motif in this region. Furthermore, in HeLa cells, heterologous expression of HNF-4 was found to increase the hypoxic inducibility of
the cotransfected Epo enhancer.33 This raised the
possibility that absent or insufficient function of HNF-4 in P19 cells
might account for noninducibility of this sequence. However, forced expression of HNF-4 did not stimulate the function of Epo enhancer in
P19 cells (Fig 9), suggesting that this was not the case. Because the
COUP family can antagonize HNF-4 by competing the binding site,33 the COUP family may be highly expressed in P19
cells and responsible for the effect. Interestingly, in mouse
erythroleukemia cells that are non-Epo producing, expression of a
reporter construct containing just the 5 region of mouse Epo
enhancer is hypoxia-inducible, whereas the whole enhancer is inactive,
suggesting that these cells contain a suppressive factor interacting
with the 3 region.18 We examined the reporter
plasmid consisting of Epo promoter and Epo enhancer in which the HNF-4
binding site was deleted. There was no hypoxic induction of the
reporter gene when this plasmid was transfected into P19 cells. In
Hep3B cells, the reporter gene was considerably induced in hypoxia, but
the inducibility was lower than that of the plasmid containing the
whole enhancer (date not shown). These results made it unlikely that
the nonfunctional Epo enhancer in P19 cells is caused by the presence
of COUP family. Alternatively, factors binding at other sites could be
involved. For instance, the sequence just 3 to the HIF-1 binding
site of Epo enhancer is essential for induction by hypoxia, although
this sequence is not well conserved.12,18 Hep3B cells may
express an unidentified protein bound to this region that is absent in P19 cells.
The LDHA enhancer activated its promoter in hypoxia with a similar
efficiency in both P19 and Hep3B cells, whereas the effect of LDHA
enhancer on the Epo promoter was less efficient in P19 cells than in
Hep3B cells (Table 1). These results suggest that P19 cells may be
insufficient in a component that binds to the Epo promoter, causing the
full interaction with the enhancer. In this context, it is interesting
that the sequence 61 to 45 relative to the transcription
start site of the murine Epo gene is required for the 3 enhancer
to be maximally functional and Hep3B nuclear extracts contain proteins
that bind to this region.50
P19 cells differentiate into astrocytes upon treatment with retinoic
acid.35 In addition to the established physiologic function
of Epo in the stimulation of erythropoiesis, we have proposed that Epo
functions as a neurotrophic factor in the central nervous
system.4,8,41,51-53 In the central nervous
system, neurons express Epo receptor51,52,54 and astrocytes
produce Epo.4,41,55 Production of Epo in the brain is also
hypoxia-inducible.4,55,56 Furthermore, Epo infused into the
lateral ventricle by an osmotic minipump protects pyramidal neurons in
the hippocampal CA1 region from ischemia-induced death (manuscript
submitted), and Epo protects the primary cultured
hippocampal and cortical neurons from glutamate toxicity, which is
considered to be a major mechanism in ischemic neuron
death.8 Conditions that differentiate P19 cells (showing noninducible Epo expression) into astrocytes that have acquired hypoxia-inducible Epo production should therefore be of interest. Thus,
P19 cells may be an excellent model for better understanding regulation
of Epo gene expression.
| |
FOOTNOTES |
Submitted June 3, 1997;
accepted September 26, 1997.
Supported by grants-in-aids from the Ministry of Education, Science,
Sports and Culture of Japan, from Snow Brand Milk Products Co, Ltd, and
from Kato Memorial Bioscience Foundation to S.M.
Address reprint requests to Ryuzo Sasaki, PhD, Division of Applied Life
Sciences, Graduate School of Agriculture, Kyoto University, Kyoto
606-01, Japan.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section 1734 solely
to indicate this fact.
| |
REFERENCES |
1.
Bunn HF,
Poyton RO:
Oxygen sensing and molecular adaptation to hypoxia.
Physiol Rev
76:839,
1996[Abstract/Free Full Text]
2.
Krantz SB:
Erythropoietin.
Blood
77:419,
1991[Free Full Text]
3.
Jelkmann W:
Erythropoietin: Structure, control of production, and function.
Physiol Rev
72:449,
1992[Free Full Text]
4.
Masuda S,
Okano M,
Yamagishi K,
Nagao M,
Ueda M,
Sasaki R:
A novel site of erythropoietin production: Oxygen-dependent production in cultured rat astrocytes.
J Biol Chem
269:19488,
1994[Abstract/Free Full Text]
5.
Maxwell PH,
Osmond MK,
Pugh CW,
Heryet A,
Nicholls LG,
Tan CC,
Doe BG,
Ferguson DJP,
Johnson MH,
Ratcliffe PJ:
Identification of the renal erythropoietin-producing cells using transgenic mice.
Kidney Int
44:1149,
1993[Medline]
[Order article via Infotrieve]
6.
Koury ST,
Bondurant MC,
Koury MJ,
Semenza GL:
Localization of cells propducing erythropoietin in murine liver by in situ hybridization.
Blood
77:2497,
1991[Abstract/Free Full Text]
7.
Maxwell PH,
Ferguson DJP,
Osmond MK,
Pugh CW,
Heryet A,
Doe BG,
Johnson MH,
Ratcliffe PJ:
Expression of a homologously recombined erythropoietin-SV40 T antigen fusion gene in mouse liver: Evidence for erythropoietin production by Ito cells.
Blood
84:1823,
1994[Abstract/Free Full Text]
8.
Morishita E,
Masuda S,
Nagao M,
Yasuda Y,
Sasaki R:
Erythropoietin receptor is expressed in rat hippocampal and cerebral cortical neurons, and erythropoietin prevents in vitro glutamate-induced neuronal death.
Neuroscience
76:105,
1997[Medline]
[Order article via Infotrieve]
9.
Semenza GL,
Nejfelt MK,
Chi SM,
Antonarakis SE:
Hypoxia-inducible nuclear factors bind to an enhancer element located 3 to the human erythropoietin gene.
Proc Natl Acad Sci USA
88:5680,
1991[Abstract/Free Full Text]
10.
Beck I,
Ramirez S,
Weinmann R,
Caro J:
Enhancer element at the 3-flanking region controls transcriptional response to hypoxia in the human erythropoietin gene.
J Biol Chem
266:15563,
1991[Abstract/Free Full Text]
11.
Pugh CW,
Tan CC,
Jones RW,
Ratcliffe PJ:
Functional analysis of an oxygen-regulated transcriptional enhancer lying 3 to the mouse erythropoietin gene.
Proc Natl Acad Sci USA
88:10553,
1991[Abstract/Free Full Text]
12.
Semenza GL,
Wang GL:
A nuclear factor induced by hypoxia via de novo protein synthesis binds to the human erythropoietin gene enhancer at a site required for transcriptional activation.
Mol Cell Biol
12:5447,
1992[Abstract/Free Full Text]
13.
Maxwell PH,
Pugh CW,
Ratcliffe PJ:
Inducible operation of the erythropoietin 3 enhancer in multiple cell lines: Evidence for a widespread oxygen-sensing mechanism.
Proc Natl Acad Sci USA
90:2423,
1993[Abstract/Free Full Text]
14.
Madan A,
Curtin PT:
A 24-base-pair sequence 3 to the human erythropoietin gene contains a hypoxia-responsive transcriptional enhancer.
Proc Natl Acad Sci USA
90:3928,
1993[Abstract/Free Full Text]
15.
Beck I,
Weinmann R,
Caro J:
Characterization of hypoxia-responsive enhancer in the human erythropoietin gene shows presence of hypoxia-inducible 120-Kd nuclear DNA-binding protein in erythropoietin-producing and nonproducing cells.
Blood
82:704,
1993[Abstract/Free Full Text]
16.
Wang GL,
Semenza GL:
Characterization of hypoxia-inducible factor 1 and regulation of DNA binding activity by hypoxia.
J Biol Chem
268:21513,
1993[Abstract/Free Full Text]
17.
Wang GL,
Semenza GL:
General involvement of hypoxia-inducible factor 1 in transcriptional response to hypoxia.
Proc Natl Acad Sci USA
90:4304,
1993[Abstract/Free Full Text]
18.
Pugh CW,
Ebert BL,
Ebrahim O,
Ratcliffe PJ:
Characterization of functional domains within the mouse erythropoietin 3 enhancer conveying oxygen-regulated responses in different cell lines.
Biochim Biophys Acta
1217:297,
1994[Medline]
[Order article via Infotrieve]
19.
Wang GL,
Semenza GL:
Purification and characterization of hypoxia-inducible factor 1.
J Biol Chem
270:1230,
1995[Abstract/Free Full Text]
20.
Wang GL,
Jiang BH,
Rue EA,
Semenza GL:
Hypoxia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular O2 tension.
Proc Natl Acad Sci USA
92:5510,
1995[Abstract/Free Full Text]
21.
Jiang BH,
Rue E,
Wang GL,
Roe R,
Semenza GL:
Dimerization, DNA binding, and transactivation properties of hypoxia-inducible factor 1.
J Biol Chem
271:17771,
1996[Abstract/Free Full Text]
22.
Semenza GL,
Roth PH,
Fang HM,
Wang GL:
Transcriptional regulation of genes encoding glycolytic enzymes by hypoxia-inducible factor 1.
J Biol Chem
269:23757,
1994[Abstract/Free Full Text]
23.
Firth JD,
Ebert BL,
Pugh CW,
Ratcliffe PJ:
Oxygen-regulated control elements in the phosphoglycerate kinase 1 and lactate dehydrogenase A genes: Similarities with the erythropoietin 3 enhancer.
Proc Natl Acad Sci USA
91:6496,
1994[Abstract/Free Full Text]
24.
Firth JD,
Ebert BL,
Ratcliffe PJ:
Hypoxic regulation of lactate dehydrogenase A.
J Biol Chem
270:21021,
1995[Abstract/Free Full Text]
25.
Semenza GL,
Jiang BH,
Leung SW,
Passantino R,
Concordet JP,
Maire P,
Giallongo A:
Hypoxia response elements in the aldolase A, enolase 1, and lactate dehydrogenase A gene promoters contain essential binding sites for hypoxia-inducible factor 1.
J Biol Chem
271:32529,
1996[Abstract/Free Full Text]
26.
Levy AP,
Levy NS,
Wegner S,
Goldberg MA:
Transcriptional regulation of the rat vascular endothelial growth factor gene by hypoxia.
J Biol Chem
270:13333,
1995[Abstract/Free Full Text]
27.
Forsythe JA,
Jiang BH,
Iyer NV,
Agani F,
Leung SW,
Koos RD,
Semenza GL:
Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1.
Mol Cell Biol
16:4604,
1996[Abstract]
28.
Nagao M,
Ebert BL,
Ratcliffe PJ,
Pugh CW:
Drosophila melanogaster SL2 cells contain a hypoxically inducible DNA binding complex which recognises mammalian HIF-1 binding sites.
FEBS Lett
387:161,
1996[Medline]
[Order article via Infotrieve]
29.
Ebert BL,
Gleadle JM,
O'Rourke JF,
Bartlett SM,
Poulton J,
Ratcliffe PJ:
Isoenzyme-specific regulation of genes involved in energy metabolism by hypoxia: Similarities with the regulation of erythropoietin.
Biochem J
313:809,
1996
30.
Goldberg MA,
Glass GA,
Cunningham JM,
Bunn HF:
The regulated expression of erythropoietin by two human hepatoma cell lines.
Proc Natl Acad Sci USA
84:7972,
1987[Abstract/Free Full Text]
31.
Goldberg MA,
Dunning SP,
Bunn HF:
Regulation of the erythropoietin gene: Evidence that the oxygen sensor is a heme protein.
Science
242:1412,
1988[Abstract/Free Full Text]
32.
Blanchard KL,
Acquaviva AM,
Galson DL,
Bunn HF:
Hypoxic induction of the human erythropoietin gene: Cooperation between the promoter and enhancer, each of which contains steroid receptor response elements.
Mol Cell Biol
12:5373,
1992[Abstract/Free Full Text]
33.
Galson DL,
Tsuchiya T,
Tendler DS,
Huang LE,
Ren Y,
Ogura T,
Bunn HF:
The orphan receptor hepatic nuclear factor 4 functions as a transcriptional activator for tissue-specific and hypoxia-specific erythropoietin gene expression and is antagonized by EAR3/COUP-TF1.
Mol Cell Biol
15:2135,
1995[Abstract]
34.
Schmitt RM,
Bruyns E,
Snodgrass HR:
Hematopoietic development of embryonic stem cell in vitro: Cytokine and receptor gene expression.
Genes Dev
5:728,
1991[Abstract/Free Full Text]
35.
McBurney MW,
Jones-Villeneuve EMV,
Edwards MKS,
Anderson PJ:
Control of muscle and neuronal differentiation in a cultured embryonal carcinoma cell line.
Nature
299:165,
1982[Medline]
[Order article via Infotrieve]
36.
Goto M,
Murakami A,
Akai K,
Kawanishi G,
Ueda M,
Chiba H,
Sasaki R:
Characterization and use of monoclonal antibodies directed against human erythropoietin that recognize different antigenic determinants.
Blood
74:1415,
1989[Abstract/Free Full Text]
37.
Yagi T,
Tokunaka T,
Furuta Y,
Nada S,
Yoshida M,
Tsukada T,
Saga Y,
Takeda N,
Ikawa Y,
Aizawa S:
A novel ES cell line, TT2, with high germline-differentiating potency.
Anal Biochem
214:70,
1993[Medline]
[Order article via Infotrieve]
38.
Goto M,
Akai K,
Murakami A,
Hashimoto C,
Tsuda E,
Ueda M,
Kawanishi G,
Takahashi N,
Ishimoto A,
Chiba H,
Sasaki R:
Production of recombinant human erythropoietin in mammalian cells: Host-cell dependency of the biological activity of the cloned glycoprotein.
Biotechnology
6:67,
1988
39.
Okano M,
Suga H,
Masuda S,
Nagao M,
Narita H,
Ikura K,
Sasaki R:
Characterization of erythropoietin isolated from rat serum: Biochemical comparison of rat and human erythropoietin.
Biosci Biotech Biochem
57:1882,
1993[Medline]
[Order article via Infotrieve]
40.
Yamaguchi K,
Akai K,
Kawanishi G,
Ueda M,
Masuda S,
Sasaki R:
Effects of site-directed removal of N-glycosylation sites in human erythropoietin on its production and biological properties.
J Biol Chem
266:20434,
1991[Abstract/Free Full Text]
41.
Masuda S,
Chikuma M,
Sasaki R:
Insulin-like growth factors and insulin stimulate erythropoietin production in primary cultured astrocytes.
Brain Res
746:63,
1997[Medline]
[Order article via Infotrieve]
42.
Yokoi H,
Natsuyama S,
Iwai M,
Noda Y,
Mori T,
Mori KJ,
Fujita K,
Nakayama H,
Fujita J:
Non-radioisotopic quantitative RT-PCR to detect changes in mRNA levels during early mouse embryo development.
Biochem Biophys Res Commun
195:769,
1993[Medline]
[Order article via Infotrieve]
43.
Seiler-Tuyns A,
Eldridge JD,
Paterson BM:
Expression and regulation of chicken actin genes introduced into mouse myogenic and nonmyogenic cells.
Proc Natl Acid Sci USA
81:2980,
1984[Abstract/Free Full Text]
44.
Eustice DC,
Feldman PA,
Colberg-Poley AA,
Buckery RM,
Neubauer RH:
A sensitive method for the detection of -galactosidase in transfected mammalian cells.
Biotechniques
11:739,
1991
45.
Galson DL,
Tan CC,
Ratcliffe PJ,
Bunn HF:
Comparison of the human and mouse erythropoietin genes shows extensive homology in the flanking regions.
Blood
82:3321,
1993[Abstract/Free Full Text]
46. Moon SK, Takeuchi S, Kambe T, Tsuchiya T, Masuda S, Nagao M,
Sasaki R: Erythropoietin enhancer stimulates production of a
recombinant protein by Chinese hamster ovary (CHO) cells under hypoxic
condition. Cytotechnology (in press)
47.
Nagao M,
Masuda S,
Abe S,
Ueda M,
Sasaki R:
Production and ligand-binding characteristics of the soluble form of murine erythropoietin receptor.
Biochem Biophys Res Commun
188:888,
1992[Medline]
[Order article via Infotrieve]
48.
Shoemaker CB,
Mitsock LD:
Murine erythropoietin gene: Cloning, expression, and human gene homolgy.
Mol Cell Biol
6:849,
1986[Abstract/Free Full Text]
49.
Lin FK,
Suggs S,
Lin CH,
Browne JK,
Smalling R,
Egrie JC,
Chen KK,
Fox GM,
Martin F,
Stabinsky Z,
Badrawi SM,
Lai PH,
Goldwasser E:
Cloning and expression of the human erythropoietin gene.
Proc Natl Acad Sci USA
82:7580,
1985[Abstract/Free Full Text]
50.
Gupta M,
Goldwasser E:
The role of the near upstream sequence in hypoxia-induced expression of the erythropoietin gene.
Nucleic Acid Res
24:4768,
1996[Abstract/Free Full Text]
51.
Masuda S,
Nagao M,
Takahata K,
Konishi Y,
Gallyas F Jr,
Tabira T,
Sasaki R:
Functional erythropoietin receptor of the cells with neural characteristics: Comparison with receptor properties of erythroid cells.
J Biol Chem
268:11208,
1993[Abstract/Free Full Text]
52.
Morishita E,
Narita H,
Nishida M,
Kawashima N,
Yamagishi K,
Masuda S,
Nagao M,
Hatta H,
Sasaki R:
Anti-erythropoietin receptor monoclonal antibody: Epitope mapping, quantification of the soluble receptor, and detection of the solubilized transmembrane receptor and the receptor-expressing cells.
Blood
88:465,
1996[Abstract/Free Full Text]
53.
Nagao M,
Masuda S,
Ueda M,
Sasaki R:
Erythropoietin processing in erythropoietic system and central nervous system.
Cytotechnology
18:83,
1995
54.
Digicaylioglu M,
Bichet S,
Marti HH,
Wenger RH,
Rivas LA,
Bauer C,
Gassmann M:
Localization of specific erythropoietin binding sites in defined areas of the mouse brain.
Proc Natl Acad Sci USA
92:3717,
1995[Abstract/Free Full Text]
55.
Marti HH,
Wenger RH,
Rivas LA,
Straumann U,
Digicaylioglu M,
Henn V,
Yonekawa Y,
Bauer C,
Gassmann M:
Erythropoietin gene expression in human, monkey and murine brain.
Eur J Neurosci
8:666,
1996[Medline]
[Order article via Infotrieve]
56.
Tan CC,
Eckardt KU,
Firth JD,
Ratcliffe PJ:
Feedback modulation of renal and hepatic erythropoietin mRNA in response to graded anemia and hypoxia.
Am J Physiol
263:F474,
1992[Abstract/Free Full Text]
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
K. Ishihara, T. Yamazaki, Y. Ishida, T. Suzuki, K. Oda, M. Nagao, Y. Yamaguchi-Iwai, and T. Kambe
Zinc Transport Complexes Contribute to the Homeostatic Maintenance of Secretory Pathway Function in Vertebrate Cells
J. Biol. Chem.,
June 30, 2006;
281(26):
17743 - 17750.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Fandrey
Oxygen-dependent and tissue-specific regulation of erythropoietin gene expression
Am J Physiol Regulatory Integrative Comp Physiol,
June 1, 2004;
286(6):
R977 - R988.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Li, R. Issa, P. Kumar, I. N. Hampson, J. M. Lopez-Novoa, C. Bernabeu, and S. Kumar
CD105 prevents apoptosis in hypoxic endothelial cells
J. Cell Sci.,
July 1, 2003;
116(13):
2677 - 2685.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Kambe, J. Tada-Kambe, Y. Kuge, Y. Yamaguchi-Iwai, M. Nagao, and R. Sasaki
Retinoic acid stimulates erythropoietin gene transcription in embryonal carcinoma cells through the direct repeat of a steroid/thyroid hormone receptor response element half-site in the hypoxia-response enhancer
Blood,
November 1, 2000;
96(9):
3265 - 3271.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Abstract
Introduction
Abstract